TOTAL: 1047757 tokens in 61143 types in 199 files 43883 the 36524 of 29790 and 24343 in 16548 a 16243 to 10763 for 10166 with 6807 is 6568 that 5972 - 5845 al 5838 was 5749 et 5140 were 5134 as 4977 J 4767 by 4486 or 4343 on 4045 1 3997 this 3811 patients 3756 be 3691 s 3687 are 3571 from 3367 2 3268 at 3161 an 3144 0 3139 M 2909 not 2859 study 2686 3 2583 P 2485 than 2459 have 2329 we 2102 4 2057 These 1967 pain 1923 5 1877 between 1821 C 1789 D 1770 E 1767 it 1723 may 1720 R 1716 which 1709 data 1670 studies 1631 G 1591 using 1591 after 1585 also 1576 been 1568 disease 1567 all 1547 clinical 1527 6 1524 more 1501 treatment 1501 has 1480 group 1476 B 1433 analysis 1413 h 1405 Cancer 1400 No 1379 L 1358 T 1345 other 1334 can 1312 cells 1290 2013 1281 10 1278 but 1258 7 1227 K 1210 N 1202 2012 1190 used 1187 risk 1169 time 1149 2011 1146 their 1132 8 1124 results 1105 Imaging 1091 less 1088 patient 1082 Our 1074 during 1072 both 1071 Health 1054 who 1052 2010 1048 there 1041 Research 1032 associated 1015 However 1014 9 986 age 984 One 981 Such 977 Care 969 had 966 brain 963 cell 946 only 940 significant 939 2009 928 each 926 Surgery 924 human 922 compared 914 i 908 effect 907 effects 907 2008 881 different 851 when 851 use 845 Med 842 increased 839 Children 833 expression 818 number 818 found 816 reported 815 years 815 F 809 muscle 801 12 792 they 783 model 780 20 774 groups 767 because 760 levels 749 exercise 743 2007 737 blood 733 Higher 731 women 728 chronic 724 evidence 722 two 710 control 709 tumor 706 factors 705 changes 703 most 686 response 686 first 685 11 678 within 673 performed 673 could 673 although 671 assessment 669 review 666 quality 662 high 653 w 649 Y 649 function 647 University 646 Table 641 those 640 activity 638 including 636 into 633 system 631 15 627 Based 626 trial 626 new 626 2006 620 test 617 Medical 614 some 614 MD 605 IF 604 greater 600 18 598 mice 596 Among 595 14 593 gene 588 Fig 586 any 582 differences 581 Figure 577 13 575 v 575 important 571 would 571 showed 569 significantly 568 retinal 568 outcomes 568 AM 562 2014 559 lower 557 well 557 cases 547 increase 546 30 542 its 541 months 538 over 537 shown 537 2005 536 participants 535 Hospital 534 24 532 included 525 total 524 development 523 will 522 should 522 findings 522 early 521 training 518 potential 516 methods 509 observed 507 did 505 Similar 502 protein 500 role 499 therapy 498 Department 497 performance 496 Res 491 social 486 rate 484 population 482 low 481 tissue 481 primary 480 16 479 further 477 level 477 17 476 information 476 Association 474 22 472 available 472 2003 471 21 470 outcome 470 disorders 469 2004 468 mean 467 stroke 467 95 463 through 460 Thus 458 trials 454 cholesterol 454 adults 454 19 453 25 452 without 452 PubMed 450 Life 448 Aging 446 related 446 difference 442 Sci 441 following 438 reduced 436 neurons 434 same 433 mg 431 survival 431 Clin 430 Many 428 Several 427 National 426 values 425 While 423 three 421 mitochondrial 421 measures 419 per 418 Management 417 MR 415 method 414 loss 412 volume 412 specific 408 present 407 depression 406 mM 406 about 404 therefore 403 factor 401 O 401 models 401 23 400 whether 396 Small 395 general 394 value 392 functional 390 normal 390 before 389 Medicine 388 DE 387 50 384 addition 383 anxiety 381 AMD 380 2001 379 cognitive 378 day 378 2002 375 type 375 score 374 100 372 28 371 symptoms 371 obtained 371 likely 370 current 369 disorder 367 relative 367 rates 367 31 365 p53 364 sample 364 report 364 change 364 26 360 Evaluation 358 postoperative 358 http 358 case 358 27 357 required 357 macular 354 physical 354 Cardiovascular 353 considered 353 breast 351 received 351 positive 351 authors 350 mutant 349 Program 348 standard 347 mortality 347 drug 347 diagnosis 346 central 345 2000 344 reduction 343 interest 343 Biol 342 Statistical 341 then 341 delivery 341 acute 339 vs 339 previous 339 possible 339 images 338 respectively 338 American 337 assessed 336 major 334 genes 333 retina 333 multiple 332 approach 331 40 330 due 330 do 330 35 328 motor 326 single 325 practice 325 given 324 baseline 322 CI 321 overall 321 flow 320 size 320 previously 319 subjects 319 Individuals 318 work 318 might 318 activation 318 acid 317 Parkinson 316 Van 316 range 316 measured 316 complex 315 Radiotherapy 314 stuttering 314 PD 314 large 313 fatigue 312 analyses 311 Second 311 controls 310 severe 310 heart 310 either 309 being 308 very 307 tumors 307 Psychiatry 307 negative 307 criteria 305 even 304 support 304 How 303 Genetic 302 days 302 32 301 where 301 stress 301 show 301 older 301 individual 300 improvement 300 identified 299 scores 299 demonstrated 298 provide 298 people 297 under 297 conditions 296 34 294 described 293 result 293 example 293 does 293 -- 292 receptor 292 body 290 Recent 290 29 289 process 288 samples 288 need 287 mL 285 versus 285 plasma 285 defined 284 regions 283 randomized 283 emergency 280 status 280 Speech 280 progression 280 follow-up 279 Intervention 279 Diseases 277 diabetes 277 common 277 according 277 36 276 surgical 276 intensity 276 duration 276 comparison 276 characteristics 275 visual 275 variables 275 Institute 274 USA 274 pediatric 274 Age-related 273 known 273 design 273 decreased 271 treated 271 safety 271 growth 271 Eye 270 presence 270 33 269 period 269 bone 268 relationship 268 men 268 measurement 268 ed 266 Additional 265 ratio 265 measure 265 contrast 264 sensitivity 264 long-term 264 area 262 interventions 262 across 261 Screening 260 tests 260 lesions 260 healthy 259 so 259 Mutations 258 suggest 258 serum 258 least 258 aged 257 us 257 proteins 257 prevalence 257 concentrations 256 weeks 256 published 256 provided 256 Image 256 drusen 256 60 255 ability 254 anesthesia 253 testing 253 psychiatric 253 events 253 Center 252 independent 251 year 251 UK 251 mouse 250 rest 248 impact 247 U 247 states 247 part 247 length 247 05 246 incidence 245 programs 245 presented 245 phase 245 37 244 see 244 interaction 243 target 243 PET 243 efficacy 242 Ophthalmol 241 Scale 240 out 240 MRI 240 AD 238 include 237 whereas 236 X 236 resistance 236 maternal 236 literature 235 www 235 mechanisms 235 effective 235 degeneration 234 determined 233 responses 233 alpha-synuclein 232 strength 231 systematic 230 point 230 guidelines 230 controlled 229 stage 229 relevant 229 dose 228 end 228 antibody 227 peripheral 226 rats 226 diagnostic 225 region 224 therapeutic 224 org 224 interval 224 energy 224 cohort 224 better 224 another 223 procedures 222 United 222 sports 222 influence 221 Z 221 stutter 221 prognostic 221 Network 221 median 221 identify 221 future 220 vivo 220 Neurosci 220 local 219 up 219 MA 219 dysfunction 219 determine 218 limited 218 increasing 217 set 217 PhD 217 humans 217 complications 217 38 216 molecular 216 45 215 impairment 215 developed 214 via 214 vascular 214 protocol 214 consistent 213 systems 213 RPE 213 affected 213 42 212 what 212 min 211 Neurol 210 Mol 210 initial 210 experience 210 CA 210 assess 210 Animals 210 adult 209 tomography 209 Signal 209 Key 209 approximately 208 relatively 208 Detection 208 1999 207 manuscript 206 often 206 Committee 205 secondary 205 features 205 decrease 205 cause 205 adverse 204 average 203 Wang 203 points 203 parameters 203 correlation 203 calculated 203 binding 202 variability 201 rather 201 Oct 200 nature 200 lung 200 improve 200 Furthermore 200 evaluated 200 bias 200 article 200 90 199 online 199 Head 199 DNA 199 attenuation 199 1998 198 form 198 Discussion 198 CT 198 arterial 197 measurements 197 made 197 diet 197 CM 197 classification 196 weight 196 Oncol 196 intervals 196 affect 195 White 195 pathology 195 main 195 content 195 concentration 194 References 194 longer 194 best 194 administration 193 prostate 193 oxidative 193 cortex 193 Author 193 analyzed 193 accuracy 192 exposure 192 41 191 Young 191 state 191 prospective 191 Physiol 191 nerve 191 Journal 191 experimental 191 diffusion 190 pregnancy 190 particular 189 HP 189 001 188 them 188 seen 188 reports 188 lack 188 drugs 188 death 188 46 188 43 188 39 187 Int 186 School 186 recovery 186 prevention 186 involved 186 DME 186 48 185 stimulation 185 Society 185 proportion 185 increases 185 improved 184 rituximab 184 complete 184 capacity 183 obesity 183 None 183 metabolism 183 four 183 distribution 183 44 182 Education 181 times 181 Structure 181 Short 181 Rev 181 movement 181 Dr 180 severity 180 processes 180 mutation 180 accumulation 180 1997 179 significance 179 novel 179 microglia 179 inflammation 179 hours 179 despite 179 Ann 178 team 178 above 177 threshold 177 Since 177 history 177 field 177 critical 177 cardiac 176 techniques 176 procedure 176 meta-analysis 175 perfusion 175 fact 175 direct 175 antibodies 175 52 175 51 174 types 174 reduce 174 Optical 174 MDT-15 174 cost 173 processing 173 OPIOID 173 monitoring 173 Failure 173 conducted 172 suggesting 172 recently 172 plus 172 Arch 172 49 171 much 171 motion 171 miR-135b 171 Lee 171 injection 171 areas 171 Animal 171 80 170 task 170 revealed 170 proposed 170 needed 170 morbidity 170 learning 170 active 170 Acad 169 suggests 169 matter 169 hypothesis 168 shows 168 schizophrenia 168 pathway 167 uptake 167 Signaling 167 regulation 167 KM 167 established 167 Chen 167 Br 166 markers 166 lead 166 doi 166 benefit 166 70 165 strategy 165 prior 165 Examination 165 clinically 164 quantitative 164 good 164 especially 163 suggested 163 left 163 International 163 final 163 currently 163 75 163 65 162 limitations 162 finding 162 against 161 must 161 liver 161 lipid 161 larger 161 Ageing 161 1996 160 understanding 160 pressure 160 mass 160 equal 160 advanced 159 tissues 159 index 159 Child 158 tested 158 production 158 populations 158 magnetic 158 long 158 expected 158 detected 157 vitamin 157 upper 157 tool 157 Smith 157 particularly 157 order 157 laboratory 157 La 157 insulin 157 injury 156 resulting 156 pathways 156 basis 155 MS 155 mitochondria 155 GA 155 food 155 confidence 155 biomarkers 154 version 154 side 154 kidney 154 interpretation 154 focus 154 examined 154 approved 154 53 153 supported 153 source 153 moderate 153 full 152 temporal 152 regression 152 environment 152 directly 152 coronary 152 caused 152 Applied 151 poor 151 Melanoma 151 diabetic 151 database 150 Science 150 neuronal 150 Mental 150 JA 150 interactions 150 impaired 150 damage 150 compliance 149 yet 149 SD 149 investigated 149 Every 148 various 148 technique 148 syndrome 148 statistically 148 Sport 148 Preterm 148 Moreover 148 membrane 148 JM 147 still 147 sham 147 remains 147 rat 147 mRNA 147 few 147 Eur 147 Conclusions 147 47 146 transfer 146 suppression 146 resulted 146 palliative 146 induced 146 II 146 density 146 cellular 146 accessed 145 right 145 preoperative 145 contribute 144 ultrasound 144 term 144 provides 144 pattern 144 JR 144 estimated 144 calcium 144 appropriate 144 ADC 144 55 143 Neck 143 Nat 143 importance 143 condition 143 collection 143 Accepted 142 treatments 142 terms 142 means 142 endothelial 142 combination 141 Surg 141 supplemental 141 site 141 phenotype 141 memory 141 grade 141 frequency 141 confirmed 141 adaptation 141 000 140 late 140 Hospitals 140 Here 139 World 139 reference 139 recorded 139 family 139 corresponding 138 Step 138 skeletal 138 simple 138 resolution 138 prediction 138 Power 138 necessary 138 highly 138 coherence 138 altered 137 respiratory 137 Public 137 position 137 patterns 137 optimal 137 onset 137 indicate 137 College 137 amount 136 true 136 having 136 Genet 136 correction 136 assay 136 adolescents 136 address 136 ac 136 64 135 Vis 135 Li 135 inhibition 135 falls 135 expressed 135 costs 135 com 135 a-synuclein 135 acquisition 135 57 134 Proc 134 potentially 134 percentage 134 occur 134 consensus 134 below 134 behavior 134 able 134 85 134 61 133 Regional 133 noted 133 inflammatory 133 Finally 133 experiments 133 excluded 133 evaluate 133 birth 132 velocity 132 targeting 132 specifically 132 IkBalpha 132 conclusion 132 Chem 132 artery 131 se 131 RA 131 later 131 derived 131 absence 131 54 130 specificity 130 selection 130 Neurology 130 networks 130 Medication 130 Five 130 clear 130 causes 130 Australia 130 approaches 130 account 129 RNA 129 Radiation 129 nuclear 129 lesion 129 Introduction 129 implant 129 help 129 glycogen 129 dopamine 129 Da 129 alone 129 73 129 72 129 56 128 Third 128 series 128 layer 128 indicated 128 clinic 128 cataract 127 zoledronic 127 strong 127 standardized 127 selected 127 persons 127 maximal 127 formation 127 er 127 auditory 127 arm 127 Adjustment 127 01 126 Software 126 McArdle 126 leading 126 essential 126 context 126 class 125 variation 125 useful 125 transplantation 125 subject 125 recommendations 125 problems 125 now 125 metastases 125 followed 125 Alzheimer 125 58 124 Technology 124 systemic 124 strategies 124 Services 124 fetal 124 chemotherapy 124 Apathy 124 63 124 59 123 Resonance 123 Neurosurgery 123 metabolic 123 laparoscopic 123 combined 123 1995 122 targets 122 Survey 122 randomised 122 perioperative 122 oxygen 122 occurred 122 neural 122 knowledge 122 biomarker 122 activities 121 Similarly 121 section 121 retinopathy 121 regarding 121 physicians 121 oral 121 old 121 mechanism 121 EG 121 difficult 121 Developmental 121 consent 120 reviewed 120 probability 120 material 120 like 120 kg 120 JL 120 correlated 120 cannot 120 biological 120 62 119 search 119 Peptide 119 Natl 119 majority 119 line 119 inclusion 119 implications 119 Identification 119 absolute 118 SNCA 118 Sciences 118 reporting 118 Kim 118 hormone 118 highest 118 funding 118 elevated 118 domain 118 cortical 117 York 117 rapid 117 publication 117 properties 117 Liu 117 collected 116 showing 116 setting 116 project 116 phosphorylation 116 generally 116 fall 116 earlier 116 degree 116 attention 116 Anderson 115 Zhang 115 vitro 115 view 115 subsequent 115 scan 115 problem 115 players 115 miRNA 115 maximum 115 fundus 115 estimate 115 diagnosed 115 contribution 115 AWS 115 access 114 variable 114 spinal 114 sections 114 Press 114 MJ 114 miRNAs 114 metastatic 114 members 114 Lancet 114 immune 114 effectiveness 114 components 114 Ca2 114 allow 113 until 113 tendon 113 preeclampsia 113 Pediatrics 113 off 113 last 113 global 113 Exp 113 constraints 113 Constraint 113 67 112 informed 112 event 112 culture 112 containing 112 comparable 112 choline 112 Cav1 112 68 111 younger 111 virus 111 Supplementary 111 Renal 111 pathological 111 nonword 111 mood 111 light 111 issue 111 distinct 111 dietary 111 degrees 111 colorectal 111 91 110 whole 110 Taken 110 repeated 110 patellar 110 observation 110 longevity 110 induction 110 decision 110 comparing 110 Catastrophizing 109 past 109 investigation 109 glucose 109 Engl 109 Ebola 108 working 108 together 108 PSA 108 progressive 108 predictive 108 pH 108 NCX3 108 language 108 FRA 108 extent 108 DEX 108 Comprehensive 108 complement 108 1993 107 way 107 vision 107 validity 107 Summary 107 sites 107 scientific 107 requires 107 peak 107 Ophthalmology 107 developing 107 decline 107 Comparisons 107 block 107 background 107 1994 106 transcription 106 studied 106 receiving 106 nonwords 106 Invest 106 III 106 financial 106 Eds 106 edema 106 dementia 106 assessments 105 ve 105 Statistics 105 SN 105 smoking 105 question 105 PLoS 105 ocular 105 investigate 105 environmental 105 complexity 105 behavioral 105 abnormal 105 69 104 receptors 104 placebo 104 outer 104 neurological 104 Multivariate 104 mm2 104 make 104 labeled 104 free 104 develop 104 conflicts 104 compare 104 ASD 104 algorithm 103 typically 103 Trends 103 transmission 103 spatial 103 robotic 103 Prognosis 103 Pregabalin 103 predictors 103 phenotypes 103 Next 103 hand 103 fluid 103 component 103 Assessing 103 angiography 102 six 102 represent 102 race 102 questions 102 PCR 102 odds 102 longitudinal 102 Inference 102 ID 102 folate 102 enhanced 102 demonstrate 102 deficiency 102 conventional 102 biopsy 102 assigned 101 rehabilitation 101 promoter 101 others 101 detect 101 deficits 101 Centre 101 alternative 100 synthesis 100 SD-OCT 100 reliability 100 posterior 100 mutants 100 month 100 minutes 100 knee 100 investigators 100 Inc 100 feedback 100 exposed 100 dynamic 100 dopaminergic 100 delivered 100 daily 100 characterized 100 Back 100 associations 100 appear 100 200 99 week 99 unknown 99 surface 99 Substantial 99 session 99 output 99 obese 99 numbers 99 Hum 99 hospice 99 EEG 99 Doppler 99 cycle 99 core 99 Clearly 99 categories 99 application 99 androgen 99 act 99 93 98 Sep 98 reducing 98 objective 98 laser 98 isolated 98 injuries 98 He 98 HBOC-201 98 estimates 98 CPX 98 abnormalities 98 71 97 WMH 97 understand 97 therapies 97 retention 97 relationships 97 Participant 97 little 97 joint 97 gain 97 frequently 97 figures 97 digital 97 designed 97 depressed 97 beyond 97 allele 97 96 96 volleyball 96 synaptic 96 ST 96 smaller 96 seems 96 SA 96 Radiology 96 Q 96 PQ 96 myocardial 96 JAMA 96 issues 96 HIV 96 functions 96 circulation 96 cerebral 96 athletes 96 alterations 95 undergoing 95 toward 95 space 95 require 95 invasion 95 Healthcare 95 female 95 fat 94 wild-type 94 thickness 94 structural 94 play 94 partners 94 met 94 marker 94 Indeed 94 done 94 dependent 94 course 94 carcinoma 94 become 94 allowed 94 agreement 94 Acta 94 89 94 77 93 subretinal 93 psychological 93 membranes 93 continuous 93 administered 93 added 93 academic 92 words 92 superior 92 subgroup 92 skin 92 purpose 92 profile 92 paper 92 Panel 92 linked 92 LB 92 JP 92 JJ 92 Germany 92 eGFR 92 Corneal 92 childhood 92 Anesthesiology 92 analgesia 92 Along 92 81 91 variants 91 variance 91 validation 91 unique 91 underwent 91 theory 91 room 91 referred 91 questionnaire 91 physician 91 neovascularization 91 needs 91 matched 91 labeling 91 internal 91 IE 91 ibrutinib 91 error 91 curve 91 classified 91 Appendix 91 94 91 66 90 Unit 90 tendinopathy 90 sufficient 90 regulatory 90 prevent 90 post 90 neonatal 90 modified 90 mild 90 ELISA 90 elegans 90 DL 90 date 90 Cone 90 completed 90 colleagues 90 coefficient 90 Circulating 90 Centers 90 cancers 89 shorter 89 predict 89 policy 89 PA 89 led 89 Johnson 89 January 89 hemorrhage 89 gov 89 EM 89 differentiation 89 depressive 89 correct 89 consequences 89 choroidal 89 action 89 achieved 88 upon 88 sex 88 making 88 lifespan 88 JC 88 infection 88 DM 88 consumption 88 Anaesthesia 88 87 88 1990 87 Supporting 87 steroid 87 stability 87 remain 87 Quantification 87 muscles 87 just 87 indicating 87 grant 87 Fac 87 detailed 87 Conflict 87 communication 87 acquired 87 92 87 76 86 targeted 86 soft 86 signals 86 relation 86 prescription 86 Phys 86 Oncology 86 note 86 microRNAs 86 Matrix 86 Materials 86 maintenance 86 homeostasis 86 her 86 forms 86 focused 86 far 86 Details 86 contributed 86 Abstract 85 successful 85 reflect 85 reasons 85 pregnant 85 Nucl 85 intake 85 DMD 85 Disord 85 cytokines 85 computed 85 benefits 85 annual 85 98 85 74 84 thank 84 speed 84 sets 84 represents 84 ratios 84 produce 84 lM 84 inner 84 implementation 84 Immediate 84 hippocampal 84 guidance 84 gender 84 cleavage 84 99 84 78 84 110 83 vessel 83 underlying 83 synchronization 83 sources 83 responsible 83 relevance 83 pulmonary 83 providers 83 occurs 83 NMDAR 83 microRNA 83 magnitude 83 localization 83 Interestingly 83 experienced 83 drink 83 community 83 Cilengitide 83 88 83 86 83 83 82 Williams 82 steroids 82 Researchers 82 reduces 82 original 82 nm 82 Malignant 82 male 82 mainly 82 involvement 82 Institutional 82 instead 82 December 82 Coupling 82 CLL 82 chemoembolization 82 cesarean 82 carried 82 August 82 AJ 82 adjusted 82 additionally 82 Abuse 81 Wu 81 solution 81 smooth 81 short-term 81 resection 81 recommended 81 protocols 81 Physiological 81 opt 81 medium 81 medications 81 involving 81 injections 81 initially 81 improvements 81 hr 81 Encephalitis 81 degradation 81 Co 81 cervical 81 applications 80 youth 80 trend 80 take 80 subunit 80 structures 80 strongly 80 species 80 South 80 selective 80 proliferation 80 predicted 80 phantom 80 existing 80 elderly 80 Differential 80 Council 80 balance 80 accurate 80 82 79 stages 79 sessions 79 remained 79 reductions 79 providing 79 possibility 79 photoreceptor 79 OS 79 marijuana 79 improving 79 functioning 79 Dyadic 79 bipolar 79 aspects 78 Yang 78 variety 78 success 78 STAS 78 spontaneous 78 Singleton 78 RTP 78 rejection 78 receive 78 Psychosocial 78 profiles 78 links 78 lines 78 Foundation 78 explain 78 cervix 78 achieve 77 why 77 vessels 77 tumours 77 subsequently 77 subgroups 77 segmentation 77 RJ 77 respect 77 regard 77 pump 77 primarily 77 March 77 location 77 limb 77 gestation 77 force 77 errors 77 ERAS 77 eligible 77 DJ 77 differ 77 Di 77 der 77 definition 77 burden 77 agents 77 84 77 79 77 1992 77 1991 76 Washington 76 USCOM 76 unlikely 76 stimuli 76 SJ 76 sensitive 76 PP 76 pigment 76 overexpression 76 Obstet 76 Nutr 76 measuring 76 maintained 76 kinase 76 June 76 HDL 76 Epidemiology 76 doses 76 Dis 76 concept 76 avoid 76 atherosclerosis 76 appears 76 already 76 97 75 usually 75 trained 75 socioeconomic 75 separate 75 restriction 75 recurrence 75 Ras 75 Physiology 75 person 75 microglial 75 locomotor 75 inhibitor 75 includes 75 his 75 hepatic 75 frontal 75 find 75 Expansion 75 ethical 75 category 75 Anesth 75 Amantadine 75 Aganirsen 74 wide 74 utility 74 sleep 74 sepsis 74 origin 74 Nevertheless 74 middle 74 lipoprotein 74 link 74 leads 74 gyrus 74 extraction 74 express 74 equation 74 close 74 CAD 74 Bayesian 73 tube 73 SKN-1 73 PR 73 place 73 opioids 73 minimal 73 maps 73 linear 73 latter 73 independently 73 Hence 73 green 73 Gray 73 FDA 73 Ethics 73 discharge 73 countries 73 connectomics 73 Board 73 almost 72 visit 72 tumour 72 transition 72 throughout 72 slow 72 release 72 preliminary 72 PC 72 organization 72 nervous 72 JH 72 JE 72 input 72 illness 72 hypertrophy 72 fear 72 ensure 72 emission 72 determination 72 deep 72 commonly 72 classes 72 awareness 72 Appl 71 validated 71 start 71 SNC 71 SM 71 placed 71 pathogenesis 71 partial 71 ME 71 London 71 leg 71 JW 71 hypertension 71 high-risk 71 generated 71 fully 71 fraction 71 European 71 economic 71 Biology 71 automated 71 approval 71 APC 71 acuity 70 toxicity 70 TE 70 Staging 70 RE 70 RAEs 70 methodology 70 immediately 70 expressing 70 evaluating 70 Dx 70 cross-sectional 70 chain 70 Canada 70 around 70 advantage 70 300 69 visits 69 VA 69 transport 69 transplant 69 symptom 69 sequence 69 risks 69 possibly 69 performing 69 outside 69 once 69 Neurobiol 69 limit 69 Japan 69 ITAS 69 investigator 69 Hu 69 handovers 69 Gynecol 69 genetics 69 entire 69 e-mail 69 distance 69 correlates 69 choice 69 beneficial 69 anti-NMDAR 69 allows 68 widely 68 tools 68 Though 68 sizes 68 retrospective 68 polymorphism 68 persistent 68 perceived 68 minor 68 inpatient 68 inhibitors 68 hippocampus 68 heterogeneity 68 Emerg 68 discussed 68 DCC 68 composition 68 CNS 68 calculation 68 ar 68 Anterior 68 albumin 67 seven 67 settings 67 rectal 67 records 67 randomly 67 prolonged 67 noise 67 Medicare 67 labor 67 ischemic 67 gestational 67 Eyes 67 early-onset 67 count 67 Correspondence 67 contraction 67 conservative 67 basal 67 ACs 67 Acknowledgments 67 abdominal 67 1000 66 Xu 66 Written 66 Widespread 66 topical 66 synapses 66 Suppl 66 sensory 66 scans 66 reason 66 perhaps 66 obtain 66 needle 66 million 66 lowest 66 logistic 66 lateral 66 intensive 66 hypothesized 66 GAP 66 extensive 66 Curr 66 couples 66 BrM 66 ATL 66 assays 66 acids 65 valve 65 unclear 65 serious 65 rare 65 protect 65 progress 65 produced 65 probably 65 PJ 65 personal 65 organ 65 numerous 65 Neuroimaging 65 missing 65 induce 65 hip 65 Gel 65 fatty 65 deaths 65 certain 65 called 65 Brown 65 brief 65 Biochem 65 betaine 65 apparent 65 angle 65 always 65 affinity 64 units 64 TRIP 64 transfusion 64 TA 64 RS 64 regardless 64 recruitment 64 Radiolabeled 64 perform 64 mixed 64 MBq 64 maturation 64 Magnitude-Based 64 indicates 64 identifying 64 hearing 64 Grants 64 glioblastoma 64 Faculty 64 exhibited 64 characterization 64 characteristic 64 A2E 64 106 64 0001 63 withdrawal 63 whom 63 water 63 walking 63 Terrorists 63 statement 63 staining 63 removal 63 Readability 63 participation 63 p110a 63 manner 63 Jones 63 glial 63 Expert 63 excess 63 except 63 endogenous 63 emotional 63 efficiency 63 dysphagia 63 discrimination 63 Del 63 consider 63 connectivity 63 April 63 apoptosis 63 aim 63 500 63 3D 63 120 62 worms 62 Thomas 62 susceptibility 62 Spectral 62 skill 62 situations 62 SI 62 sampling 62 remaining 62 reading 62 random 62 qualitative 62 predictor 62 Netherlands 62 maintain 62 lost 62 likelihood 62 Le 62 interests 62 hazards 62 fractions 62 fibrinogen 62 fibers 62 external 62 difficulties 62 depletion 62 depending 62 Demographic 62 DC 62 comparative 62 benign 62 attributed 62 adaptive 62 actions 61 TP 61 Thompson 61 thereby 61 subset 61 She 61 rupture 61 routine 61 residents 61 products 61 preventing 61 PM 61 Pi 61 parameter 61 Leukemia 61 July 61 intracellular 61 induces 61 impairments 61 Gleason 61 genotype 61 February 61 exist 61 Endurance 61 educational 61 ear 61 Dev 61 cost-effectiveness 61 clinicians 61 Clark 61 channels 61 barriers 61 alpha 61 adolescent 61 02 60 WT 60 variations 60 univariate 60 treat 60 too 60 tolerance 60 Taylor 60 summarized 60 spectrum 60 slightly 60 sequences 60 robust 60 reaction 60 psoriasis 60 pilot 60 perspective 60 Metab 60 masking 60 Martin 60 JS 60 Intraneural 60 hospitalization 60 Guide 60 genomic 60 follow 60 fixed 60 fewer 60 examinations 60 evident 60 es 60 electron 60 edu 60 dependence 60 deliveries 60 creatinine 60 contact 60 considering 60 Cognition 60 CJ 60 CD 60 BCVA 60 Australian 60 advantages 59 You 59 Wong 59 volumes 59 transgenic 59 standards 59 serve 59 seem 59 sedation 59 preparation 59 Pediatr 59 parkinsonism 59 osteonecrosis 59 operating 59 open 59 ongoing 59 observations 59 Neuroscience 59 ner 59 mtDNA 59 MBF 59 load 59 injected 59 histological 59 feature 59 failed 59 epithelium 59 embryo 59 CWS 59 changed 59 calcification 59 blocks 59 BC 59 barrier 59 Arg11 59 Anesthesiologists 59 admission 58 thresholds 58 text 58 stable 58 sodium 58 sense 58 scanning 58 revision 58 Resources 58 reached 58 RBC 58 rapidly 58 quantified 58 Pt 58 Peptides 58 pdf 58 organs 58 optic 58 near 58 minimum 58 Keywords 58 KA 58 Geriatr 58 GC 58 families 58 false 58 extension 58 encoding 58 device 58 determining 58 Curcio 58 cord 58 contributions 58 contains 58 conduct 58 CCMSH 58 BTZ 58 adequate 58 101 57 UA 57 traditional 57 synuclein 57 Soc 57 signs 57 scanner 57 rod 57 recruited 57 Psychology 57 Practices 57 Pik3caRBD 57 oxidation 57 neurodegenerative 57 marrow 57 living 57 largely 57 labour 57 kit 57 infarction 57 hazard 57 extracellular 57 epithelial 57 documented 57 distress 57 disability 57 cortisol 57 Cook 57 color 57 Cochrane 57 asked 57 A53T 57 1988 57 107 57 04 56 writing 56 voluntary 56 thought 56 recurrent 56 reach 56 Premature 56 population-based 56 multidisciplinary 56 Modification 56 mediated 56 late-onset 56 JD 56 introduced 56 Huang 56 gabapentin 56 extracted 56 extended 56 evidence-based 56 DG 56 describe 56 cytokine 56 CRC 56 channel 56 ATP 56 150 56 119 55 uses 55 towards 55 theoretical 55 technical 55 Taking 55 Tables 55 substantia 55 stay 55 special 55 San 55 RM 55 repetition 55 record 55 ranging 55 paradigm 55 North 55 neurodegeneration 55 muscular 55 List 55 lipoproteins 55 LDL 55 iv 55 itself 55 Italy 55 Investig 55 invasive 55 integrity 55 instance 55 improves 55 framework 55 follows 55 fast 55 elements 55 correlations 55 availability 55 articles 55 algorithms 55 affects 55 03 54 wall 54 surveillance 54 Service 54 reviews 54 reproducibility 54 Radiol 54 professional 54 prescribing 54 predicting 54 PE 54 Parallel 54 obstetric 54 nr 54 NIH 54 molecules 54 meaningful 54 located 54 limitation 54 jump 54 home 54 grading 54 goal 54 France 54 Embolization 54 diversity 54 CS 54 composite 54 Cohorts 54 chosen 54 calculations 54 BMI 54 blocking 54 aimed 54 accurately 54 Academy 54 1989 54 118 54 109 53 Western 53 ventral 53 typical 53 SL 53 RNAi 53 rating 53 promote 53 postmortem 53 plasticity 53 periods 53 perception 53 Pathologic 53 Park 53 oxycodone 53 own 53 O2 53 NY 53 NR1 53 monitor 53 modalities 53 Miller 53 Milestones 53 Medtronic 53 interview 53 interesting 53 hoc 53 great 53 felt 53 experiment 53 eight 53 disruption 53 continued 53 continue 53 Collaboration 53 coefficients 53 circuit 53 chest 53 bodies 53 autophagy 53 autism 53 anesthetic 53 analgesic 53 a-MSH 53 agent 53 affecting 53 ACC 53 AA 53 117 52 yield 52 Xbp1 52 worse 52 vaginal 52 urine 52 twice 52 SS 52 roles 52 revised 52 Randomisation 52 quartile 52 Psychol 52 polymorphisms 52 Otx2 52 mentioned 52 Mapping 52 Map 52 Intern 52 intermediate 52 implicated 52 immunoreactivity 52 HB 52 Guideline 52 focal 52 flagging 52 excellent 52 establish 52 Epidemiol 52 enrolled 52 efforts 52 dry 52 diameter 52 deposits 52 depends 52 deletion 52 consequence 52 confirm 52 clearance 52 challenges 52 Cambridge 52 Backward 52 atrophy 52 anatomical 52 amino 52 alendronate 52 again 51 visible 51 turn 51 TESPAL 51 tBOOH 51 symptomatic 51 sustained 51 simultaneous 51 sarcopenia 51 running 51 rise 51 removed 51 reality 51 rabbit 51 progenitor 51 practical 51 PPROM 51 phenomenon 51 nor 51 MP 51 mode 51 know 51 initiative 51 game 51 funded 51 enzyme 51 enhance 51 EC 51 displayed 51 direction 51 deficit 51 decreasing 51 Davis 51 criterion 51 controlling 51 challenge 51 calculate 51 Caffeinated 51 base 51 amounts 50 TJ 50 temperature 50 skills 50 shift 50 SH 50 residual 50 rCBVNER 50 placental 50 PB 50 ophthalmic 50 nigra 50 Neuron 50 MC 50 makes 50 leucovorin 50 Lett 50 Institutes 50 influenced 50 incentives 50 graft 50 generation 50 GDNF 50 forward 50 fellowship 50 Exclusion 50 examine 50 employed 50 Dual-Energy 50 divided 50 distributed 50 declare 50 coordination 50 constant 50 concluded 50 blinded 50 AII 50 2-2 50 121 49 tasks 49 symmetry 49 starting 49 sporadic 49 segment 49 RT 49 reliable 49 reformulated 49 participating 49 participated 49 parents 49 MF 49 media 49 Marc 49 manual 49 Klein 49 interpreted 49 HF 49 glutamate 49 fragments 49 explained 49 ethnic 49 equivalent 49 England 49 directed 49 deviation 49 cross 49 CP 49 counts 49 CL 49 brains 49 BD 49 apolipoprotein 49 Analg 49 admitted 49 113 48 whose 48 unable 48 submaximal 48 stereotactic 48 satisfaction 48 requiring 48 relaxation 48 recognized 48 provider 48 promising 48 profiling 48 Price 48 presenting 48 prefrontal 48 pneumonia 48 plays 48 Otherwise 48 observational 48 nonchronic 48 never 48 Neurosurg 48 movements 48 methylation 48 lipofuscin 48 Lin 48 limits 48 intravitreal 48 integrated 48 infants 48 incubated 48 Immunol 48 GBS 48 fibromyalgia 48 familial 48 enough 48 effort 48 division 48 display 48 diagnoses 48 den 48 decreases 48 decisions 48 CSF 48 corticosteroid 48 Concerns 48 comparator 48 cluster 48 Chan 48 BCs 48 allowing 48 5-year 48 125 48 104 47 vestibular 47 topic 47 SR 47 sound 47 sometimes 47 SAS 47 reconstruction 47 RB 47 Ranibizumab 47 Publications 47 product 47 particles 47 normalized 47 Na 47 Morris 47 live 47 IL 47 HCit 47 Fa 47 Epley 47 elite 47 drive 47 cumulative 47 consistently 47 Conference 47 brainstem 47 awake 47 AUC 47 APOE 47 AIP 47 aerobic 47 advancing 47 activated 47 105 47 102 46 Xbp1s 46 word 46 treating 46 transcriptional 46 T2D 46 surgeons 46 supports 46 stored 46 SPSS 46 solutions 46 scored 46 safe 46 return 46 resource 46 requirements 46 probe 46 pathogenic 46 painful 46 options 46 nutrition 46 Natural 46 moving 46 medial 46 lymphocytes 46 layers 46 isolation 46 insula 46 influences 46 importantly 46 histone 46 hemisphere 46 gradient 46 GAS 46 explored 46 explore 46 exact 46 Eustachian 46 endpoint 46 distinguish 46 disclose 46 Dermatol 46 created 46 CE 46 CA1 46 born 46 BJ 46 axonal 46 autoimmune 46 Anaesth 46 ADP 46 103 45 Ward 45 video 45 vector 45 update 45 TW 45 trauma 45 toxic 45 T2 45 supply 45 storage 45 Staff 45 scoring 45 repair 45 Registry 45 reasonable 45 RC 45 proteasome 45 Pharmacol 45 perturbation 45 PCME 45 October 45 newly 45 necessarily 45 nearly 45 mostly 45 manoeuvre 45 Lewy 45 largest 45 ingestion 45 infusion 45 inferior 45 ill 45 hypopharyngeal 45 Howell 45 half 45 Gerontol 45 GE 45 fluorescein 45 extremely 45 Environments 45 Dystrophy 45 driven 45 double 45 discovery 45 detail 45 definitions 45 decades 45 considerable 45 conditioning 45 Computer 45 competency 45 combinations 45 CBb 45 Cardiol 45 beginning 45 autofluorescence 45 arteries 45 actually 45 116 44 worldwide 44 vulnerable 44 VTA 44 Unlike 44 Ther 44 tg 44 strand 44 repeat 44 regulate 44 questionnaires 44 Propofol 44 partner 44 occurring 44 NAP5 44 Nanobody 44 MW 44 multicenter 44 Modeling 44 Menzies 44 meeting 44 lww 44 investigations 44 intrinsic 44 institution 44 IEEE 44 Gait 44 fracture 44 fluency 44 Fisher 44 fields 44 examining 44 ethnicity 44 electronic 44 demand 44 CR 44 consortium 44 Consequently 44 CC 44 buffer 44 Baker 44 arthritis 44 amplitude 44 advances 44 Adjuvant 44 addressed 44 Accreditation 44 AAGA 44 3B 44 108 44 00 43 viral 43 updated 43 transformation 43 Technologies 43 teams 43 subjective 43 student 43 stimulus 43 slope 43 simply 43 Sequencing 43 SECT 43 SC 43 reveal 43 responsibility 43 Rehabil 43 reactive 43 p-value 43 PS 43 probabilities 43 perinatal 43 pemphigus 43 PBS 43 opportunities 43 obstetricians 43 monkeys 43 methodological 43 metastasis 43 MeSH 43 lymphocytic 43 lipids 43 lacking 43 KR 43 ischemia 43 genome 43 frequent 43 frailty 43 FICB 43 expectant 43 equally 43 elasticity 43 EA 43 Disclosures 43 decade 43 cultured 43 Craig 43 correlate 43 completely 43 changing 43 Chang 43 broad 43 Boston 43 blastocyst 43 bilateral 43 axis 43 ages 43 400 43 1983 43 133 42 West 42 urinary 42 ultimately 42 swine 42 strengths 42 somewhat 42 Scand 42 scales 42 reveals 42 Representative 42 regulated 42 real-time 42 radiosurgery 42 presentation 42 Pitx3 42 Pathol 42 option 42 Notably 42 NHP 42 morphology 42 MMN 42 kinematic 42 IOP 42 Graduate 42 geographic 42 fluorescence 42 EPC 42 downstream 42 died 42 detecting 42 deposition 42 define 42 contain 42 consideration 42 connections 42 compromise 42 Colon 42 CNV 42 CD7N 42 causing 42 basic 42 assistance 42 aspiration 42 ANOVA 42 analysed 42 AEs 42 Ab 42 3A 42 1985 41 yr 41 ways 41 verbal 41 utilization 41 subunits 41 substantially 41 stem 41 sphincter 41 Spain 41 RRT 41 RNAs 41 Rich 41 rf 41 resting 41 resident 41 residency 41 recovered 41 protective 41 pair 41 Obstetrician 41 neuroinflammation 41 member 41 macula 41 L-type 41 leakage 41 Iron 41 Ire1 41 intracranial 41 intact 41 inspiratory 41 indication 41 idea 41 ice 41 graph 41 GJ 41 gave 41 evaluations 41 empirical 41 efficient 41 DS 41 dorsal 41 challenging 41 Calpain 41 Boys 41 box 41 BMJ 41 blind 41 bind 41 alcohol 41 actual 41 123 41 115 41 114 40 webpages 40 vary 40 steps 40 simultaneously 40 Separated 40 restricted 40 requirement 40 regulates 40 Radiat 40 positively 40 planning 40 planned 40 PI3-Kinase 40 phobia 40 Opin 40 oncologic 40 nurses 40 NRS 40 NJ 40 ng 40 neurosurgical 40 neither 40 monoclonal 40 MEP 40 KE 40 instruments 40 housing 40 hamstring 40 GTS 40 Frozen 40 fresh 40 FL 40 feasibility 40 exercises 40 epidemic 40 DOCT 40 diverse 40 directions 40 depth 40 demonstrating 40 CYP27A1 40 commercial 40 Coll 40 Biomed 40 AsPn 40 Antigen 40 1987 40 111 40 09 39 Zhao 39 virtual 39 varied 39 ultrasound-guided 39 TKR 39 temozolomide 39 subtypes 39 speakers 39 SNP 39 simulated 39 serial 39 September 39 sensing 39 saline 39 Retinoblastoma 39 ranges 39 promotes 39 presents 39 potent 39 plane 39 PFS 39 Parent 39 Otolaryngol 39 NSAIDs 39 non-Hispanic 39 nine 39 neuromuscular 39 Neuroimage 39 murine 39 MI 39 matching 39 mammalian 39 M2 39 Lymphocyte 39 loading 39 lip 39 isoform 39 IR 39 interns 39 implemented 39 identical 39 fMRI 39 fentanyl 39 extend 39 explanation 39 endpoints 39 easily 39 dynamics 39 diminished 39 detectable 39 CVF 39 cutoff 39 covariates 39 carriers 39 capture 39 Canadian 39 British 39 BMC 39 believe 39 BA 39 atypical 39 Analogues 39 adaptations 39 accompanied 39 160 39 122 38 von 38 VDBP 38 travel 38 timing 38 ten 38 supplementation 38 solid 38 SG 38 Roche 38 RL 38 RG 38 respond 38 remote 38 reflects 38 reconstructed 38 recommendation 38 reactions 38 reaching 38 ratings 38 radical 38 PW 38 pulse 38 preclinical 38 plan 38 pharyngoplasty 38 overdose 38 off-label 38 nutritional 38 net 38 monitored 38 Marked 38 males 38 lymphoma 38 letters 38 JB 38 investigating 38 intrathecal 38 intraoperative 38 insights 38 hSNCA 38 HJ 38 Hemiparesis 38 GM 38 fiber 38 experts 38 exhibit 38 Exerc 38 excision 38 Epistaxis 38 down 38 diffusion-weighted 38 CV 38 curves 38 confounding 38 concurrent 38 Complication 38 Caenorhabditis 38 Biomedical 38 aspect 38 AP 38 analyze 38 alter 38 Airway 38 AG 38 3rd 38 1984 38 180 38 07 38 06 37 web 37 ventilation 37 variant 37 uterus 37 Tokyo 37 -synuclein 37 stated 37 span 37 smokers 37 scheduled 37 Savings 37 S1 37 Reson 37 resolved 37 representation 37 registered 37 Rapee 37 private 37 predicts 37 positron 37 placebo-controlled 37 pathophysiology 37 paired 37 occurrence 37 null 37 November 37 Mov 37 mixture 37 microscopy 37 meet 37 MAF 37 listed 37 LC 37 IQR 37 involves 37 intended 37 Insurance 37 inhibits 37 immunohistochemical 37 IL-6 37 ICG 37 Hopkins 37 HER2 37 growing 37 Go 37 give 37 GCs 37 femoral 37 face 37 extreme 37 experiences 37 existence 37 episodes 37 Eligibility 37 domains 37 distributions 37 description 37 crucial 37 contained 37 concomitant 37 compounds 37 combining 37 capable 37 Behav 37 appeared 37 Anatomic 37 AHA 37 acceptable 36 Zhu 36 your 36 varying 36 TP53 36 surprising 36 submitted 36 stratification 36 silencing 36 Royal 36 reverse 36 regimen 36 recognition 36 real 36 Rae 36 radioactivity 36 propose 36 programme 36 pretargeting 36 prepared 36 pregnancies 36 precise 36 positives 36 overlap 36 opportunity 36 Oncogene 36 obstructive 36 neovascular 36 MPH 36 modifications 36 mobility 36 mmol 36 mellitus 36 MC1-R 36 lymph 36 localized 36 junctions 36 John 36 JF 36 involve 36 interviews 36 inhibitory 36 infant 36 income 36 hour 36 glaucoma 36 generate 36 etc 36 estimation 36 Dysregulation 36 Drosophila 36 Disclosure 36 DH 36 cytometry 36 CVD 36 Cox 36 cost-effective 36 Cooper 36 Conversion 36 contributes 36 Contrary 36 Colorado 36 cold 36 code 36 ch 36 Built 36 becomes 36 became 36 angiogenesis 36 achievement 36 accordance 36 5MTHF 36 130 35 Yu 35 walk 35 vital 35 Vermont 35 valuable 35 usual 35 Toronto 35 TM 35 surrogate 35 Sun 35 stimulating 35 static 35 started 35 SP 35 SNpc 35 sirolimus 35 Scott 35 S2 35 reservoir 35 representing 35 Rep 35 reflecting 35 red 35 RDS 35 RD 35 raised 35 radionuclide 35 purposes 35 professionals 35 pooled 35 plot 35 persistence 35 parietal 35 Oxford 35 overview 35 NR2B 35 normally 35 nominal 35 metrics 35 MB 35 looking 35 locally 35 LENS 35 IVIM 35 Intraprocedural 35 Instrument 35 inside 35 heavy 35 Headache 35 hard 35 FT 35 foveal 35 facilitate 35 expanded 35 English 35 diets 35 Devices 35 demonstrates 35 deletions 35 declared 35 cycles 35 cultures 35 coping 35 contributing 35 connectome 35 Competing 35 compartment 35 Cohen 35 coding 35 causal 35 Black 35 avoidance 35 autoantibodies 35 attending 35 assumed 35 AQP4 35 accounted 35 1A 34 vulnerability 34 vectors 34 untreated 34 understood 34 trunk 34 translational 34 translation 34 transferred 34 testosterone 34 Telemedicine 34 Tan 34 subpopulations 34 shoulder 34 senescence 34 segments 34 screened 34 reticular 34 registration 34 Recall 34 propensity 34 principal 34 porphyria 34 pemphigoid 34 pathologies 34 participate 34 pairs 34 paid 34 overcome 34 necrosis 34 modulation 34 meta-analyses 34 mature 34 Maternity 34 manufacturer 34 managed 34 ls 34 Lewis 34 lactate 34 Laboratories 34 KL 34 items 34 IQ 34 intelligence 34 inhibit 34 highlight 34 height 34 Harris 34 GACs 34 fit 34 evolution 34 drinks 34 delayed 34 Declaration 34 DBS 34 db 34 David 34 cyclosporine 34 create 34 Copyright 34 Congenital 34 compression 34 CD4 34 CBT 34 candidate 34 California 34 blue 34 bladder 34 Biophys 34 Barcelona 34 athlete 34 ASA 34 architecture 34 applicable 34 anatomy 34 Agency 34 AE 34 adherence 34 absent 34 127 34 1016 33 zone 33 weighted 33 visualization 33 traumatic 33 three-dimensional 33 Therapeutics 33 SW 33 suspected 33 stratified 33 somatic 33 SNPs 33 share 33 Self-report 33 RR 33 recommend 33 ranged 33 quite 33 proper 33 prominent 33 principles 33 pharmacological 33 personality 33 peer 33 owing 33 offered 33 Obstetrics 33 Neurochem 33 neoplastic 33 nausea 33 nasal 33 Michael 33 Merck 33 mediator 33 Magn 33 latent 33 lab 33 kDa 33 JT 33 JK 33 intravenous 33 intraocular 33 IGF-1 33 Hz 33 hsCRP 33 hepatocellular 33 Gupta 33 GS 33 greatest 33 GH 33 Fundamental 33 FRAs 33 Fourth 33 flox 33 fFN 33 fed 33 Facility 33 Endocrinol 33 elsewhere 33 discuss 33 difficulty 33 df 33 crossover 33 concern 33 comorbidities 33 Circ 33 cingulate 33 Chicago 33 bleeding 33 BI-RADS 33 behaviour 33 B16 33 aortic 33 adulthood 33 08 32 yielded 32 wet 32 vomiting 32 unchanged 32 Transfers 32 TDC 32 t1 32 syllable 32 successfully 32 students 32 striatal 32 SNR 32 SK 32 Schmidt 32 Schmetterer 32 reviewers 32 retained 32 Replacement 32 remission 32 referral 32 reclassification 32 radar 32 racial 32 posttransplant 32 postinjection 32 PG 32 perturbed 32 persist 32 Pearson 32 neuropsychiatric 32 nested 32 mT 32 Moore 32 mobilization 32 mediate 32 MACCE 32 LJ 32 Italian 32 isoforms 32 Indicators 32 immunohistochemistry 32 host 32 HM 32 Helsinki 32 Gy 32 gross 32 get 32 fixation 32 fax 32 fasting 32 FAME 32 EZ 32 extremity 32 exists 32 excitability 32 epigenetic 32 entry 32 entered 32 enhancing 32 enhancement 32 endoscopic 32 effectively 32 differentiate 32 definitive 32 defects 32 Deary 32 cycling 32 country 32 contractions 32 consecutive 32 concerning 32 Concepts 32 completion 32 chorioamnionitis 32 Campbell 32 Biodistribution 32 biochemical 32 biases 32 away 32 Automatic 32 appearance 32 antenatal 32 adolescence 32 abundant 32 A30P 32 600 32 112 31 Wilson 31 washed 31 undergo 31 twitch 31 tree 31 transient 31 TH 31 tend 31 Taubert 31 tamoxifen 31 SV 31 supervision 31 spontaneously 31 sought 31 SLS 31 situ 31 reticulum 31 released 31 radionuclides 31 quantify 31 P-values 31 proximal 31 Prog 31 precision 31 poststroke 31 photoreceptors 31 pharmacist 31 Perceptions 31 PDS 31 papers 31 Otolaryngology 31 orientation 31 onto 31 observers 31 non-invasive 31 non-coding 31 nigrostriatal 31 monthly 31 MK 31 masked 31 locus 31 locations 31 interact 31 insufficient 31 infections 31 indications 31 increasingly 31 IL-8 31 ICC 31 helpful 31 harmful 31 harm 31 half-life 31 Gen 31 ganglion 31 frame 31 former 31 formed 31 formal 31 FFPE 31 fail 31 extracts 31 expect 31 eventually 31 Editor 31 Duchenne 31 dual 31 drawn 31 distant 31 depend 31 default 31 covered 31 coupled 31 corrected 31 continues 31 consisting 31 connected 31 compartments 31 CFD 31 asymptomatic 31 array 31 Apart 31 Americans 31 Allen 31 Africa 31 adopted 31 Accordingly 31 1986 30 Zheng 30 yes 30 weak 30 voxel 30 valid 30 usefulness 30 unilateral 30 Transcatheter 30 Trans 30 Top 30 Surveys 30 Surprisingly 30 subjected 30 striatum 30 squat 30 spike 30 speaking 30 soluble 30 separately 30 Secretion 30 schwannomas 30 relapse 30 post-operative 30 positioning 30 portion 30 plots 30 parts 30 OXPHOS 30 oncogenic 30 obvious 30 nucleus 30 NHS 30 NF-kb 30 Murphy 30 molecule 30 migraine 30 midline 30 MGMT 30 Mark 30 lymphoedema 30 lobe 30 leukocyte 30 JG 30 indirect 30 inbred 30 implantation 30 highlighted 30 grid 30 Gold 30 Front 30 fovea 30 expectancy 30 excluding 30 ETD 30 establishing 30 epidemiological 30 en 30 elective 30 elbow 30 eating 30 document 30 dimensions 30 diffuse 30 Demyelinating 30 decision-making 30 databases 30 cytoplasmic 30 cystoid 30 coverage 30 constructed 30 composed 30 Competition 30 ck 30 CBA 30 carotid 30 Cardiovasc 30 births 30 Belgium 30 beam 30 attributable 30 Arena 30 ahead 30 2A 30 131 29 WM 29 WA 29 Vasc 29 VAR 29 undertaken 29 Uncertainty 29 tubes 29 transporter 29 Transitions 29 tone 29 TFS 29 T-cell 29 tau 29 substance 29 structured 29 spine 29 specimens 29 SNAQ 29 sign 29 separation 29 self-reported 29 seeking 29 scope 29 Rodriguez 29 ROC 29 relief 29 regular 29 reflected 29 randomization 29 put 29 pure 29 protection 29 preferred 29 plans 29 PL 29 picture 29 percent 29 partially 29 Onslow 29 offer 29 Objectives 29 notion 29 nodes 29 NMDA 29 nil 29 Myers 29 move 29 motivation 29 modulate 29 MDD 29 lungs 29 limiting 29 kinetics 29 keratitis 29 keratinocytes 29 judged 29 James 29 Jackson 29 institutions 29 insight 29 hSNCA140 29 HOX 29 hormones 29 FOV 29 focusing 29 Federal 29 feasible 29 FAF 29 experiencing 29 enhances 29 Engineering 29 enable 29 element 29 eccentric 29 dye 29 DP 29 dominant 29 dilution 29 differed 29 deliver 29 deemed 29 corresponds 29 Conversely 29 consisted 29 computational 29 Comp 29 clusters 29 classical 29 chromatin 29 choroid 29 cessation 29 CD4t 29 CAST 29 Cardiology 29 camera 29 calculating 29 Biochemistry 29 behaviors 29 axial 29 attractive 29 Assoc 29 AOSLO 29 anorexia 29 adjacent 29 add 29 adapted 29 64Cu 28 zinc 28 xls 28 WJ 28 Vitelliform 28 vasculature 28 t-test 28 Thromb 28 TEM 28 synthase 28 survivors 28 sum 28 Sullivan 28 squamous 28 spread 28 simulation 28 signatures 28 Sigma 28 shared 28 select 28 SDD 28 routinely 28 Robert 28 RH 28 resistant 28 regimens 28 receiver 28 readers 28 rationale 28 provision 28 Professor 28 productions 28 produces 28 procedural 28 print 28 Pretargeted 28 predominantly 28 PIR 28 Pik3caWT 28 PIK3CA 28 PI3K 28 oxide 28 OPRM1 28 ones 28 Office 28 Nucleic 28 noninvasive 28 neurotrophic 28 neurotoxicity 28 Neurophysiol 28 neuropathic 28 neoadjuvant 28 Nanobodies 28 namely 28 multilevel 28 minute 28 miniature 28 migration 28 metabolites 28 mediators 28 mechanistic 28 Louis 28 look 28 log-rank 28 ller 28 large-scale 28 Knight 28 kinematics 28 KH 28 KC 28 interference 28 integration 28 initiation 28 incremental 28 IgG 28 identity 28 Heimberg 28 Graded 28 Government 28 George 28 gastrointestinal 28 Fischer 28 Figs 28 females 28 F1 28 enzymes 28 enriched 28 edge 28 distinguishing 28 discussions 28 delay 28 Defining 28 CYP46A1 28 CU 28 consists 28 conflicting 28 colonisation 28 closely 28 charges 28 CDC 28 caffeine 28 BVMD 28 BS 28 Bruch 28 BPPV 28 BM 28 Award 28 assist 28 analyzing 28 alteration 28 Alloxan 28 alleles 28 Advisory 28 adequately 28 ACGME 28 acetonide 28 3-NPC 28 279 28 250 28 2011b 28 1976 28 166 28 140 28 136 27 weakness 27 voxels 27 vein 27 VCO2 27 upregulation 27 unaffected 27 TX 27 treadmill 27 tended 27 TB 27 Switzerland 27 STS 27 spectrometry 27 socio-economic 27 soccer 27 so-called 27 smoke 27 run 27 Ross 27 Respir 27 rapamycin 27 proportional 27 policies 27 Peters 27 Patient-reported 27 Packman 27 opinion 27 offers 27 nose 27 NK 27 Nguyen 27 neurosteroids 27 nervosa 27 mothers 27 MOG 27 modern 27 milliseconds 27 MH 27 medically 27 mechanical 27 meaning 27 match 27 massive 27 man 27 library 27 Iverach 27 Interventional 27 In-hospital 27 inhibited 27 inducing 27 indicator 27 incorporate 27 hormonal 27 horizontal 27 holds 27 High-Quality 27 Hansen 27 German 27 G-CSF 27 gamma 27 fractures 27 foods 27 FE 27 facilities 27 Examples 27 epilepsy 27 EP 27 emerging 27 electrophoresis 27 EJ 27 edges 27 echo 27 durations 27 duplication 27 DMDD 27 distinction 27 dexamethasone 27 demands 27 dedicated 27 cut-off 27 critically 27 contrast-enhanced 27 consultant 27 CIs 27 Cigarette 27 Cheng 27 chemical 27 CG 27 CF 27 capillary 27 Bull 27 Briefly 27 biosynthesis 27 behaviours 27 behavioural 27 b0 27 art 27 arms 27 AREDS 27 aid 27 aggressive 27 acknowledge 27 2012a 27 135 27 126 27 1-1 26 Zeisel 26 Wood 26 whole-brain 26 Viewed 26 tracking 26 TNFalpha 26 think 26 stenosis 26 Stein 26 specimen 26 shock 26 severely 26 RW 26 RK 26 Riley 26 respective 26 recognize 26 reasoning 26 Quinn 26 processed 26 post-exercise 26 pool 26 platform 26 Phillips 26 pay 26 p65 26 negatively 26 Name 26 myophosphorylase 26 Muller 26 morphine 26 MO 26 mediates 26 Massachusetts 26 marital 26 manifestations 26 mammography 26 Lincoln 26 lg 26 KO 26 KJ 26 Khan 26 Jaw 26 Invitrogen 26 investigational 26 inputs 26 initiated 26 Infrared 26 illustrate 26 identifies 26 hydroxychloroquine 26 html 26 Hong 26 Hoffman 26 hockey 26 high-resolution 26 highlights 26 helped 26 hate 26 Gp 26 goals 26 gives 26 gains 26 Framingham 26 Fourier 26 fluorescent 26 fluent 26 Fliesler 26 fine 26 fees 26 feel 26 faces 26 FAAP 26 extensively 26 exercise-induced 26 exception 26 Excellence 26 employment 26 electrical 26 easy 26 double-blind 26 displacement 26 descriptive 26 deprivation 26 Departments 26 contractility 26 construct 26 considerations 26 connection 26 conclude 26 Chung 26 categorized 26 cardiopulmonary 26 Brian 26 Brazil 26 bovine 26 beta 26 attentional 26 attempt 26 apply 26 amygdala 26 Alternatively 26 Ago 26 aggregation 26 ADC0 26 1982 26 157 26 156 26 152 26 143 26 129 26 128 25 Zhou 25 warranted 25 volumetric 25 visually 25 vast 25 validate 25 UPPP 25 uncertain 25 TT 25 themselves 25 template 25 TBI 25 synthetic 25 surrounding 25 surgeries 25 subframe 25 SPT 25 spent 25 specified 25 Spanish 25 societal 25 slight 25 Sequential 25 self 25 screen 25 Santa 25 ROS 25 ROIs 25 Robertson 25 Reprod 25 represented 25 replicated 25 Relat 25 regulator 25 QUIPS 25 pyramidal 25 proven 25 proportions 25 proinflammatory 25 PRM 25 positions 25 phosphorylase 25 overnight 25 originally 25 notable 25 non-cardiac 25 node 25 neurologic 25 Nelson 25 NE 25 nationwide 25 Myeloma 25 multimodal 25 modulates 25 manage 25 loci 25 ll 25 LH 25 Levy 25 Kingdom 25 inverse 25 intellectual 25 instructions 25 implants 25 hypotheses 25 hospitalized 25 Hispanic 25 Hall 25 GR 25 girls 25 GFI 25 genome-wide 25 fruit 25 FC 25 favor 25 faster 25 Farrer 25 expensive 25 excessive 25 Europe 25 elimination 25 elevations 25 El 25 Edwards 25 editors 25 Edinburgh 25 e1 25 DW 25 dizziness 25 disclosed 25 detrimental 25 demographics 25 dehydrogenase 25 counseling 25 contexts 25 constructs 25 complicated 25 community-dwelling 25 collect 25 clonal 25 chamber 25 certainly 25 cerebrovascular 25 carefully 25 captured 25 CA3 25 believed 25 behind 25 band 25 averaged 25 atherosclerotic 25 assembly 25 argument 25 appropriately 25 antioxidant 25 anticipated 25 angiographic 25 analgesics 25 America 25 allocation 25 all-cause 25 Ahmed 25 aggregates 25 AF 25 advice 25 adoption 25 admissions 25 addressing 25 acting 25 Acknowledgements 25 A33 25 3C 25 2B 25 191 25 173 25 153 25 147 25 142 25 003 24 Zn 24 Yan 24 Wechsler 24 Walker 24 Wales 24 volunteers 24 viable 24 valves 24 upregulated 24 tyrosine 24 took 24 tip 24 thoracic 24 terrorism 24 takes 24 Sydney 24 surgeon 24 supplemented 24 subtype 24 substrate 24 subsets 24 stiffness 24 specialist 24 sparse 24 slides 24 Singh 24 seek 24 seconds 24 rule 24 Richardson 24 retrieved 24 respondents 24 reserve 24 rescue 24 remodeling 24 regulating 24 regarded 24 recombinant 24 recipients 24 quality-of-life 24 purified 24 PTL 24 prove 24 prevented 24 presynaptic 24 point-of-care 24 plate 24 phosphorylated 24 phone 24 phenomena 24 pelvic 24 passive 24 package 24 overexpressing 24 operation 24 observe 24 nurse 24 nuclei 24 northwest 24 normalization 24 NMO 24 nigral 24 neuromelanin 24 multivariable 24 MPSC 24 MN 24 minority 24 mind 24 Medicaid 24 Managing 24 maintaining 24 mAb 24 Lu 24 LP 24 Leitgeb 24 KS 24 kidneys 24 ketamine 24 JN 24 Jin 24 IVFE 24 IPL 24 intractable 24 intracerebral 24 intolerance 24 intensities 24 instances 24 hypoxia 24 full-length 24 FN 24 fitting 24 filtration 24 fever 24 favorable 24 exploratory 24 exclusively 24 exchange 24 etiology 24 endocrine 24 EBE 24 ease 24 downregulated 24 disturbances 24 Diego 24 daf-2 24 CT-based 24 Crossing 24 creating 24 copies 24 COPD 24 contacts 24 considerably 24 confounders 24 complexes 24 Commission 24 comes 24 clinician 24 cited 24 Choi 24 China 24 chemoradiotherapy 24 century 24 catalogue 24 cat 24 Carrier 24 bullous 24 boundary 24 BCT 24 attenuated 24 assuming 24 antidepressant 24 AK 24 AH 24 administrative 24 activate 24 2013a 24 167 24 141 24 132 24 124 23 yeast 23 WK 23 Wilkins 23 WC 23 visualized 23 views 23 vertigo 23 Ultra-marathon 23 trigger 23 tract 23 supportive 23 suffering 23 studying 23 stressors 23 spot 23 Spearman 23 Song 23 SIRT1 23 Semin 23 scatter 23 rodents 23 Roberts 23 RLI 23 returned 23 responsiveness 23 residential 23 refractory 23 refer 23 recurrences 23 readily 23 read 23 Pseudophakic 23 prompt 23 pretreatment 23 prescriptions 23 Pract 23 post-ED 23 perspectives 23 permanent 23 parkin 23 Parafoveal 23 outpatient 23 nucleotide 23 neutral 23 Narrow 23 NAC 23 Multicentre 23 morphological 23 Monkey 23 MIP 23 minimize 23 min-1 23 microscope 23 microarray 23 Martinez 23 margin 23 maculopathy 23 macrophages 23 literacy 23 lifestyle 23 lean 23 Landfield 23 KD 23 Jan 23 interquartile 23 interpret 23 intermittent 23 insulin-like 23 inherent 23 incomplete 23 impair 23 HL 23 Hill 23 hemodynamic 23 handling 23 Handbook 23 Hamilton 23 greatly 23 graduates 23 glomerular 23 Glioma 23 genotypes 23 genetically 23 FoxO 23 flagged 23 filter 23 fibroblasts 23 FFR 23 fascia 23 estimating 23 Enablers 23 employing 23 embryos 23 elevation 23 Educ 23 edition 23 easier 23 Dutch 23 downregulation 23 dosing 23 dosage 23 differentially 23 deterioration 23 desirable 23 defect 23 DD 23 conserved 23 competitive 23 communities 23 come 23 codes 23 Club 23 chromatography 23 chemistry 23 chance 23 cerebellar 23 caspase-3 23 carrying 23 carcinomas 23 calpain-1 23 caesarean 23 Bureau 23 breathing 23 blot 23 biologic 23 bidirectional 23 BCRL 23 attributes 23 attack 23 assisted 23 Artifacts 23 arsenite 23 argue 23 aOR 23 antibiotics 23 Andrews 23 analogue 23 amacrine 23 agreed 23 achieving 23 607 23 4B 23 4A 23 2C 23 2-1 23 2011a 23 2010b 23 1979 23 176 23 148 23 139 23 131I-IB-Mal-D-GEEEK-Nanobody 22 woman 22 whole-body 22 wells 22 website 22 Weber-Fox 22 versions 22 VAS 22 urban 22 unless 22 Unfortunately 22 Turnbull 22 Trust 22 transmission-based 22 transfusions 22 traits 22 tPA 22 SynchroMed 22 subtle 22 stronger 22 stromal 22 strains 22 stopped 22 SRTR 22 Sponsor 22 societies 22 socially 22 Siemens 22 shape 22 Shah 22 sensorimotor 22 searched 22 said 22 RP 22 route 22 Rosenfeld 22 reward 22 recording 22 psychometric 22 promoting 22 Prev 22 Pharmacology 22 Peter 22 Paul 22 parametric 22 outlined 22 outbreak 22 organisms 22 opposite 22 occlusion 22 NHR-64 22 neuropsychological 22 NC 22 musculoskeletal 22 Murray 22 Mitchell 22 min21 22 Michigan 22 Miao 22 LR 22 ligand 22 Liang 22 Leuven 22 Lauritzen 22 Kumar 22 kcl 22 junction 22 ITT 22 IRSS 22 indices 22 incorporated 22 inactivation 22 impossible 22 hyperintensity 22 HW 22 high-intensity 22 hemorrhagic 22 HC 22 Gynaecology 22 GWAS 22 GMM 22 GL 22 GG 22 GABA 22 Friedman 22 French 22 Fox 22 exudative 22 exposures 22 explicitly 22 expertise 22 Exon 22 exogenous 22 exclude 22 ever 22 episode 22 endoplasmic 22 end-of-life 22 Ding 22 describing 22 declares 22 decay 22 Cytotoxicity 22 contralateral 22 collagen 22 circuits 22 choose 22 chemokine 22 Chair 22 centres 22 Categorical 22 Carbamylated 22 canonical 22 call 22 blurring 22 blistering 22 begin 22 began 22 bedside 22 b-catenin 22 balanced 22 bacterial 22 AW 22 attempts 22 atlas 22 arise 22 anxious 22 antisense 22 anti-inflammatory 22 antibiotic 22 answer 22 anesthetized 22 analyte 22 analog 22 Amsterdam 22 altitude 22 aims 22 agree 22 accidental 22 acatalasemic 22 abnormality 22 6-month 22 305 22 264 22 195 21 zero 21 Wright 21 Wisconsin 21 WH 21 wave 21 VEGF 21 utilized 21 turnover 21 translocation 21 transformed 21 track 21 TNM 21 TERRA 21 terminal 21 tendency 21 Tel 21 Tang 21 suitable 21 suffer 21 sucrose 21 statistic 21 slowly 21 slices 21 signature 21 Shen 21 Shaw 21 self-paced 21 schools 21 SB 21 restore 21 researcher 21 reprints 21 rely 21 relapsed 21 raw 21 Rank 21 psychotics 21 prospectively 21 pronounced 21 progressively 21 principle 21 primate 21 prevents 21 prevalent 21 precursor 21 Pre-analytical 21 Practitioners 21 postoperatively 21 Post-hoc 21 poorly 21 poorer 21 PLONI 21 photography 21 payment 21 parity 21 palate 21 paediatric 21 P1 21 Otorhinolaryngologic 21 nursing 21 non-smokers 21 Nonetheless 21 nitric 21 NICE 21 mTOR 21 MR-based 21 mother 21 molar 21 modality 21 microscopic 21 mast 21 markedly 21 Mar 21 Machine 21 lives 21 lipopolysaccharide 21 Likewise 21 lifetime 21 learned 21 Learn 21 LD 21 Law 21 Kras 21 Kimura 21 Kaplan-Meier 21 Jensen 21 I-SGMIB-Nanobody 21 ion 21 interdisciplinary 21 interacting 21 influencing 21 indicative 21 implement 21 hyperspectral 21 Hospitalizations 21 Heidelberg 21 HCC 21 Guazzi 21 Graz 21 GFP 21 Gensini 21 generalized 21 gained 21 functionally 21 Francisco 21 Forum 21 FJ 21 fIVIM 21 FEMDD 21 elicited 21 EE 21 editing 21 echocardiography 21 derive 21 dehumanization 21 defective 21 Das 21 cytochrome 21 cutaneous 21 Crit 21 C-reactive 21 cornea 21 Confirmation 21 Commun 21 comments 21 Collectively 21 Cleveland 21 chorioretinal 21 Cho 21 cerebellum 21 CD38 21 CD20 21 CB 21 caution 21 Carolina 21 candidates 21 cancer-related 21 broader 21 Brice 21 Braak 21 BN 21 blots 21 blocked 21 blinding 21 Bl 21 biopsies 21 Binary 21 billion 21 bearing 21 basketball 21 aware 21 Attestation 21 attacks 21 ask 21 arrest 21 aging-related 21 Adolesc 21 adenosine 21 accumulate 21 abilities 21 5alpha-reductase 21 3-year 21 351 21 320 21 2nd 21 284 21 217 21 201 21 1B 21 179 21 170 21 155 21 149 21 1111 21 1001 21 004 21 002 20 wrote 20 wound 20 works 20 Wolf 20 within-subject 20 Wiley 20 weekly 20 Walsh 20 vocabulary 20 users 20 uniform 20 undergone 20 Tran 20 TL 20 TK 20 thereafter 20 tensor 20 TD 20 TaqMan 20 surfaces 20 subcortical 20 strides 20 strictly 20 SRC 20 spots 20 spectroscopy 20 spatially 20 Sparrow 20 sociodemographic 20 similarities 20 Shi 20 sensation 20 seemed 20 say 20 rules 20 Rudolf 20 rods 20 RMDD 20 RET 20 responders 20 respiration 20 Replication 20 replaced 20 relating 20 relate 20 regulations 20 RBCs 20 quickly 20 purification 20 pumps 20 proxy 20 proviral 20 property 20 proof 20 producing 20 Probes 20 preventive 20 preserved 20 pre-operative 20 prenatal 20 postural 20 played 20 Philadelphia 20 Pharmaceuticals 20 Ovarian 20 organizations 20 Ontario 20 Obviously 20 objects 20 neonates 20 native 20 moves 20 MMSE 20 medication-related 20 Markov 20 manually 20 Lys 20 lymphocytosis 20 LTCC 20 linking 20 Ktrans 20 KP 20 kept 20 Keeping 20 judgment 20 Joseph 20 item 20 Ire1-Xbp1 20 intestinal 20 Interpreting 20 Internet 20 Integrating 20 inherited 20 individually 20 inconsistent 20 incentive 20 illnesses 20 Ig 20 hypothesize 20 htm 20 household 20 historical 20 hexagons 20 Hernand 20 health-related 20 Halliday 20 grow 20 gliomas 20 GD 20 GBM 20 Gao 20 fusion 20 Frank 20 Foster 20 Forest 20 flexion 20 FLAIR 20 fitness 20 fifth 20 Feng 20 FASEB 20 expiratory 20 exhaustive 20 Epub 20 energy-supply 20 Elsevier 20 drop 20 draw 20 donor 20 distal 20 discontinued 20 diluted 20 dendritic 20 dark 20 Covariate 20 Costa 20 consistency 20 conformation 20 confirming 20 compound 20 comorbidity 20 comorbid 20 Cobley 20 ClinicalTrials 20 classic 20 chose 20 characterize 20 CD3 20 caregivers 20 Carbamylation 20 canal 20 came 20 Calorie 20 Bradford 20 bile 20 Austria 20 asymmetry 20 assumption 20 arthroplasty 20 appointment 20 amplification 20 allocated 20 accounting 20 accessible 20 acceptance 20 acceptability 20 Abeta 20 aaojournal 20 800 20 5alpha-THF 20 344 20 273 20 203 20 1980 20 169 20 164 20 137 20 125I-Nanobody 19 vitreous 19 videofluoroscopy-asp 19 ventilatory 19 varies 19 UC 19 twins 19 truncated 19 triglycerides 19 transportation 19 trace 19 Tooth 19 THF 19 theoretically 19 Tai 19 systematically 19 supplement 19 SSI-3 19 spreadsheet 19 specialized 19 Simon 19 S-estimator 19 serotonin 19 searches 19 sciatic 19 S3 19 Roentgenol 19 reviewing 19 restrictions 19 residence 19 reorganization 19 Reg 19 recipient 19 realized 19 quartiles 19 Qual 19 Qaeda 19 putative 19 putamen 19 Psychotherapy 19 proved 19 projects 19 pre- 19 PPV 19 post-TKR 19 placenta 19 PK 19 pharmacologic 19 pethidine 19 percentile 19 Pedersen 19 pancreatic 19 pairwise 19 operator 19 Offspring 19 obtaining 19 observable 19 nulliparous 19 non 19 NL 19 nicotine 19 Newman 19 Mutated 19 mounted 19 Morton 19 modest 19 methylated 19 maze 19 market 19 malignancies 19 Ltd 19 litre 19 Lim 19 leaving 19 laws 19 latency 19 lane 19 KPS 19 Korea 19 kits 19 King 19 jumping 19 jumper 19 Jiang 19 IVF 19 isometric 19 irrespective 19 integrin 19 instability 19 infectious 19 infancy 19 incision 19 inability 19 immunoglobulin 19 imaged 19 ideology 19 ideal 19 IB-Mal-D-GEEEK 19 hemoglobin 19 healing 19 handover 19 Han 19 grouping 19 grades 19 Garhofer 19 FRA-positive 19 format 19 Fluocinolone 19 flat 19 fears 19 Extraocular 19 extract 19 expressive 19 explains 19 expectations 19 exertion 19 EV 19 enrollment 19 energetics 19 embolism 19 embedded 19 Editorial 19 Du 19 dramatically 19 donors 19 doing 19 DK 19 disparities 19 discrete 19 disciplines 19 Digit 19 differently 19 Dietschy 19 depicted 19 Denmark 19 demyelination 19 declined 19 cyclic 19 creation 19 correctly 19 controversial 19 consultation 19 Cond 19 coded 19 clustering 19 CKD 19 CHARGE 19 cerebrospinal 19 CER 19 cDNA 19 catheter 19 cancer-specific 19 Besides 19 Berg 19 Bene 19 being-in-the-world 19 Batterham 19 Barker 19 bad 19 babies 19 Austin 19 attended 19 attempted 19 assumptions 19 argued 19 apnea 19 analytical 19 analogs 19 anaesthetists 19 AMPK 19 Albert 19 African 19 AEDs 19 Adams 19 accumulated 19 Abuse-Deterrent 19 64Cu-NOTA-A33 19 5-min 19 511 19 2-year 19 2D 19 286 19 283 19 216 19 2013b 19 17p 19 165 19 15-letter 19 154 18 WS 18 worst 18 weights 18 WB 18 vol 18 usage 18 underestimation 18 TR 18 Tourette 18 Tor 18 timely 18 thoughts 18 terminals 18 telomere 18 Teaching 18 T2-weighted 18 systolic 18 syndromes 18 supervised 18 suggestion 18 sufficiently 18 Stone 18 stimulator 18 sterol 18 stepping 18 steering 18 Stat 18 standardised 18 something 18 solely 18 SLAdd 18 situation 18 sensations 18 sedentary 18 Schneider 18 scenario 18 scanned 18 Sato 18 Sarks 18 ROI 18 Road 18 RN 18 Riva 18 Retin 18 responsive 18 responding 18 reproductive 18 repression 18 quantitation 18 psychotic 18 Psychiatrists 18 PS-IkBalpha 18 pseudodrusen 18 Pro 18 prescribed 18 Pre-exercise 18 polymerase 18 POD 18 pneumothorax 18 plexiform 18 physiologic 18 phosphate 18 phonological 18 pharmaceutical 18 phakic 18 peers 18 pediatricians 18 palsy 18 pain-related 18 page 18 Operative 18 olfactory 18 numeric 18 NR2C 18 N-methyl-D-aspartate 18 Nle4 18 NIHR 18 Newell 18 neuroprotective 18 neuropathy 18 Neuropathol 18 Moyer 18 Morgan 18 modify 18 missed 18 Ministry 18 meant 18 margins 18 Maastricht 18 localised 18 lncRNAs 18 liquid 18 Levine 18 Levin 18 LB-injected 18 label 18 Kujala 18 kappa 18 Kang 18 jumps 18 Jude 18 Jong 18 Ireland 18 intense 18 integrative 18 innovative 18 initiatives 18 Ingham 18 inclusions 18 inadequate 18 Implementing 18 impairs 18 immunosuppressive 18 Iliaca 18 IL-1Ra 18 I2 18 Hysterectomy 18 homozygous 18 homocysteine 18 hematoxylin 18 Harvard 18 Hardy 18 graphs 18 going 18 giving 18 genomics 18 formulation 18 flexible 18 Fish 18 first-line 18 facilitates 18 extending 18 expenditure 18 evoked 18 equations 18 epidural 18 EPCs 18 encountered 18 emphasis 18 emotion 18 EMBO 18 E-deprived 18 Drs 18 dropout 18 driving 18 documents 18 Disterhoft 18 disruptions 18 disease-specific 18 discrepancies 18 dimension 18 developments 18 determinants 18 degenerative 18 CW 18 curative 18 Cruz 18 creatine 18 conjugated 18 concerned 18 complementary 18 coming 18 column 18 Collaborative 18 cm2 18 clips 18 clinics 18 classify 18 clarify 18 chromosome 18 Chow 18 check 18 centenarians 18 CD8 18 career 18 Butler 18 bound 18 blank 18 bisphosphonates 18 Biostatistics 18 BH 18 B-cell 18 barnes 18 b1 18 autoantibody 18 applying 18 anti-VEGF 18 anti-GDNF 18 anticoagulant 18 anesthesiologist 18 amyloid 18 -a-MSH 18 Agostino 18 adipose 18 adhesion 18 addiction 18 acts 18 accumulating 18 ablative 18 ablation 18 aberrant 18 3-PC 18 3D-TTE 18 309 18 2-mg 18 256 18 255 18 240 18 199 18 198 18 1977 18 1975 18 1964 18 183 18 182 18 177 18 159 18 151 18 138 18 134 18 005 18 -0 17 Yamamoto 17 Xie 17 xenografts 17 WW 17 weaning 17 wdr-23 17 VPAA 17 vowel 17 videofluoroscopy 17 venous 17 utilizing 17 UPR 17 unintended 17 underlie 17 ubiquitin 17 Turner 17 Turley 17 triangle 17 triamcinolone 17 tobacco 17 TNF-a 17 themes 17 thalamus 17 texture 17 tetrazine 17 T1-weighted 17 Syst 17 Synapse 17 susceptible 17 suggestive 17 suffered 17 substances 17 sub-retinal 17 subcellular 17 stores 17 stand 17 SPECT 17 specialty 17 somatosensory 17 soft-tissue 17 slower 17 slice 17 Signalling 17 shortened 17 sentence 17 sdisease 17 Schwartz 17 scattering 17 scalp 17 SAD 17 Ryan 17 RxO 17 Rose 17 ribbons 17 Rheumatol 17 rheumatoid 17 revealing 17 retrospectively 17 remove 17 relates 17 rejected 17 recreational 17 radiological 17 radioligand 17 QOL 17 PTEN 17 Psychosom 17 Psychiatr 17 prostatectomy 17 properly 17 prone 17 promoted 17 Progenitors 17 Primer 17 prepare 17 preferentially 17 PPROMEXIL 17 poverty 17 postsynaptic 17 postnatal 17 positional 17 polymers 17 polyclonal 17 PINK1 17 phases 17 permeability 17 Peng 17 Patent 17 parental 17 Pan 17 Oh 17 obstruction 17 NS 17 NRI 17 Non-Gaussian 17 Nielsen 17 nerves 17 NCX1 17 Naatanen 17 MVC 17 multitude 17 multifocal 17 module 17 mismatch 17 mid 17 Metric 17 metal 17 messenger 17 mesorectal 17 MDRD 17 mastoid 17 lupus 17 Lozano 17 low-dose 17 license 17 Liao 17 lengths 17 Lees 17 laterally 17 Lang 17 kind 17 keV 17 Kenyon 17 kb 17 Katz 17 introduce 17 intravoxel 17 internalization 17 inter-individual 17 inoculations 17 inhibiting 17 incoherent 17 incident 17 imbalance 17 ideally 17 hyperactivity 17 Hope 17 histology 17 histologic 17 highlighting 17 high-grade 17 HG 17 heterogeneous 17 Hell 17 held 17 Hayes 17 Haller 17 gyri 17 Guo 17 Gouspillou 17 geriatric 17 fractional 17 formula 17 formalin 17 finger 17 fibrosis 17 fell 17 F4 17 extractions 17 Exploring 17 excitatory 17 epidermal 17 eosin 17 enzymatic 17 ensuring 17 engaged 17 emerged 17 electrodes 17 EDTA 17 dystrophin 17 dysfunctional 17 D-Phe7 17 disease-free 17 discrepancy 17 discovered 17 discharged 17 diagnostics 17 DFS 17 deviant 17 designs 17 Deng 17 debate 17 DAF-16 17 cytoplasm 17 CVOR 17 cure 17 cultural 17 covering 17 corticotherapy 17 Corp 17 contents 17 contemporary 17 cones 17 conditional 17 conception 17 compromised 17 comprised 17 Colonies 17 claims 17 City 17 citrate 17 CD138 17 caloric 17 calibration 17 Burke 17 Bretillon 17 breastfeeding 17 Boon 17 birthweight 17 binds 17 Bethesda 17 Belfer 17 beams 17 avoided 17 attenuates 17 attainment 17 astrocytes 17 assume 17 associate 17 Arterioscler 17 apparently 17 apoB 17 angles 17 anabolic 17 Altman 17 Alexander 17 age-dependent 17 affiliations 17 Adv 17 additive 17 adding 17 accumulations 17 absorption 17 5A 17 563 17 430 17 367 17 366 17 30-day 17 287 17 285 17 282 17 280 17 268 17 246 17 225 17 211 17 2009a 17 1-min 17 18F 17 186 17 171 17 161 17 1002 16 Wnt 16 Werkmeister 16 well-being 16 Weisz 16 weight-training 16 Watts 16 waiting 16 voxel-based 16 volunteer 16 VO2 16 viability 16 veterans 16 vertical 16 vegetables 16 variances 16 Valdes 16 ultrastructure 16 twin 16 treatment-related 16 transforming 16 trajectories 16 trainees 16 tongue 16 tolerated 16 today 16 thioredoxin 16 Thibault 16 tendons 16 TC 16 Takahashi 16 Taiwan 16 synthesized 16 Swallowing 16 survive 16 summarize 16 Suicide 16 substrates 16 submit 16 striking 16 stimulate 16 Stewart 16 Stanford 16 Spaide 16 sounds 16 Soon 16 SJCRH 16 singletons 16 single-fraction 16 similarity 16 SGMIB 16 serves 16 senescent 16 SEM 16 selecting 16 scheme 16 schedule 16 sacrocolpopexy 16 Sachs 16 Rogers 16 rigorous 16 RIDE 16 Richard 16 resolve 16 repositioning 16 repetitions 16 regulators 16 really 16 rated 16 rarely 16 Rao 16 psychosis 16 protects 16 protease 16 prophylaxis 16 promise 16 progression-free 16 prespecified 16 precisely 16 powered 16 playing 16 player 16 plausible 16 plaques 16 pixels 16 physically 16 photocoagulation 16 phonemic 16 phasing 16 pharmacokinetic 16 percentages 16 passed 16 partly 16 paretic 16 orbitofrontal 16 optics 16 ONeOFF 16 object 16 nutrient 16 non-CAD 16 Neurosciences 16 neuropathological 16 neuraxial 16 mucosa 16 motifs 16 morphologic 16 morbidities 16 monoexponential 16 mismatched 16 Minnesota 16 Minneapolis 16 micro 16 metabolite 16 MESCC 16 Melbourne 16 McDonald 16 Lowe 16 Los 16 LOR 16 lesser 16 lasting 16 Krishnan 16 ketorolac 16 JY 16 Jacobs 16 isoflurane 16 inventory 16 interpersonal 16 interface 16 insular 16 inoculation 16 industry 16 incubation 16 IM 16 illustrated 16 Hypoventilation 16 HS 16 Holz 16 hold 16 Ho 16 heightened 16 HA 16 Goldstein 16 glycolysis 16 Glasgow 16 Gaussian 16 frequentist 16 freezing 16 Formalin-fixed 16 forced 16 Fleming 16 Finland 16 fashion 16 falling 16 facial 16 Extraneural 16 Executive 16 excretion 16 exacerbate 16 equipment 16 entirely 16 engage 16 encouraging 16 DTI 16 Drops 16 drafting 16 draft 16 Dp1402 16 Dp140 16 Donald 16 Documentation 16 DLPFC 16 distinguished 16 disrupted 16 discontinuation 16 disc 16 differentiated 16 Diclofenac 16 deprived 16 defines 16 cytotoxic 16 CVsta 16 cues 16 Crisis 16 CPT 16 corticosteroids 16 Corporation 16 Corella 16 copy 16 continuing 16 Con 16 compatible 16 Commercially 16 cms 16 closer 16 Click 16 CKD-EPI 16 Chi 16 Cheung 16 chemokines 16 censored 16 CAP 16 Building 16 BT 16 breakdown 16 BP 16 border 16 blockade 16 blindness 16 Birmingham 16 Biochim 16 bilaterally 16 Beyer 16 beliefs 16 Behrens-Fisher 16 Bauer 16 Bank 16 Authorship 16 Aust 16 Audit 16 Arising 16 ARC 16 Apcfl 16 Ali 16 air 16 activating 16 Ac- 16 ABCA1 16 64Cu-Tz-Bn-NOTA 16 4-syllable 16 375 16 361 16 358 16 289 16 277 16 276 16 259 16 248 16 205 16 2012b 16 192 16 189 16 1200 16 1007 15 yields 15 yielding 15 Yi 15 xParallelGroupsTrial 15 WSSFN 15 write 15 worsening 15 web-based 15 weakened 15 volitional 15 vertices 15 upper-limb 15 triggered 15 transplants 15 transarterial 15 tolerability 15 time-trials 15 thyroid 15 thrombolytic 15 thinning 15 theories 15 than0 15 Texas 15 Test-retest 15 termed 15 tax 15 talent 15 syllables 15 Swedish 15 summarised 15 substitute 15 subcutaneous 15 statins 15 standing 15 stained 15 stabilization 15 speech-sound 15 siRNA 15 Silent 15 Sigma-Aldrich 15 sharing 15 SF 15 Seoul 15 Schultz 15 Schneier 15 Schapira 15 scenarios 15 scavenger 15 S1-F5 15 Russell 15 Rodgers 15 rod-cone 15 Rheum 15 Reynolds 15 repeatedly 15 reliably 15 regularly 15 refers 15 Reeve 15 recover 15 receives 15 reagent 15 radio-therapy 15 radiologists 15 qualities 15 qualified 15 PrP 15 prophylactic 15 projections 15 preparations 15 practicing 15 polymer 15 plotted 15 PIs 15 physiotherapy 15 phenotypic 15 persists 15 peroxide 15 Perez 15 Pedro 15 path 15 Patel 15 pars 15 paraffin-embedded 15 p53s 15 overlying 15 Organisation 15 optimize 15 opposed 15 one-third 15 oncologists 15 OCD 15 O2max 15 NQF 15 novices 15 nonparetic 15 noncoding 15 noncardiac 15 nodal 15 neurosurgeons 15 neurogenesis 15 neighborhood 15 Nakamura 15 multifactorial 15 MSc 15 moved 15 MOSAIC 15 miRs 15 miR-34a 15 midbrain 15 Meyer 15 meetings 15 Mediterranean 15 maybe 15 Marshall 15 Mann-Whitney 15 m-2 15 lysosomal 15 Lutz 15 lumbar 15 LT 15 loaded 15 Lo 15 Lippincott 15 lipase 15 Ligation 15 leukocytes 15 KT 15 Knyazeva 15 knockout 15 Klinikum 15 kinetic 15 Kaplan 15 Jung 15 Japanese 15 Jain 15 Izatt 15 Irritability 15 inversely 15 intraframe 15 interleukin 15 interim 15 interested 15 initiating 15 inform 15 infected 15 indocyanine 15 impacts 15 hydrogen 15 herein 15 Hemoglobin-Based 15 heat 15 HCA 15 harvested 15 Harrison 15 haptoglobin 15 grouped 15 ground 15 Groningen 15 Goldberg 15 goat 15 Gibson 15 GF 15 GBS-positive 15 gain-of-function 15 Fu 15 fractionation 15 forming 15 football 15 fluids 15 Fellowships 15 feelings 15 feeding 15 fatal 15 extends 15 exceeded 15 Evans 15 Eq 15 encouraged 15 encourage 15 Email 15 elucidated 15 elucidate 15 edited 15 Drevets 15 dividing 15 Distinctive 15 dissection 15 describes 15 dense 15 deleterious 15 deficient 15 decided 15 Dai 15 cytometric 15 cyclophosphamide 15 CTP 15 CRT 15 counting 15 correspond 15 Copeland 15 Coordinate 15 Contributors 15 conscious 15 connective 15 conjunction 15 Comput 15 competent 15 Columbia 15 collapsed 15 CO2 15 classifications 15 Chi-square 15 Chapter 15 chains 15 CFH 15 centered 15 CCL3 15 causality 15 case-control 15 cascade 15 Cary 15 carry 15 careful 15 Carbohydrate 15 broadly 15 bout 15 boundaries 15 between-subject 15 bench 15 bed 15 becoming 15 balloon 15 avoiding 15 au 15 assignment 15 arrival 15 Arbor 15 antagonist 15 Annu 15 androsterone 15 alters 15 adrenal 15 ADHD 15 acute-type 15 accounts 15 abstracts 15 aappublications 15 99mTc 15 900 15 6-syllable 15 5B 15 503 15 460 15 451 15 381 15 369 15 349 15 325 15 317 15 307 15 3- 15 247 15 245 15 207 15 2010a 15 2009b 15 1973 15 193 15 185 15 172 15 163 15 158 15 145 15 144 15 131I-SGMIB-Nanobody 15 12-month 15 1097 15 1- 14 Zuo 14 yoga 14 worth 14 workplace 14 wild 14 Wilcoxon 14 wide-field 14 Watson 14 Wagner 14 VT 14 void 14 VLDL 14 Vissing 14 virtually 14 Vic 14 vesicles 14 verified 14 VC 14 unusual 14 untrained 14 unpublished 14 universal 14 Unexpected 14 Ultrastructural 14 u2-u1 14 two-sided 14 tumorigenesis 14 trivial 14 transverse 14 trafficking 14 toxicities 14 topography 14 tof 14 TMS 14 time-trial 14 thinking 14 Things 14 Thermal 14 tends 14 TEAEs 14 Symbol 14 Suzuki 14 suited 14 subversive 14 subtests 14 subframes 14 Sturm 14 strengthening 14 strengthened 14 strain 14 stop 14 Stern 14 stereotaxic 14 stents 14 steady 14 standardization 14 SPTs 14 split 14 spleen 14 smallest 14 sharp 14 served 14 SEIFA 14 scleral 14 schemes 14 Sasisekaran 14 rural 14 RT-PCR 14 rounds 14 Rom 14 Rodent 14 Robinson 14 ribbon 14 re-treatment 14 resuscitation 14 resting-state 14 request 14 remarkably 14 relations 14 rejectors 14 reflective 14 reflection 14 recessive 14 raise 14 radiographic 14 quantity 14 quantitatively 14 quantifying 14 pz 14 profound 14 Proceedings 14 probable 14 PRMSI 14 presumably 14 Pre-Plasmablasts 14 PRC2 14 pragmatic 14 postsurgical 14 post-injection 14 POLG 14 pointing 14 photographs 14 Philips 14 personnel 14 Perk 14 periphery 14 perceptual 14 PBMCs 14 paraffin 14 P450 14 oxidase 14 overlapping 14 outputs 14 optimization 14 opening 14 observer-rated 14 Nurs 14 NSAID 14 npCR 14 Novartis 14 Norris 14 nonspecific 14 Noble 14 nmol 14 NHANES 14 news 14 NEDS 14 ND 14 naive 14 N2 14 my 14 Mucous 14 mRNAs 14 Motion-Correction 14 motif 14 Montreal 14 monozygotic 14 mononuclear 14 monocytes 14 moment 14 MMP-13 14 missense 14 miR-16 14 milk 14 middle-aged 14 microvascular 14 microbial 14 medulloblastoma 14 Medline 14 Mayo 14 Max 14 matrices 14 mandatory 14 lymphoid 14 Loneliness 14 locomotion 14 lists 14 list-mode 14 linkage 14 leukaemia 14 LDH 14 Laryngoscope 14 Laparoscopy 14 landscape 14 L3 14 Kolb 14 knockdown 14 KGaA 14 JO 14 ipsilateral 14 Iowa 14 internalizing 14 interactive 14 instructed 14 informative 14 infertility 14 infarct 14 incorrect 14 inappropriate 14 Immunological 14 immunodeficiency 14 Immunity 14 ICER 14 hot 14 histopathological 14 high-density 14 HFrEF 14 Heuvel 14 heterotopic 14 hemispheres 14 Hematology 14 HBOC 14 H4 14 g-speed 14 grown 14 gradually 14 Gordon 14 Gonzalez 14 GFR 14 GFOG 14 gAC 14 funisitis 14 fruits 14 frequencies 14 FR 14 formally 14 foot 14 fluid-sensitive 14 flip 14 filled 14 fetuses 14 fetus 14 fat-6 14 factorial 14 explicit 14 explanations 14 exchanger 14 exceeds 14 exacerbated 14 E-supplemented 14 essentially 14 erroneous 14 EORTC 14 encoded 14 enables 14 EMBASE 14 effector 14 E2 14 Duncan 14 ductal 14 DSM-5 14 don 14 displays 14 discriminate 14 discoveries 14 discomfort 14 Diolez 14 dilation 14 differentiating 14 diagnose 14 designated 14 deregulation 14 demonstration 14 deleted 14 definite 14 declines 14 DAR 14 cysteine 14 curriculum 14 crosstalk 14 Cre 14 cranial 14 cortisone 14 corticospinal 14 converted 14 contour 14 construction 14 constitute 14 conditioned 14 competencies 14 compensatory 14 Company 14 community-based 14 commented 14 comment 14 closure 14 CETP 14 cell-associated 14 Carroll 14 carcinogenesis 14 carbon 14 calls 14 calibrated 14 cact 14 C3 14 BTK 14 BT474M1 14 Bologna 14 Boesze-Battaglia 14 body-map 14 boards 14 BJOG 14 Bird 14 Biotechnology 14 bioenergetics 14 Beal 14 Baumann 14 bandwidth 14 aspx 14 Arnold 14 approximate 14 appraisal 14 Anti-HER2 14 anonymous 14 anomalies 14 annemergmed 14 ankle 14 Angeles 14 Anastomotic 14 amplitudes 14 allografts 14 Allergan 14 Alimera 14 Akt 14 agility 14 aggregate 14 affiliated 14 advance 14 adjusting 14 ADCs 14 adapt 14 actively 14 Activations 14 acoustic 14 accumulates 14 abuse-related 14 absorbance 14 A33-TCO 14 A118G 14 68Ga 14 4C 14 437 14 429 14 370 14 364 14 363 14 360 14 355 14 321 14 303 14 2p 14 295 14 293 14 269 14 265 14 237 14 228 14 220 14 209 14 204 14 1C 14 1981 14 1972 14 196 14 187 14 184 14 181 14 175 14 146 14 125I-SGMIB-Nanobody 14 10-year 14 006 13 Zeiss 13 Zalutsky 13 Yuan 13 Yamada 13 WR 13 window 13 WF 13 Welfare 13 Wei 13 Watt 13 Wardlaw 13 VJ 13 Virginia 13 Vienna 13 vertex-presenting 13 verify 13 vegetable 13 UW-QOL 13 uterine 13 uric 13 Underperforming 13 underperformance 13 uncontrolled 13 t-tests 13 Tserentsoodol 13 TS 13 triple 13 tried 13 trastuzumab 13 translate 13 transcripts 13 transcranial 13 Title 13 termination 13 TCGA 13 TCF7L2 13 Symposium 13 swept 13 Sweden 13 survived 13 supine 13 substitution 13 sublayer 13 Subclinical 13 Street 13 straightforward 13 Stevens 13 statements 13 Spencer 13 spectral-domain 13 spanning 13 smoker 13 smoked 13 SMOG 13 SMD 13 small-to-medium-sized 13 simpler 13 Silva 13 short- 13 sequelae 13 selectively 13 secreted 13 season 13 sclerosis 13 schwannoma 13 Schorer 13 SCA 13 safer 13 Saf 13 S5 13 S4 13 rs1805502 13 Root 13 reviewer 13 reversible 13 responded 13 residualizing 13 Republic 13 reproducible 13 remissions 13 Refract 13 refill 13 referrals 13 recycling 13 recognizing 13 receipt 13 reagents 13 reader 13 R2 13 quick 13 Quadros 13 PTD 13 Psychosurgery 13 psychopathology 13 proteome 13 Pronovost 13 promoters 13 projection 13 probabilistic 13 primers 13 preservation 13 Predefined 13 precluded 13 precede 13 potentiated 13 potentials 13 potency 13 positioned 13 Polycomb 13 plates 13 placement 13 pixel 13 phosphatase 13 phacoemulsification 13 PF 13 permeabilized 13 Payne 13 pathophysiological 13 pathologists 13 Partridge 13 paroxysmal 13 paralysis 13 Palmer 13 oxidized 13 overweight 13 overuse 13 overt 13 overinfusion 13 overestimation 13 OSCC 13 organized 13 open-label 13 omnibus 13 Oliveira 13 occipital 13 nutrients 13 Nussbaum 13 numerator 13 NP 13 normative 13 nonopioid 13 Nikon 13 Newcastle 13 neurobiological 13 Munoz 13 mucosal 13 MRC 13 mouth 13 morphometry 13 morphologically 13 modes 13 modeled 13 mimic 13 methodologies 13 mesenchymal 13 MEK 13 Medulloblastomas 13 McMaster 13 maximize 13 masker 13 marginally 13 manipulation 13 manifest 13 macrophage 13 machinery 13 mAbs 13 lymphedema 13 longitudinally 13 lie 13 lethal 13 leisure 13 legal 13 lasted 13 ladder 13 Labs 13 KrasLA2 13 KIX-domain 13 Kent 13 JI 13 jaws 13 intramuscular 13 intraarterial 13 interlimb 13 interacts 13 intention-to-treat 13 integrate 13 integral 13 inferences 13 inequalities 13 imply 13 ICU 13 IA 13 Hypothetical 13 Hwang 13 Hunter 13 hundred 13 histopathology 13 histones 13 heterozygous 13 hemolysis 13 HBOCs 13 guided 13 Graham 13 Gmbh 13 Gilles 13 Genotyping 13 GCL 13 GBS-based 13 gating 13 Gardner 13 gaps 13 FZ 13 Freund 13 FRES 13 freedom 13 FM 13 fill 13 fibrils 13 Feb 13 failures 13 fails 13 EZH2 13 evolving 13 eu 13 etiocholanolone 13 ERPs 13 ergometer 13 epigenetics 13 engagement 13 endometrioma 13 employ 13 emphasized 13 emphasize 13 emergence 13 DSM-IV 13 drusenoid 13 drives 13 Dong 13 discretion 13 disabilities 13 dilatation 13 diastolic 13 diameters 13 descriptions 13 dendrites 13 delivering 13 degraded 13 deal 13 dataset 13 Daniel 13 D-alpha-Tocopherol 13 cyclized 13 Cui 13 CSS 13 CSA 13 CRP 13 cross-class 13 cover 13 couple 13 counterparts 13 counted 13 costly 13 cortices 13 Copenhagen 13 co-ordinators 13 coordinates 13 CoO 13 contractile 13 contamination 13 consonant 13 conjugate 13 conducting 13 Concurrently 13 conceptual 13 comprising 13 Collins 13 coil 13 cognitive-behavioral 13 cognitions 13 cleaved 13 Clarke 13 circular 13 circuitry 13 chronological 13 choosing 13 Cholecystectomy 13 Chinese 13 chelator 13 charged 13 cervicovaginal 13 cavity 13 Caucasian 13 Catalase 13 cards 13 capturing 13 buffered 13 bowel 13 bortezomib 13 Bonferroni 13 BMP-4 13 Blumgart 13 Bishop 13 biogenesis 13 BI 13 beverages 13 BEST1 13 Bernard 13 Berlin 13 Berger 13 beneficiaries 13 beings 13 begun 13 bases 13 Bano 13 Baltimore 13 axons 13 axon 13 averaging 13 automatically 13 attend 13 attached 13 assurance 13 associates 13 artificial 13 arguably 13 architectures 13 apoptotic 13 antisocial 13 antidepressants 13 anomaly 13 angiogram 13 anemia 13 anal 13 ambulation 13 aids 13 Ai 13 agonists 13 affective 13 advised 13 adjust 13 Activator 13 ACGME-accredited 13 accredited 13 Abbott 13 700 13 6beta-hydroxycortisol 13 6B 13 5th 13 5-fold 13 5F7GGC 13 521 13 420 13 407 13 3-fold 13 382 13 378 13 359 13 341 13 335 13 329 13 310 13 2-fold 13 2F 13 299 13 290 13 270 13 241 13 236 13 235 13 231 13 210 13 208 13 2006a 13 1-year 13 1D 13 1978 13 194 13 190 13 188Re 13 174 13 1-2 12 ZS 12 Yin 12 X-100 12 Workshop 12 WL 12 Winkler 12 William 12 WG 12 Welch 12 Weiss 12 Wegener 12 weaknesses 12 Vmax 12 Vicra 12 velocities 12 vehicle 12 VDOE 12 vagina 12 uveitis 12 url 12 unfolded 12 uncomplicated 12 Ultra-endurance 12 two-thirds 12 two-dimensional 12 Triton 12 triggers 12 triggering 12 Train 12 topology 12 tomographic 12 tier 12 telomerase 12 telephone 12 TAVR 12 Tanaka 12 tail 12 SW1222 12 suppressor 12 superimposed 12 strategic 12 stimulated 12 Steril 12 square 12 Springer 12 spending 12 speech-language 12 Speculative 12 spectrometer 12 spectra 12 Snyder 12 Smits-Bandstra 12 slowing 12 Sinclair 12 simplified 12 Sick 12 Shin 12 sexual 12 SERCA1 12 sent 12 sensor 12 scholarship 12 scaling 12 sarcoplasmic 12 Sage 12 roughly 12 Rosen 12 revisions 12 restoration 12 resembling 12 representatives 12 representations 12 Rep1 12 refined 12 recommends 12 reasonably 12 reactivity 12 raises 12 Radioiodination 12 Rades 12 qRT-PCR 12 QPCR 12 PVR 12 purchased 12 proton 12 Proteomics 12 proteomic 12 protected 12 proposal 12 priori 12 prices 12 preferences 12 pre-eclampsia 12 precentral 12 powerful 12 postulated 12 posttherapy 12 post-stroke 12 postpartum 12 Postadaptation 12 popular 12 platforms 12 Pittsburgh 12 pigmented 12 pigmentation 12 Picard 12 PI3KCA 12 pharmacokinetics 12 Pharma 12 Pennsylvania 12 Pencina 12 payments 12 P4 12 oxysterols 12 overdoses 12 osteoblast 12 orthopedic 12 origins 12 originate 12 organoids 12 organizational 12 ordinariness 12 OPTN 12 optimized 12 opiate 12 Oph-thalmol 12 Olson 12 oligonucleotides 12 Okayama 12 Ohio 12 Occup 12 occasionally 12 NSW 12 N-succinimidyl 12 novo 12 norms 12 nonevents 12 noncancer 12 newborn 12 neutrophil 12 neurophysiology 12 Neuromodulation 12 Neurobiology 12 narrative 12 myelin 12 mycophenolate 12 MV 12 mSv 12 Mountain 12 mount 12 Morrison 12 morning 12 Mmax 12 Mix 12 miR 12 minus 12 minimizing 12 Mini 12 MFDT 12 Meier 12 Matthews 12 Mathematical 12 Masliah 12 Marmor 12 Maria 12 Maraganore 12 Mann 12 mammals 12 LTCCs 12 low-intensity 12 long-lived 12 Lond 12 log 12 loads 12 LIPC 12 Leung 12 Lessons 12 Leone 12 leadership 12 LB-induced 12 Lawrence 12 Larsen 12 Lambert 12 Lam 12 kurtosis 12 Koch 12 KK 12 kinds 12 kinases 12 keratinocyte 12 Kellner 12 Kato 12 justice 12 Jansson-Verkasalo 12 Janssen 12 ivory 12 iterative 12 invited 12 invariance 12 intravenously 12 inter-rater 12 interconnected 12 insufficiency 12 Inst 12 Inspection 12 inoculated 12 initiate 12 inhospital 12 infusions 12 infect 12 individualized 12 inactive 12 illumination 12 IL-1beta 12 IFMT 12 IEP 12 IBM 12 hypertrophic 12 Hudson 12 https 12 Houston 12 historically 12 Higgins 12 HH 12 hernia 12 healthier 12 Hashimoto 12 hallmark 12 hair 12 H2A 12 Guyatt 12 Greene 12 g-memory 12 gmail 12 glass 12 Gillespie 12 GDC0941 12 Gasser 12 gaining 12 Funds 12 Fuchs 12 Freeman 12 fold 12 flux 12 fluctuations 12 flicker 12 fibronectin 12 Fertil 12 familiar 12 F3 12 extended-release 12 explaining 12 expense 12 expectation 12 expand 12 exons 12 exhaustion 12 exert 12 evolved 12 euthanized 12 escape 12 Erosion 12 equity 12 epidermolysis 12 epidemiologic 12 Environ 12 endothelium 12 end-expiratory 12 employee 12 emitting 12 elicit 12 EF 12 EB 12 E4 12 DWI 12 DT 12 DP-EES 12 DN 12 D-loop 12 Dix 12 disseminated 12 disk 12 disadvantaged 12 disabling 12 differs 12 die 12 Dickson 12 diaphragm 12 diagnosing 12 deviations 12 deviants 12 develops 12 determines 12 detects 12 designation 12 des 12 Dermatology 12 derivatives 12 derivative 12 denotes 12 deeper 12 decomposition 12 debris 12 Deb 12 DCE 12 datasets 12 cystic 12 cut 12 Cursiefen 12 Critchley 12 courses 12 copper 12 Cooperative 12 controversy 12 continuously 12 contacted 12 Connor 12 Congress 12 Confocal 12 COMt 12 Computing 12 comprehensively 12 comprehension 12 completeness 12 competence 12 combine 12 closed 12 ChIP 12 chief 12 checked 12 Chase 12 chart 12 characterised 12 CFB 12 centrifuged 12 CD7 12 CD4-positive 12 causative 12 categorization 12 carbohydrates 12 capabilities 12 Cao 12 BW 12 bullosa 12 Brooks 12 BRONJ 12 bring 12 Brien 12 Bressler 12 breaks 12 bolus 12 Bock 12 Blatter 12 Bland 12 Blackwell 12 Binswanger 12 bi-directional 12 bicycle 12 bevacizumab 12 Bender 12 behalf 12 begins 12 beats 12 banks 12 bands 12 ball 12 autosomal 12 attrition 12 Attempting 12 Atf6 12 assign 12 Arsac 12 Armstrong 12 arises 12 arbitrary 12 applicability 12 ANT 12 ANOVAs 12 analytic 12 Allergy 12 AHI 12 agricultural 12 agonist 12 agencies 12 Affairs 12 Aff 12 Adler 12 addresses 12 acquire 12 acknowledged 12 acceptors 12 accelerated 12 abdomen 12 a1 12 89Zr 12 691 12 661 12 657 12 5D 12 557 12 496 12 461 12 441 12 412 12 403 12 394 12 392 12 383 12 380 12 365 12 347 12 346 12 345 12 337 12 330 12 319 12 312 12 301 12 2E 12 298 12 288 12 278 12 258 12 215 12 213 12 212 12 2005a 12 1974 12 197 12 178 12 162 12 1-3 11 Yoon 11 yellow 11 Yale 11 worked 11 Weisberg 11 webpage 11 Wattie 11 Warren 11 Waal 11 w2 11 volleyball-specific 11 visceral 11 Vincent 11 Vicini 11 vesicle 11 vertex 11 vasculitis 11 Vanderbilt 11 upstream 11 unsupervised 11 unresectable 11 unrelated 11 unnecessary 11 Unequal 11 UNC 11 unapproved 11 umbilical 11 ultrasonography 11 TTS 11 TROG 11 transported 11 transitional 11 traditionally 11 Toxicol 11 Touch 11 TORS 11 timed 11 tics 11 TI 11 thrombosis 11 thermometer 11 theme 11 TF 11 tension 11 temporary 11 tegmental 11 technological 11 Technol 11 TAp63 11 syntactic 11 SY 11 Swing 11 swallow 11 Surv 11 surgically 11 surgery-induced 11 supraspinal 11 suppress 11 summarizes 11 subsidies 11 strongest 11 Stock 11 Steven 11 stenotic 11 Steinberg 11 split-belt 11 speculate 11 sinus 11 single-agent 11 SII 11 SHR 11 shopping 11 sentinel 11 semantic 11 segmented 11 sectional 11 Scotland 11 Scholars 11 Savitz 11 Sansom 11 S2-F5 11 Ruth 11 runners 11 RRTs 11 Rowe 11 Rossi 11 ring 11 Richards 11 Rice 11 reversed 11 retreatment 11 reporter 11 removing 11 reductase 11 redistribution 11 reactivation 11 RCTs 11 Rasmussen 11 Radiother 11 radiolabeling 11 R01 11 quintile 11 Quebec 11 qualification 11 quadriceps 11 quadrant 11 Qiagen 11 Puschmann 11 Purdam 11 publicly 11 proximity 11 proposals 11 promotion 11 progressing 11 programmes 11 problematic 11 Prism 11 priority 11 preoperatively 11 preference 11 preexisting 11 Predominant 11 possibilities 11 Political 11 polarization 11 pointed 11 plexus 11 pie 11 phosphatidylcholine 11 phonotactic 11 phenomenology 11 Pharm 11 pertinent 11 persisted 11 peroxidation 11 peroxidase 11 paucity 11 pathologist 11 paraformaldehyde 11 Pandit 11 Paediatr 11 P3 11 oxygenation 11 overload 11 overexpressed 11 Otol 11 Orthop 11 ORs 11 optica 11 OK 11 oil 11 official 11 Occupational 11 OA 11 NR2A 11 notes 11 Norway 11 northern 11 nonlinear 11 NMDARs 11 NINDS 11 neutrophils 11 Neuropsychopharmacology 11 neuroprotection 11 neuropathology 11 neurobehavior 11 neoplasia 11 neighboring 11 NAD 11 myocardium 11 Mutat 11 MPTP 11 MPD 11 modulators 11 modulated 11 miu-opioid 11 mitigate 11 misuse 11 Missouri 11 mirror 11 minimally 11 Millipore 11 Mexican 11 metaphysical 11 mentally 11 MEFs 11 medicines 11 Mech 11 MBFratio 11 MBFabsolute 11 marathon 11 maneuvers 11 malnutrition 11 Malfunction 11 Lund 11 Luminex 11 Ludwig 11 LRRK2 11 low-density 11 losses 11 Lopez 11 Logical 11 LK 11 Lieshout 11 Liebowitz 11 letter 11 let 11 Lerner 11 leak 11 Langston 11 lamina 11 lactam 11 Kraemer 11 Kobayashi 11 knock-in 11 Kennedy 11 Kay 11 Kaeberlein 11 juvenile 11 justify 11 Jeffrey 11 issued 11 ISSN 11 IRX 11 intestine 11 Inter-Set 11 intersection 11 internalized 11 interfere 11 intent 11 injured 11 ingested 11 ineffective 11 inductions 11 incorporating 11 implication 11 implanted 11 immunotherapy 11 illustrates 11 hypersynchronized 11 hydroxylase 11 hybridization 11 hybrid 11 huge 11 HPLC 11 Horizon 11 holoprotein 11 histologically 11 high-dose 11 hierarchical 11 heroin 11 Herman 11 Henry 11 Hart 11 Hancock 11 Hamburg 11 Hallpike 11 half-lives 11 habits 11 GW 11 gut 11 grey 11 Graphpad 11 graphical 11 grafts 11 Graefes 11 Google 11 Goldman 11 geometry 11 geographical 11 Fujimoto 11 Franklin 11 fragmentation 11 focuses 11 flexibility 11 FKGL 11 files 11 Famiglietti 11 fairly 11 facing 11 facilitated 11 face-to-face 11 Extra 11 extensor 11 expressions 11 Expanding 11 exclusive 11 exceed 11 Ex 11 ethanol 11 establishment 11 erythematosus 11 Erp 11 Era 11 EQ-5D 11 entering 11 enter 11 enrichment 11 eNOS 11 Eng 11 Endosc 11 encounter 11 emerge 11 embryonic 11 ellipsoid 11 Elizabeth 11 electrode 11 efflux 11 efficiently 11 Edward 11 educators 11 ECOG 11 Eastern 11 East 11 earliest 11 durable 11 driver 11 drawing 11 dramatic 11 drafted 11 double-masked 11 dose-dependent 11 dorsolateral 11 Donovan 11 disturbance 11 dissected 11 disrupts 11 disposition 11 disordered 11 Directors 11 director 11 dilated 11 differing 11 dichotomized 11 Diagn 11 DHI 11 detector 11 desired 11 Della 11 Davies 11 Davidson 11 Cz 11 CTM 11 CRNAs 11 CRM 11 C-peptide 11 convenient 11 contrasting 11 continuum 11 constitutes 11 constants 11 conservation 11 Connell 11 conformational 11 conformal 11 compensation 11 compelling 11 Committees 11 Cochran 11 CN 11 CML 11 classifiers 11 citations 11 circadian 11 cigarettes 11 CHU 11 cholesteryl 11 choices 11 chemotaxis 11 chemo-irradiation 11 chemoimmunotherapy 11 Charvet 11 Chapman 11 Chantada 11 cgi 11 CES-D 11 CD45 11 Carl 11 caregiver 11 Capnography 11 capability 11 cancerization 11 calpain-mediated 11 caffeine-containing 11 cactus 11 Burger 11 Buresh 11 Buck 11 breath 11 brachial 11 bottom 11 bony 11 Biobehav 11 biased 11 between-group 11 Berry 11 Bergman 11 Becker 11 beads 11 backgrounds 11 av 11 augmentation 11 ATPase 11 Atlanta 11 assayed 11 Asian 11 ARPE-19 11 approximation 11 apparatus 11 anti-CD20 11 anticancer 11 Antiangiogenic 11 answers 11 annually 11 Annotation 11 angular 11 analytes 11 analyse 11 analogous 11 ambiguous 11 alpha-spectrin 11 allogeneic 11 Ahn 11 Age-associated 11 agar 11 adjustments 11 activates 11 acquisita 11 Abbreviations 11 A2E-loaded 11 89Zr-DFO-A33 11 790 11 699 11 5F 11 564 11 538 11 514 11 410 11 372 11 357 11 356 11 354 11 352 11 350 11 338 11 323 11 296 11 274 11 272 11 263 11 260 11 254 11 252 11 251 11 24-hour 11 249 11 243 11 239 11 226 11 224 11 223 11 221 11 214 11 206 11 15-19 11 111In 11 1038 11 -1 11 012 11 011 10 Zweifel 10 youths 10 Yairi 10 Wszolek 10 wish 10 willingness 10 Wilkinson 10 Wider 10 WI 10 whereby 10 went 10 Wen 10 Welsh 10 well-established 10 Weiner 10 weighting 10 websites 10 Weber 10 WAIS-III 10 vulgaris 10 vousden 10 voice 10 Viking 10 vials 10 Utrecht 10 utero 10 urgent 10 Up-regulation 10 Universit 10 universally 10 unintentional 10 unified 10 undoubtedly 10 ultrasonographic 10 UGRA 10 tumor-derived 10 truncation 10 Trophic 10 triplication 10 translated 10 transition-aged 10 transcript 10 trametinib 10 Torres 10 tightly 10 tiab 10 TH-positive 10 thalamic 10 Th17 10 terminology 10 Taxes 10 tauopathy 10 task-specific 10 TA-Re 10 Tandem 10 tailored 10 sympathetic 10 swelling 10 suspension 10 Suite 10 suggestions 10 subtest 10 suboptimal 10 subline 10 stressor 10 stent 10 stays 10 SREBP-1 10 spreadsheets 10 spouses 10 Sphenopalatine 10 specialties 10 Specialists 10 sophisticated 10 Solomon 10 small-volume 10 slopes 10 slip 10 sitting 10 sirtuins 10 shifts 10 Sharma 10 Serine 10 Sequeira 10 septic 10 sensitivities 10 Senior 10 semi-structured 10 segmental 10 secretory 10 Seattle 10 Scrambled-AMO 10 Schulz 10 Schmitz-Valckenberg 10 Schmitz 10 Schizophr 10 SCC 10 scanners 10 saturation 10 sarcomas 10 sarcoma 10 Sahlin 10 S1928 10 round 10 rotenone 10 Rossini 10 rigid 10 Riess 10 Rheumatology 10 rhabdomyolysis 10 Reversal 10 retrieval 10 restored 10 residues 10 requested 10 replace 10 remarkable 10 remainder 10 relatives 10 Reims 10 regeneration 10 Redox 10 receptive 10 REC 10 realistic 10 RCT 10 Radiochemical 10 radial 10 RAD 10 rabbits 10 Querques 10 QALY 10 PSR 10 proteasomal 10 propagation 10 PROMIS 10 prescribe 10 premedication 10 precursors 10 preclude 10 Preciado 10 practitioner 10 PPARa 10 post-translational 10 possess 10 polyacrylamide 10 POA 10 PO 10 plasmid 10 Pierce 10 phrenic 10 phenotyping 10 Perry 10 perpendicular 10 permitted 10 permits 10 pay-for-performance 10 payer 10 patient-oriented 10 pathologically 10 packing 10 overtime 10 oversight 10 osteoporosis 10 organelles 10 Oren 10 Oregon 10 Ordinary 10 orbital 10 operated 10 omitted 10 omission 10 oligonucleotide 10 observer 10 Observatory 10 NPV 10 Nov 10 non-surgical 10 non-speech 10 Non-specific 10 non-significant 10 nonparametric 10 noninferiority 10 Nilsson 10 NHR-49 10 NHMRC 10 Neutropenia 10 neurotransmitter 10 Neurorehabil 10 neuromyelitis 10 neurocognitive 10 neuro 10 neurite 10 neighbor-joining 10 negligible 10 negativity 10 NDP 10 nCounter 10 nadir 10 n1 10 Mulcahy 10 motility 10 moderate-to-severe 10 MMWR 10 microstructure 10 Micheva 10 Michel 10 mediating 10 McGill 10 MATLAB 10 Marcus 10 makers 10 magnesium 10 MacDonald 10 lV 10 lunch 10 LORs 10 LOA 10 lived 10 lin-4 10 light-induced 10 ligands 10 lies 10 licenses 10 Lesage 10 lengthy 10 LEMD1 10 legislation 10 legacy 10 leave 10 Lau 10 laryngeal 10 Lamb 10 Kyoto 10 KW 10 Kuhl 10 Kramer 10 Kraaimaat 10 Kiss 10 kHz 10 Keefe 10 Karin 10 Kappas 10 Jia 10 Jeong 10 Jena 10 iterations 10 Israel 10 isotope 10 islamic 10 IODO-GEN 10 iodine 10 intrinsically 10 Intraclass 10 Interv 10 Interplay 10 insert 10 Innovation 10 INL 10 initiates 10 ingestions 10 influx 10 infiltrate 10 infarcts 10 industrialized 10 indirectly 10 incorporation 10 Incoming 10 inadmissible 10 inactivity 10 impression 10 imposed 10 IJ 10 IDI 10 ICD-10 10 Ib 10 hypoxic 10 hydroxyapatite 10 HY 10 Hruby 10 Horton 10 homogeneous 10 homeostatic 10 Hoffmann 10 Hoboken 10 HIV-Infected 10 Hitzenberger 10 high-speed 10 herd 10 hemodynamically 10 heme 10 heavily 10 hearts 10 HD 10 Hausdorff 10 harms 10 hallucinations 10 hallmarks 10 HALE 10 GT 10 Griffiths 10 granule 10 Grabiner 10 Goodman 10 GOF 10 glia 10 Gilbert 10 Giasson 10 Ghosh 10 generating 10 generates 10 gels 10 GBS-negative 10 GB 10 Garcia 10 Gandevia 10 G209A 10 friend 10 Francis 10 FOXO3A 10 formulations 10 FOCUS-220 10 Fluor 10 fludarabine 10 Fletcher 10 flap 10 Fins 10 filtered 10 filed 10 file 10 fertilization 10 fellows 10 fellow 10 Feldman 10 Federation 10 Fan 10 fair 10 extremities 10 exploration 10 exercise-based 10 execution 10 exceptional 10 exceeding 10 event-related 10 ETDRS 10 ERK 10 equivalents 10 enucleation 10 enlarged 10 engineered 10 enforcement 10 end-stage 10 enabling 10 EMG 10 eliminating 10 EH 10 Econ 10 eat 10 eAddenda 10 dumping 10 dropped 10 doubt 10 doubled 10 DOTA 10 distances 10 displaying 10 disease-associated 10 discipline 10 discharges 10 disappearance 10 dioxide 10 Dindo 10 dimensional 10 diffusivities 10 Dicer 10 diabetics 10 desaturation 10 dentate 10 Dent 10 denominator 10 definitively 10 defense 10 deeply 10 decide 10 debated 10 Dawson 10 cytoprotective 10 cutpoint 10 C-terminal 10 crude 10 Croce 10 Creative 10 covers 10 county 10 countermovement 10 correlative 10 Coresh 10 Coordinated 10 contributor 10 contract 10 consultancy 10 constant-load 10 confer 10 complaints 10 commentary 10 collagenous 10 coils 10 cognitively 10 Clonality 10 cleared 10 Clavien 10 circles 10 cingulotomy 10 Christensen 10 Choristoma 10 Chong 10 chloride 10 chemoradiation 10 certainty 10 census 10 cell-mediated 10 CD45-133 10 cation 10 capsules 10 Cantril 10 Canberra 10 Campos 10 calpain-cleaved 10 Cai 10 C57Bl 10 C4 10 BY-NC-ND 10 Bullmore 10 build 10 branch 10 BPCA 10 Bordeaux 10 Blalock 10 BK 10 biotinylation 10 Bihan 10 Bernstein 10 Bennett 10 Bell 10 beds 10 Bayer 10 Basak 10 Badr 10 AZ 10 axillary 10 Avenue 10 Ave 10 avascular 10 autonomy 10 autofluorescent 10 authorities 10 atrophic 10 ataxia 10 Arendt 10 archive 10 Arab 10 appearing 10 aperture 10 antiepileptic 10 angiograms 10 Andersen 10 amendment 10 ambulatory 10 Amann 10 alternatives 10 Alpha-Melanocyte 10 Alongside 10 AJR 10 aiming 10 agriculture 10 aggressiveness 10 aggression 10 affinities 10 adversely 10 adopt 10 abundance 10 A2E-loading 10 965 10 725 10 6A 10 667 10 649 10 647 10 575 10 525 10 519 10 506 10 488 10 480 10 449 10 448 10 447 10 445 10 422 10 405 10 401 10 399 10 397 10 395 10 393 10 391 10 371 10 368 10 362 10 342 10 333 10 31P 10 308 10 3000 10 2-way 10 297 10 294 10 2500 10 232 10 212Bi 10 1-carbon 10 1990s 10 1970 10 1967 10 18F-FDG 10 177Lu 10 025 10 007 9 Zealand 9 Yun 9 Yehoshua 9 Ye 9 X-ray 9 XBP1u 9 worthwhile 9 Wolfe 9 wind 9 willing 9 Whilst 9 WD 9 warrants 9 Warner 9 want 9 VP 9 VO2max 9 vitamins 9 virgin 9 violations 9 vice 9 vial 9 versa 9 Vaughan 9 Vaidyanathan 9 utilize 9 usability 9 URM 9 unexpectedly 9 undirected 9 undertaking 9 underestimated 9 tuboplasty 9 tubing 9 Tsang 9 truly 9 triglyceride 9 trees 9 transoral 9 transform 9 Toxicology 9 topics 9 Tonsillectomy 9 Todd 9 TN 9 TMA 9 titers 9 timepoints 9 tiers 9 tic 9 Thrombolysis 9 throat 9 threat 9 thousands 9 Thermo 9 territories 9 tell 9 teenage 9 taste 9 Tanner 9 SUZ12 9 sustain 9 supernatant 9 supermarket 9 sulfate 9 substage 9 Subsarcolemmal 9 sub-RPE 9 streptozotocin 9 strata 9 Stinson 9 Steele 9 state-of-the-art 9 starts 9 spreading 9 specify 9 sparing 9 someone 9 SLI 9 skull 9 SKN-1c 9 signal-to-noise 9 sideways 9 shortening 9 shaped 9 s-eye 9 Serv 9 Serono 9 sensitization 9 semi-automated 9 seizures 9 Scottish 9 Scholl 9 Schmoll 9 scattered 9 saw 9 saved 9 satisfactory 9 Sam 9 Salivary 9 SAEs 9 S7 9 S1-N5 9 RTOG 9 ROSSITER 9 Rockville 9 rinsed 9 rhesus 9 Reyes 9 retinoid 9 retinas 9 resorption 9 replicates 9 repetitive 9 repeatability 9 Ren 9 registries 9 Refinement 9 Reeves 9 Reed 9 recordings 9 reciprocal 9 reacted 9 rCBVCER 9 rCBV 9 RC1 9 Rahimi 9 radiologist 9 Quinzio 9 QuikCheckTM 9 questioned 9 Queen 9 QALYs 9 PY 9 Pub 9 psychotropic 9 psychophysical 9 Psychoneuroimmunology 9 PSMB5 9 proteolytic 9 prompted 9 proliferative 9 projected 9 progressed 9 Prof 9 primates 9 preventable 9 presumed 9 prerequisite 9 premise 9 prematurely 9 PREA 9 PPV1 9 Powell 9 Porter 9 pooling 9 polarized 9 polarity 9 pmol 9 PLP 9 Pine 9 photograph 9 phenomenological 9 pharmacy 9 pharmacotherapy 9 personalized 9 performance-based 9 percutaneous 9 penetration 9 pending 9 PEMT 9 Peberdy 9 paths 9 partitioning 9 particle 9 Parker 9 parenting 9 paradox 9 Oxman 9 outstanding 9 outflow 9 osteoblasts 9 organic 9 optimizing 9 opinions 9 operations 9 one-way 9 one-sided 9 offset 9 offline 9 nt 9 NSE 9 nothing 9 Notation 9 Northwestern 9 north-west 9 Nonsteroidal 9 non-small 9 nonsignificant 9 nonresponders 9 nonpregnant 9 non-LB 9 nonhuman 9 NMOSD 9 Nixon 9 nitrogen 9 NF-kappaB 9 Newton 9 newer 9 neurotoxic 9 Neuroreport 9 Neuromuscul 9 nei 9 negatives 9 Nations 9 named 9 Namasivayam 9 multiplex 9 MSS 9 msec 9 MRS 9 Montevecchi 9 modifying 9 misclassification 9 miR-34 9 MiR-22 9 mimics 9 mimicking 9 Milwaukee 9 Millwood 9 Mills 9 Millet 9 Milestone 9 Milano 9 MHz 9 Methyl 9 merits 9 mere 9 Mercer 9 Memorial 9 membership 9 measurable 9 MCSA 9 McLean 9 Matthew 9 mathematics 9 Math 9 Markus 9 marks 9 mapped 9 manipulations 9 Manag 9 malignancy 9 Makita 9 mail 9 macroscopic 9 lysis 9 lysine 9 lymphatic 9 LXRs 9 Ludlow 9 Lucas 9 LOT 9 looked 9 Loh 9 localize 9 lobes 9 LLC 9 Lilly 9 Levey 9 lethality 9 Leiden 9 legs 9 left-handed 9 League 9 LDL-R 9 Larson 9 labels 9 Kuo 9 Kozuma 9 Koh 9 killer 9 Kessler 9 Kelly 9 Keller 9 keep 9 Kahn 9 JV 9 journals 9 Jose 9 Johnston 9 Jenkins 9 Jankovic 9 Jaisson 9 Iwatsubo 9 IREDs 9 inversion 9 intraregional 9 intraperitoneally 9 intraoperatively 9 intranigral 9 interneurons 9 interleukin-6 9 intention 9 integrins 9 Integr 9 inspired 9 insertion 9 inherently 9 info 9 industrial 9 independence 9 incidents 9 inaccurate 9 improper 9 implies 9 immunosorbent 9 immunoreactive 9 IL-1b 9 idiopathic 9 identifiable 9 IDDS 9 ICD-9 9 IC 9 hypofunction 9 hypersynchronization 9 hyperintensities 9 Hughes 9 HTA 9 Honoraria 9 homolog 9 homogenized 9 HIF1a 9 Henle 9 hemiparetic 9 headaches 9 HCV 9 Hayashi 9 Hattori 9 Harbor 9 Hara 9 haplotype 9 Haemodynamic 9 H3 9 Gynecologists 9 govern 9 glycoprotein 9 Gershon 9 Genentech 9 GCH1 9 gabaergic 9 Frye 9 FRC 9 FOXO1 9 Footnotes 9 Folstein 9 folic 9 Fleckenstein 9 flare 9 FIH 9 fibrillation 9 Feany 9 FBP 9 Fawzi 9 favour 9 fat-7 9 Farrell 9 facilitating 9 extensors 9 extensions 9 experimentally 9 expenditures 9 existed 9 exhibits 9 exhibiting 9 exerted 9 exciting 9 exactly 9 evolutionary 9 estrogen 9 equilibrium 9 EO 9 Endocrinology 9 encounters 9 encodes 9 enabled 9 Emma 9 Ellis 9 eliminate 9 Eleven 9 elementary 9 early-stage 9 Durham 9 drinking 9 Dp1401 9 Doyle 9 Downward 9 dosimetry 9 dominated 9 disrupt 9 discarded 9 disagreement 9 disadvantages 9 Dichotomous 9 desire 9 designing 9 descriptors 9 densities 9 Dennis 9 Denham 9 delays 9 definitely 9 decorrelation 9 declining 9 dauer 9 Danish 9 CX3CR1 9 criminal 9 creates 9 coronal 9 convergence 9 consumed 9 consulting 9 consultations 9 Constraint-induced 9 confined 9 concentrated 9 computerized 9 compute 9 comprise 9 compliant 9 completing 9 communications 9 communicate 9 collecting 9 Cole 9 coagulation 9 Classifier 9 clarified 9 circumstances 9 cholesterol-related 9 Chemicals 9 characterizing 9 challenged 9 CFP 9 ceiling 9 CD7-CD3 9 ccr 9 Catterall 9 cataracts 9 catabolism 9 Carson 9 Carr 9 caring 9 capsulotomy 9 Cannon 9 CANAVERO 9 canalith 9 Campochiaro 9 Cameron 9 cameras 9 calcineurin 9 cadmium 9 Byrd 9 Busch 9 BTZ-resistant 9 BSc 9 Bruce 9 Bronson 9 Briggman 9 Brand 9 brachytherapy 9 BP-BES 9 Boyer 9 BOLD 9 Boer 9 bloodstream 9 BLamD 9 Bjorkhem 9 BIRNBAUM 9 Biosciences 9 Biometrics 9 biologically 9 biloma 9 beta-catenin 9 Bedwell 9 bear 9 bath 9 Baik 9 Bahr 9 awarded 9 ATEM 9 asymmetric 9 aspirated 9 Askling 9 A-scans 9 artistic 9 arrays 9 arithmetic 9 arguments 9 aqueous 9 approached 9 appreciate 9 anti-bodies 9 anhedonia 9 angina 9 Andrade 9 ancillary 9 analyzer 9 anaesthetic 9 anaemia 9 a-melanocyte 9 alloP 9 allied 9 Alexa 9 albeit 9 Albany 9 Agid 9 aggregated 9 age-matched 9 aforementioned 9 Affibody 9 afferent 9 aetiology 9 advantageous 9 advancement 9 adjunctive 9 adds 9 acutely 9 Acknowledgment 9 accountability 9 accomplished 9 accommodate 9 accept 9 absorbed 9 Abramoff 9 abolished 9 96-well 9 944 9 921 9 919 9 915 9 -80 9 7B 9 740 9 6-minute 9 642 9 606 9 5G 9 594 9 567 9 550 9 533 9 526 9 515 9 512 9 510 9 507 9 501 9 5- 9 4th 9 497 9 489 9 485 9 481 9 477 9 465 9 464 9 446 9 442 9 433 9 427 9 425 9 421 9 415 9 409 9 3-way 9 3-kinase 9 390 9 385 9 376 9 343 9 331 9 324 9 313 9 2-sided 9 2-min 9 281 9 275 9 271 9 267 9 266 9 261 9 253 9 230 9 219 9 212Pb 9 2008b 9 2- 9 1980s 9 1968 9 1947 9 18-month 9 168 9 11C 9 1109 9 10-19 9 10-14 9 026 9 014 9 010 8 Zurich 8 z-score 8 YW 8 YT 8 Yogesan 8 YJ 8 YH 8 xSampleSize 8 Xia 8 workload 8 workforce 8 Woo 8 Wkly 8 within- 8 Wistar 8 wisdom 8 Windows 8 Whitney 8 whatever 8 Werner 8 well-defined 8 Weir 8 weakening 8 waveform 8 warning 8 Walter 8 Wahr 8 voltage 8 VMpo 8 vigorous 8 viewpoint 8 ventricular 8 veins 8 Vazquez 8 vasodilation 8 Vasan 8 Vance 8 utilised 8 U-test 8 USDHHS 8 unlimited 8 unipolar 8 Union 8 undertake 8 underrepresented 8 underpowered 8 unconscious 8 Unbiased 8 ultimate 8 tumor-to-muscle 8 tumor-specific 8 tukey 8 Tsai 8 triple-negative 8 treatment-refractory 8 treatment-emergent 8 transmitted 8 Transmembrane 8 transfected 8 transduction 8 transducer 8 transcriptomic 8 transcribed 8 transcendence 8 trajectory 8 traces 8 Town 8 Tonkonogi 8 tones 8 tomograms 8 Toft 8 tm2182 8 TJC 8 tiered 8 threats 8 threatening 8 Thorac 8 Thin 8 thick 8 TGFbR2 8 tertiary 8 tennis 8 tbS 8 tauopathies 8 talk 8 talented 8 Tajerian 8 tachycardia 8 T3 8 synthesize 8 synovial 8 synergy 8 synchrony 8 synchronized 8 Symp 8 Swiss 8 Sutton 8 suppresses 8 supplements 8 superiority 8 Sulzer 8 substitutions 8 substages 8 Subscale 8 subgenual 8 Strait 8 Sterling 8 STATA 8 starvation 8 Starr 8 stabilizing 8 Stabell 8 squats 8 Spring 8 sporns 8 spillover 8 sperm 8 speckle 8 spasticity 8 Souza 8 Sons 8 Sommer 8 skilled 8 skewed 8 Sit 8 Simpson 8 simplicity 8 Signed 8 Siegel 8 ShHor 8 Sheridan 8 separating 8 seemingly 8 seed 8 sectioning 8 secrete 8 seated 8 sclera 8 Schuster 8 Schroeder 8 Schoenfeld 8 schizo-phrenia 8 Sch 8 scarce 8 says 8 satisfy 8 Santen 8 Samuels 8 sampled 8 salt 8 RV 8 ruled 8 Rudmik 8 RPSS 8 rpm 8 Rotter 8 rotation 8 Rosenberg 8 Ron 8 robustness 8 robot 8 Ro 8 Rio 8 Rights 8 rhythms 8 rhythm 8 RFC 8 revisited 8 returning 8 retinoids 8 restoring 8 residue 8 resembles 8 reportedly 8 repertoire 8 renders 8 remoteness 8 relied 8 reimbursement 8 Reid 8 Regul 8 regenerative 8 refused 8 refine 8 Reddy 8 rectum 8 recombination 8 reclassified 8 reaches 8 ray 8 Rappaport 8 Rapantzikos 8 Ramaekers 8 Rajput 8 RAI 8 radioisotopes 8 quantities 8 quantifications 8 quality-adjusted 8 qualitatively 8 Qtw 8 PVL 8 PV 8 pursue 8 purity 8 purely 8 puncture 8 Publishing 8 Psychooncology 8 PSP 8 psoriatic 8 prostate-specific 8 proprioception 8 pro-inflammatory 8 program-specific 8 prime 8 pressures 8 presentations 8 preparing 8 prematurity 8 prednisone 8 prednisolone 8 predisposition 8 predetermined 8 preceding 8 potentiation 8 Postgraduate 8 Poses 8 popularity 8 pools 8 polyunsaturated 8 PoCD 8 PN 8 plastic 8 plasmablasts 8 physiologically 8 Physics 8 PFC 8 person-years 8 permit 8 permission 8 Permezel 8 Pemp 8 peer-reviewed 8 pedigree 8 PBL 8 Paxinos 8 passage 8 participates 8 Paris 8 Paranasal 8 parahippocampal 8 paradigms 8 Papadimitriou 8 Pang 8 Panels 8 pains 8 pack 8 p73 8 p63 8 OxyContin 8 Owen 8 overproduction 8 overestimate 8 ours 8 osteoarthritis 8 OSEM 8 oropharyngeal 8 ophthalmologist 8 Ophthal 8 OP 8 oncologist 8 oligomeric 8 off-protocol 8 oedema 8 obligatory 8 Obes 8 Oaks 8 numerical 8 N-terminal 8 NRT 8 noticed 8 noticeable 8 normoxia 8 Norman 8 normal-tissue 8 normality 8 nonsense 8 non-parametric 8 nonopioids 8 nonnegligible 8 non-fatal 8 non-depressed 8 nodules 8 NIR 8 Neuroradiol 8 neuroma 8 neuroendocrine 8 neurobehavioral 8 neurites 8 Neilson 8 neighborhoods 8 naturally 8 Names 8 naloxone 8 nal 8 Nakagawa 8 Nagel 8 multiplications 8 multi-institutional 8 MSD 8 MRI-based 8 mounting 8 motivated 8 Morimoto 8 Moon 8 Monte 8 monocyte 8 molecularly 8 Mohammed 8 mofetil 8 modulating 8 modelling 8 model-based 8 mm3 8 Mizuno 8 mitophagy 8 miR-17-92 8 miR-135b-AMO 8 Mini-mental 8 Miner 8 Mikkelsen 8 Middleton 8 microenvironment 8 microdissected 8 metropolitan 8 methyltransferase 8 methanol 8 mention 8 melanoma-bearing 8 melanogaster 8 melanin 8 mechanically 8 McKay 8 maximizing 8 matters 8 Mason 8 Masland 8 Mary 8 Marsteller 8 Marsh 8 marrow-derived 8 Mao 8 manifested 8 mandate 8 magnitudes 8 M1 8 lysates 8 Lynch 8 LXR 8 lowering 8 looks 8 local-regional 8 listener 8 Lifting 8 life-threatening 8 lgmL 8 Lewandowski 8 Leibenluft 8 legitimate 8 LAURA 8 late-life 8 Lastly 8 Lasers 8 lacks 8 L4 8 L-1 8 KV 8 Kulminski 8 Kruger 8 Knife 8 Kleim 8 KF 8 Keane 8 Kaganovich 8 Kachergus 8 JWD 8 Junior 8 juice 8 judgement 8 Jos 8 joined 8 Johns 8 jaundice 8 Jaros 8 Jacobsen 8 JAB 8 islets 8 ischaemia 8 irradiation 8 irradiated 8 intron 8 introducing 8 intra-ocular 8 intra- 8 interpretations 8 insoluble 8 Inoue 8 innervation 8 innate 8 infection-control 8 Indianapolis 8 indeterminate 8 inconsistency 8 in-class 8 impede 8 immunosuppression 8 immunostained 8 Immun 8 imaging-based 8 IkappaBalpha 8 identifiers 8 Identifier 8 ideas 8 icons 8 Iconic 8 icon 8 ICMJE 8 hyposynchronization 8 hypometabolism 8 hypercholesterolemia 8 Hunt 8 humanized 8 Hulstijn 8 Hulihan 8 Howard 8 House 8 Hounsfield 8 homeobox 8 Holmes 8 Holding 8 histotype 8 histograms 8 Hirsch 8 high-fat 8 hidden 8 HFpEF 8 hereditary 8 hereafter 8 hematoma 8 Hematol 8 helping 8 HbA1c 8 Hartmann 8 happy 8 HACA 8 H2O2 8 H2O 8 Gynaecol 8 Gurses 8 Gu 8 Groot 8 Greece 8 grateful 8 gram 8 gradual 8 gradients 8 governing 8 GK 8 ger 8 Georgiou 8 genesis 8 generator 8 gauge 8 gathered 8 Gates 8 GABAARs 8 Fuzzy 8 Fundacio 8 Fund 8 frontotemporal 8 Frisoni 8 forth 8 Fornari 8 forces 8 Foley 8 floxed 8 filipin 8 Fifteen 8 FH 8 Fernand 8 Ferguson 8 FEBS 8 feared 8 FB 8 Fam 8 factor-a 8 faced 8 F-18 8 extrinsic 8 externally 8 exome 8 evil 8 Eva 8 etal 8 equipped 8 EOV 8 entoptic 8 entity 8 enters 8 enrollees 8 enormous 8 endovascular 8 endorsement 8 endorsed 8 embarrassment 8 eluted 8 Elder 8 eld 8 EK 8 educating 8 ECs 8 ecology 8 Early-life 8 E3 8 dysregulated 8 Dunham 8 Duke 8 Duda 8 Dubra 8 dryness 8 druse 8 drawbacks 8 donkey 8 doctors 8 Doctoral 8 doctor 8 DOAs 8 dissolved 8 dissociation 8 Dissemination 8 disproportionate 8 dispensable 8 disfluencies 8 disadvantage 8 diminishes 8 Dickinson 8 DIATHESIS-STRESS 8 developmentally 8 detoxification 8 dependency 8 Denver 8 densitometry 8 delirium 8 delaying 8 deficiencies 8 deferred 8 Deelen 8 Deeks 8 Davare 8 dates 8 Darmstadt 8 Daly 8 dabigatran 8 CYP11A1 8 cylinder 8 CXCL13 8 custom 8 curricula 8 CTX 8 Cronin 8 CRH 8 creativity 8 creativecommons 8 Crawford 8 co-workers 8 Counter 8 Coso 8 corroborate 8 corresponded 8 Cornell 8 coordinator 8 Cooperation 8 contributory 8 contrasts 8 contraindications 8 continuity 8 consumers 8 consulted 8 Constitutive 8 constituent 8 consonants 8 conservatively 8 consecutively 8 connectomes 8 confirms 8 Conf 8 concordance 8 conceived 8 compensate 8 compares 8 commencement 8 colour 8 colliculi 8 cloud 8 CLIP 8 Clinicopathologic 8 CJP 8 cite 8 circle 8 chronicity 8 chorionic 8 Chiu 8 Chesselet 8 checklist 8 Charles 8 characterisation 8 certified 8 CBD 8 Caucasians 8 catabolites 8 Carter 8 cardiorespiratory 8 captures 8 capita 8 calpastatin 8 calories 8 Calcific 8 cadaver 8 C1 8 bypass 8 BYL719 8 Burns 8 bullying 8 brought 8 bronchiolitis 8 Bristol 8 Brennan 8 breeding 8 branching 8 branches 8 brain-derived 8 BPI 8 Bok 8 BMPs 8 blunt 8 blotting 8 bisphosphonate 8 biomechanical 8 Bioinformatics 8 BG 8 beverage 8 best-corrected 8 Beekman 8 Beck 8 Baxter 8 Bastian 8 baclofen 8 Bachmann 8 Babiloni 8 autonomic 8 Autoimmunity 8 aura 8 augmented 8 Aug 8 atrial 8 ATG 8 assure 8 assistant 8 ASSFN 8 assesses 8 Asp 8 asking 8 ascertain 8 artifact 8 Aquinas 8 Apr 8 appetite 8 APA 8 Antonio 8 antiretroviral 8 antigens 8 anatomically 8 anaesthetist 8 Anaesthesiology 8 Anaesthesiol 8 amniotic 8 altering 8 alpha-synucleinopathy 8 alleviate 8 alignment 8 align 8 Alder 8 Alden 8 alcoholism 8 Aguilera 8 age-specific 8 agerelated 8 afterwards 8 afferents 8 adiposity 8 Adam 8 Acquisitions 8 ACEP 8 accompanying 8 accession 8 acceleration 8 abrupt 8 Aboriginal 8 abnormally 8 Abeta1 8 Ab1 8 A78 8 90Y 8 8-OHdG 8 811 8 803 8 792 8 761 8 728 8 722 8 715 8 704 8 675 8 662 8 651 8 617 8 5-minute 8 5-cholestenoic 8 589 8 588 8 587 8 573 8 571 8 569 8 555 8 553 8 541 8 540 8 535 8 532 8 518 8 502 8 4-fold 8 494 8 479 8 457 8 456 8 455 8 450 8 417 8 413 8 411 8 -4 8 4- 8 3-month 8 3-min 8 388 8 379 8 377 8 3-6 8 348 8 336 8 334 8 332 8 328 8 318 8 304 8 2-mm 8 2h 8 2D-DIGE 8 292 8 291 8 24-hydroxycholesterol 8 24h 8 233 8 227 8 202 8 2008a 8 -20 8 1H 8 1971 8 1969 8 1962 8 1936 8 188Re- 8 1071 8 024 8 016 8 013 8 009 7 Zorumski 7 youngest 7 YM 7 YKH 7 yearly 7 YC 7 Yasuno 7 xi 7 xenograft 7 WTP 7 Wray 7 worm 7 Woods 7 Willcox 7 Willardson 7 Wilder 7 well-known 7 Weinberger 7 weaker 7 washing 7 warm-up 7 warfarin 7 wanted 7 walls 7 Wallis 7 Wallace 7 Wakamatsu 7 waived 7 Vos 7 VKA 7 visualize 7 visited 7 viewing 7 verification 7 ver 7 ventricle 7 vastus 7 VASARI 7 vanishing 7 Vancouver 7 validating 7 uvulopalatopharyngoplasty 7 User 7 use1 7 Urol 7 ureteral 7 Upwards 7 upward 7 unsatisfactory 7 UNOS 7 Universitaire 7 uneventful 7 undesirable 7 undertook 7 underlies 7 underestimate 7 uncommon 7 ultrasoundguided 7 UI 7 ubiquitous 7 typing 7 TXtr 7 twitches 7 twelve 7 turning 7 turned 7 Turk 7 trying 7 try 7 truth 7 Trizol 7 trichrome 7 trials21 7 treatment-resistant 7 treatment-associated 7 treatable 7 transvesical 7 transthoracic 7 transporters 7 translating 7 Transl 7 transcyclooctene 7 transcriptionally 7 trait 7 tracks 7 Toth 7 topological 7 Tomogr 7 titles 7 titer 7 Tissenbaum 7 Till 7 tight 7 tidal 7 Tian 7 Thorpe 7 thorough 7 Thirteen 7 therapists 7 Thakur 7 TGo 7 terrorist 7 terror 7 temperatures 7 Tasdizen 7 tags 7 T1w 7 switching 7 suppressive 7 suppressed 7 superoxide 7 superficial 7 subtracting 7 subpopulation 7 sublethal 7 subclasses 7 sub 7 Su 7 style 7 stutterers 7 stroma 7 strokes 7 stratum 7 story 7 store 7 stomach 7 stimulations 7 stimulates 7 sterile 7 stereotypical 7 stepwise 7 Standl 7 Stambolsky 7 SSB 7 SR-BI 7 splicing 7 splice 7 Spengler 7 specificities 7 spaces 7 Souied 7 sorted 7 somatotopic 7 Soliz 7 sole 7 Smidt 7 Small-animal 7 Slack 7 SKN-1-dependent 7 Sirtuin 7 SIR2 7 single-leg 7 single-energy 7 Simeone 7 silenced 7 signi 7 Sierra 7 sides 7 shuttle 7 sheet 7 shed 7 shares 7 shapes 7 Shannon 7 sham-controlled 7 Shaffer 7 setup 7 Ser 7 sensors 7 seminal 7 sedative 7 security 7 secure 7 second-generation 7 SDS 7 scrutiny 7 screens 7 scientifically 7 saturated 7 Santos 7 salient 7 Sakamoto 7 S5A 7 S32 7 Ryu 7 RxOs 7 Ruiz 7 rugby 7 Roy 7 Row 7 Roth 7 rotating 7 Rosa26-CreERT2 7 Ronald 7 Romero 7 Rome 7 Rochester 7 Robbins 7 RNEasy 7 risperidone 7 risk-adjusted 7 rising 7 RI 7 Rhinol 7 retardation 7 resistive 7 reproduction 7 REpresentational 7 replicate 7 relying 7 relieving 7 refractoriness 7 Reese 7 recruit 7 RecoverAll 7 reconstructions 7 Recherche 7 reassessed 7 Ratner 7 Raoul 7 ranked 7 Ramaswamy 7 raising 7 radius 7 radioiodinated 7 radioimmunotherapy 7 radioactive 7 questionable 7 qualityforum 7 QST 7 Qi 7 pyruvate 7 pyridoxamine 7 PYGM 7 Purdue 7 PUFAs 7 Psychopharmacol 7 psychologist 7 Province 7 prototype 7 prominently 7 programming 7 prognostication 7 Pro-Ed 7 productivity 7 priorities 7 printed 7 PRIMA-1 7 preserve 7 pregnenolone 7 preferential 7 predictiveness 7 precipitated 7 preceded 7 PRE 7 practiced 7 PPV3 7 Posture 7 post-surgery 7 poly-morphism 7 Pollard 7 Poisson 7 Poisoning 7 plaque 7 pitfalls 7 Pik3caflox 7 pii 7 Pihlstrom 7 phylogenetic 7 photopic 7 photometry 7 phosphoinositide 7 phosphate-buffered 7 philosophy 7 philosophical 7 Phila 7 phagocytosis 7 Petersen 7 permitting 7 Penke 7 PEDs 7 pedigrees 7 pediatric-aged 7 Pearce 7 peaks 7 peaked 7 PD-like 7 PD-derived 7 PCI-32765 7 patient-centered 7 pass 7 Parsian 7 parkinsonian 7 parenchyma 7 paracrine 7 Pain-QuILT 7 paclitaxel 7 pacemaking 7 Ozansoy 7 oxysterol 7 owns 7 overrepresentation 7 outline 7 outliers 7 outbreaks 7 oto-rhinolaryngologic 7 orthopaedic 7 Ordovas 7 Ophthalmologists 7 opened 7 onward 7 one-half 7 Olive 7 oligomers 7 OD 7 obsessive-compulsive 7 objectively 7 Obeng 7 N-terminus 7 novelty 7 Novelli 7 noteworthy 7 notch 7 normalize 7 nonnormalized 7 non-financial 7 non-enzymatic 7 nonenhanced 7 non-CTM 7 Nogales-Gadea 7 nn 7 NMR 7 NF-kappa 7 NF- 7 nez 7 newborns 7 neurovascular 7 Neurotol 7 neurosteroid 7 Neuropsychopharmacol 7 neuroanatomy 7 Neumann 7 netrin-1 7 neo-vascularization 7 neoplasm 7 nematode 7 needles 7 necessity 7 nearby 7 Neale 7 NCX 7 nchs 7 Nazi 7 Nanostring 7 musculotendinous 7 Musch 7 multisource 7 multiplicative 7 multiforme 7 multi-feature 7 multifaceted 7 Mueller 7 MTP 7 MRtr-based 7 Mortal 7 morphometric 7 Morin 7 Moran 7 money 7 modulator 7 modular 7 modifies 7 Modifiable 7 moderately 7 moderate-intensity 7 Miyamoto 7 misleading 7 misfolding 7 miR-24 7 mining 7 Miller-Payne 7 Microdissection 7 Mexican-American 7 methylene 7 metaanalysis 7 Mercy 7 Menghini 7 Menendez 7 Melzack 7 Mellick 7 MEH 7 MEG 7 medical-directed 7 McNeil 7 McManus 7 McCormick 7 McCormack 7 Maxillofac 7 maturity 7 Masson 7 masses 7 Mas 7 Maryland 7 Marsden 7 married 7 MAPT 7 Mapp 7 manifestation 7 Malek 7 MAL-AS 7 mailed 7 macro 7 Machado 7 Lucia 7 Luc 7 Lubomski 7 low-volume 7 low-risk 7 low-rCBVNER 7 lowered 7 lose 7 loop 7 Logan 7 Liotti 7 lineage 7 Linden 7 Lindblom 7 lift 7 life-span 7 Lichtman 7 licensed 7 Liberia 7 lfdr 7 LF 7 leuprorelin 7 Leslie 7 Leroy 7 learners 7 LCA 7 lateralis 7 Larsson 7 LAR 7 Laparoscopic-Assisted 7 Lange 7 landing 7 Lai 7 lacked 7 Ku 7 Kruskal 7 K-ras 7 Kordower 7 Kong 7 Koenig 7 Kirik 7 Kenny 7 Kehlet 7 Kawasaki 7 justified 7 Jurisson 7 Julia 7 judge 7 Jonathan 7 jointly 7 Johansson 7 Joan 7 Jennifer 7 Javitt 7 Jacks 7 IV-2 7 Ito 7 islands 7 Islander 7 Irvine 7 IP 7 intuitive 7 intraretinal 7 intraperitoneal 7 intra-individual 7 intra-abdominal 7 interviewer 7 interruption 7 intercellular 7 intensity-modulated 7 Insomnia 7 inserted 7 insane 7 inguinal 7 infratentorial 7 Infrastructure 7 infiltration 7 inferred 7 inevitable 7 indistinct 7 Indexes 7 Inclusiveness 7 incidences 7 Inactivating 7 ina 7 IMRT 7 imputed 7 Implicates 7 imperative 7 immunoprecipitation 7 immunology 7 Immunoblot 7 illustration 7 IL-1 7 IIa 7 IHDD 7 ICV 7 iC3b 7 Iba-1 7 Hypertens 7 hypersensitivity 7 HTLV-1 7 Hsu 7 hospital-based 7 horn 7 Hood 7 Honorarium 7 honeycomb 7 homogeneity 7 homeotic 7 Hofmann 7 histories 7 histopathologic 7 histochemical 7 high-volume 7 hexagonal 7 HER2-expressing 7 hepatitis 7 Henderson 7 hematopoietic 7 Helmstaedter 7 Helios 7 HCUP 7 HCT 7 Hampton 7 Hallett 7 Haifa 7 Hadley 7 Hadjigeorgiou 7 Haas 7 -H 7 gynecology 7 Gussekloo 7 Guinea 7 Guilford 7 Guarente 7 Gregory 7 Greer 7 graduated 7 Gottlieb 7 Goldenberg 7 glycolytic 7 glycation 7 gland 7 Gillery 7 gift 7 GFAP 7 generic 7 Gastroenterol 7 gastric 7 Garwood 7 GAPDH 7 Gal11 7 fused 7 Fung 7 FTD 7 Fritsche 7 Freed-Pastor 7 frameworks 7 frames 7 fractal 7 FOXOs 7 Ford 7 folinic 7 FNE 7 fluorometholone 7 Floor 7 flies 7 Flick 7 firm 7 Finch 7 Fillingim 7 filling 7 fibrillary 7 FG 7 Fersht 7 feedforward 7 feed 7 FDOCT 7 FDG 7 fate 7 farm 7 extracranial 7 extant 7 expenses 7 expedition 7 expectantly 7 expectancies 7 exosomes 7 exerts 7 exertional 7 excised 7 exchangers 7 Excel 7 exacerbations 7 exacerbation 7 exacerbates 7 evolutionarily 7 evildoing 7 evidenced 7 everyday 7 evaluable 7 esterified 7 Espinosa 7 equivocal 7 episodic 7 epileptic 7 epicardial 7 entries 7 enroll 7 enlargement 7 engraver 7 engaging 7 endocytosis 7 encompass 7 employees 7 empirically 7 emitters 7 EMD 7 embedding 7 elusive 7 eliminated 7 elastic 7 effectors 7 ects 7 ect 7 economics 7 Eclampsia 7 ECG 7 Eberle 7 E46K 7 e1370 7 dysplasia 7 Drew 7 drainage 7 download 7 downgraded 7 Dowling 7 dosimetric 7 DJ-1 7 divergent 7 disposable 7 disparate 7 diseased 7 discussing 7 discusses 7 discover 7 disappeared 7 diminish 7 Dijk 7 diffusivity 7 Dietz 7 diary 7 dialogue 7 devastating 7 detachment 7 designate 7 deposit 7 depolarizing 7 depended 7 Denk 7 Delta 7 Delphi 7 delineated 7 Deitch 7 dead 7 DAT 7 DAPI 7 danger 7 Dangardt 7 D-amino 7 damaging 7 damaged 7 Dallan 7 Dale 7 cysts 7 cyclists 7 CY 7 CVs 7 Cutler 7 CT-guided 7 CTCA 7 CRPS1 7 Crowley 7 crossed 7 covariance 7 corroborated 7 Correspondingly 7 Corn 7 Cope 7 co-ordinator 7 coordinating 7 convincing 7 conversation 7 convenience 7 consuming 7 consumer 7 consume 7 consult 7 constraints-based 7 considers 7 consented 7 Connecting 7 conferencing 7 Conceivably 7 computer-generated 7 computer-aided 7 computation 7 comprises 7 competency-based 7 companies 7 commissioned 7 comfortable 7 columns 7 Coleman 7 coincidence 7 coincided 7 cognitive-behavioural 7 Cocktail 7 CNC1 7 clone 7 classifying 7 Clare 7 claim 7 cities 7 CINAHL 7 Churchill 7 chloroquine 7 Chinnery 7 Chin 7 Chim 7 Chapel 7 cervices 7 Cereb 7 centrally 7 cell-autonomous 7 CD7P 7 CD20low 7 CCS 7 CCR5 7 causally 7 catechol-O-methyltransferase 7 catastrophic 7 catalytic 7 Carrasco 7 Card 7 carbachol 7 capillaries 7 Calpains 7 calpain-2 7 Calkins 7 Cali 7 calf 7 cachexia 7 Byrne 7 Bykov 7 BTZ-Refractory 7 Bruton 7 Browning 7 bromfenac 7 Broeckhoven 7 broadband 7 bridging 7 bridge 7 bpm 7 BPIGS 7 Boyle 7 Boushel 7 book 7 bonuses 7 Bonifati 7 Boehm 7 Boe 7 Bloomfield 7 Blau 7 Blasco 7 bit 7 bistratified 7 bisretinoid 7 birthdate 7 Biotinylated 7 Biosystems 7 Biopure 7 Biodegradable 7 Bioconjug 7 bioavailability 7 Bigner 7 biceps 7 BF 7 Benjamin 7 bead 7 Bauerly 7 battery 7 Barton 7 bars 7 BAC 7 baby 7 B6 7 Avidan 7 avid 7 Avery 7 Averages 7 autophagic 7 attribute 7 attests 7 attained 7 attachment 7 athletic 7 assigning 7 Aside 7 A-scan 7 Armeni 7 approximated 7 appreciated 7 Apostolov 7 apolipoproteins 7 apical 7 aorta 7 anything 7 anxiolytic 7 antitumor 7 Antioxid 7 antibody-based 7 anti-angiogenic 7 antepartum 7 antemortem 7 antagonists 7 answered 7 annulus-shaped 7 Annals 7 Anna 7 angiogenic 7 ANESCARDIOCAT 7 Andrew 7 ANC 7 Anand 7 anaerobic 7 AMP-activated 7 AMOSS 7 amongst 7 AML 7 Ambrose 7 Amaral 7 Almeida 7 ALM 7 allosteric 7 Alku 7 alive 7 aligned 7 Alan 7 AJNR 7 Ahtiainen 7 Ahlers 7 affordable 7 advent 7 ADPD 7 adhere 7 ADCmean 7 acidic 7 Achilles 7 achievable 7 acetylation 7 Academies 7 abscess 7 Abrams 7 Ab-induced 7 Abcam 7 AAP 7 A169 7 997 7 968 7 962 7 861 7 859 7 853 7 817 7 801 7 7-ketocholesterol 7 778 7 764 7 753 7 731 7 707 7 693 7 687 7 681 7 677 7 626 7 5C 7 583 7 559 7 536 7 529 7 522 7 509 7 505 7 504 7 492 7 487 7 471 7 467 7 454 7 416 7 414 7 406 7 402 7 3-syllable 7 3region 7 3E 7 3-dimensional 7 389 7 387 7 374 7 327 7 322 7 314 7 30-min 7 306 7 302 7 27-hydroxylase 7 257 7 242 7 234 7 229 7 21st 7 218 7 20th 7 2030 7 2016 7 2006b 7 1-methyl-4-phenyl-1 7 1928 7 188 7 177Lu-DOTA-Re 7 1500 7 1-4 7 135b-AMO 7 131I 7 11q 7 1136 7 1043 7 1017 7 08003 7 049 7 046 7 028 7 017 7 008 6 zones 6 Zhengzhou 6 ZEUS 6 Zeng 6 Zelaznik 6 YS 6 Yoo 6 YOD 6 Yazdanfar 6 Yao 6 Xiangya 6 X2 6 x1 6 WP 6 worsen 6 workflow 6 workers 6 Wittekindt 6 withdrawn 6 Wiman 6 width 6 Whenever 6 Weng 6 well-trained 6 Weller 6 Weickert 6 Weele 6 Webster 6 Waters 6 watchful 6 Wan 6 Walton 6 waist 6 VUMC 6 VQ 6 voltage-gated 6 voltage-dependent 6 vocal 6 VM 6 vitrectomy 6 VIP 6 violence 6 Vila 6 Vieira 6 VH 6 Vet 6 VEs 6 vertebrate 6 Verges 6 VBM 6 VATMS 6 vasoactive 6 variably 6 Valeri 6 USC 6 upright 6 unstable 6 unmedicated 6 Universitat 6 Universita 6 uniquely 6 uniformly 6 unhealthy 6 unesterified 6 undetermined 6 underscore 6 underpinning 6 uncoupling 6 unacceptable 6 ultrasonic 6 ubiquitination 6 two-year 6 Two-way 6 two-tailed 6 twofold 6 Twenty-four 6 Twenty 6 tumor-to-background 6 Tullet 6 TTE 6 trough 6 tromethamine 6 Trojanowski 6 Tripathi 6 Trifunovic 6 Tregs 6 Tredici 6 translocator 6 transaxial 6 Trade-off 6 tracked 6 tracing 6 tracer 6 Tissue-specific 6 time-varying 6 time-consuming 6 tiling 6 tiedemann 6 tied 6 Thy1 6 thresholding 6 Thousand 6 thigh 6 thickening 6 thesis 6 thematic 6 Tervaniemi 6 terminally 6 Teng 6 temporarily 6 telomeres 6 Technion-Institute 6 technicians 6 technician 6 teamwork 6 teachers 6 TD-OCT 6 TCF4 6 TBSS 6 TBR-SGP 6 taught 6 Tamura 6 talking 6 tabulated 6 synuclein-induced 6 Synopsis 6 switch 6 swab 6 SW480 6 Susan 6 Surmeier 6 supernatants 6 supermarkets 6 superclasses 6 suominen 6 Sung 6 summing 6 summed 6 summarise 6 successive 6 successes 6 substantive 6 Subramanian 6 submission 6 sublines 6 styles 6 Struct 6 stringent 6 strikingly 6 strict 6 stress-induced 6 Streptococcus 6 strenuous 6 Stratus 6 Stopa 6 Stepien 6 Steigler 6 Starkstein 6 stance 6 stain 6 staged 6 stabilized 6 SRS 6 Srivastava 6 SRF 6 SREBP 6 Sprung 6 spouse 6 SPL 6 spite 6 Spillantini 6 Spence 6 speculated 6 specifications 6 Spec 6 Speaker 6 speak 6 spaced 6 southern 6 sonicated 6 Son 6 snapshot 6 Smeets 6 Smart 6 SLA 6 SKN-1-independent 6 Sixth 6 single-photon 6 single-limb 6 Singer 6 Sinai 6 simulations 6 Sidhu 6 siblings 6 Shu 6 shRNA 6 Shot 6 shortly 6 shortcomings 6 Shimizu 6 Shih 6 shifted 6 sheets 6 sheep 6 Shackleton 6 sexes 6 serving 6 Serna 6 Ser129 6 sequentially 6 Senses 6 senile 6 semiquantitative 6 semiautomatic 6 selectivity 6 seizure 6 SEIPS 6 Seeger 6 Seddon 6 Sebire 6 Sebastiani 6 searching 6 sealed 6 sea 6 scintigraphy 6 scientists 6 Schofield 6 Schmidl 6 schedules 6 Schardosim 6 scene 6 scavenging 6 scaled 6 satisfied 6 sarcopenic 6 Sant 6 Salvio 6 Saito 6 Saha 6 safely 6 Sadagopan 6 Sacchi 6 S6 6 S129A 6 Russo 6 Rothman 6 Rosenthal 6 Rolls 6 Rodebaugh 6 Rockford 6 RIN 6 Riederer 6 Ridker 6 rib 6 rhenium 6 reverses 6 resultant 6 responder 6 respirations 6 resected 6 rescued 6 RER 6 requests 6 reprogramming 6 replacing 6 rendering 6 reliant 6 rejecting 6 Reiss 6 Reisman 6 reinforced 6 Register 6 regenerating 6 Refractive 6 reflectance 6 referring 6 refactoring 6 recreationally 6 recreation 6 recognised 6 recognise 6 receptor-mediated 6 real-world 6 realize 6 readmission 6 readable 6 rate-limiting 6 ran 6 ramp 6 rafts 6 radiopharmaceuticals 6 radiofrequency 6 radio 6 races 6 rAAV2 6 R50X 6 R248Q 6 questioning 6 Queensland 6 quadrants 6 Qin 6 push 6 PTC 6 prudent 6 proxies 6 Proukakis 6 proteolysis 6 protein-bound 6 prospect 6 prolapse 6 prohibited 6 profession 6 Privacy 6 Prichep 6 pretreated 6 pressing 6 prescribers 6 preplanned 6 prelaminar 6 preferable 6 precuneus 6 precautions 6 Prager 6 practically 6 PPM 6 potentiate 6 pot 6 post-trial 6 post-treatment 6 postsurgery 6 poster 6 possesses 6 Portland 6 polymorphic 6 POLG1 6 Pole 6 platelet-rich 6 Plasminogen 6 places 6 pivotal 6 pituitary 6 Pircher 6 Pike 6 pigs 6 piece 6 Pichler 6 physiotherapists 6 Physiother 6 photons 6 photon 6 phospholipids 6 phosphatidylethanolamine 6 phenol 6 PhD1 6 PharmD 6 Pharmacyclics 6 Peterson 6 pervasive 6 Perspect 6 person-oriented 6 performs 6 perfect 6 Peralta 6 peptide-targeted 6 PEG 6 PEEP 6 ped 6 Patterson 6 pathobiology 6 Pastor 6 passes 6 parenchymal 6 paradoxical 6 Palo 6 palliation 6 paired-label 6 pacing 6 pace 6 p1928 6 p110alpha 6 Ozurdex 6 ow 6 Ovid 6 OV-F 6 over-expression 6 overcoming 6 outweigh 6 Osteoporos 6 orthologue 6 Ortenblad 6 originated 6 Orgul 6 organism 6 Optotrak 6 optimistic 6 optimally 6 opted 6 OPL 6 ophthalmoscope 6 operates 6 onwards 6 on-line 6 oncological 6 omissions 6 oligodendrocytes 6 Oklahoma 6 Ohno 6 octogenarians 6 occult 6 observing 6 ob-gyns 6 Nuttin 6 Nurr1 6 numbered 6 nude 6 N-space 6 NR3A 6 NPE 6 NPC 6 novice 6 noting 6 notification 6 notice 6 Not-for-profit 6 notched 6 normalisation 6 non-verbal 6 nontarget 6 non-stuttering 6 non-smoker 6 non-small-cell 6 non-responders 6 non-randomised 6 nonmalignant 6 non-HDL 6 nonenhancing 6 nonaccredited 6 noisy 6 nociceptive 6 NNAL 6 Nishimura 6 nimodipine 6 Nijmegen 6 nickel 6 Ni 6 NHPs 6 NH 6 Newmark 6 Neville 6 neurotransmission 6 Neuropsychology 6 Neuropsychiatry 6 neuron-specific 6 neuromotor 6 Neuromatrix 6 Neurogenetics 6 netrin 6 nesting 6 NES 6 nervousness 6 nepafenac 6 neoplasms 6 NEJM 6 nationally 6 narcotic 6 naming 6 Nam 6 NaF 6 NADPH 6 myth 6 myoglobinuria 6 M-wave 6 mutually 6 Muth 6 mutational 6 multiplied 6 Mullins 6 Mulder 6 Mu 6 MRI-positive 6 MR-detected 6 morphogenetic 6 Morb 6 Morandi 6 Monticelli 6 Montgomery 6 monophosphate 6 monomer 6 monolayer 6 Mollet 6 molecule-1 6 modularity 6 Mobile 6 mmHg 6 MJvdB 6 mitochon-drial 6 misclassified 6 miR-21 6 minorities 6 minimizes 6 mineral 6 milk-free 6 Milder 6 Milan 6 mid-volume 6 microvasculature 6 microstructural 6 microspheres 6 Microsoft 6 microperimetry 6 micro-CT 6 MgCl2 6 Meyers 6 metformin 6 meta-static 6 metabolically 6 ment 6 Mem 6 Melnyk 6 Mehta 6 Meditec 6 medians 6 McGuire 6 McCarthy 6 MBA 6 Mayer 6 MathWorks 6 Mathews 6 Maternal-Fetal 6 Matern 6 Mata 6 Massey 6 mass-based 6 massage 6 Mashour 6 Marquand 6 Manning 6 manifests 6 mania 6 Mancuso 6 Malondialdehyde 6 Malliaras 6 Mahon 6 Maguire 6 magnification 6 MacKay 6 macaque 6 m22 6 lysosomes 6 Lys11 6 Lyon 6 lymphomas 6 lymphadenopathy 6 LVOT 6 Luo 6 lumen 6 Luca 6 low-level 6 longterm 6 long-acting 6 logic 6 Locating 6 LN 6 Livingstone 6 Lisa 6 Lipidol 6 Liong 6 linguistic 6 ling 6 Lindquist 6 ligase 6 Li-Fraumeni 6 lifestyles 6 Lesnick 6 les 6 Leisure-time 6 Lehmann 6 Leemans 6 leeds 6 LDLs 6 LDL-cholesterol 6 LBN 6 layout 6 launch 6 Latest 6 Laryngotracheal 6 landmark 6 Land 6 laminar 6 Laird 6 KY 6 Kunz 6 Kuhn 6 Krauss 6 Kraus 6 Kras-driven 6 Korean 6 Kliniken 6 Klinik 6 Klaver 6 kindred 6 Kiecolt-Glaser 6 Khanna 6 Keyholes 6 Keating 6 Kaufman 6 Kaiser 6 Kadish 6 Joyce 6 journey 6 Jong-Gierveld 6 joining 6 Joerger 6 Jenner 6 Jazbutyte 6 JAL 6 Jager 6 IVIg 6 isotopes 6 isoLGs 6 isocyanic 6 island 6 Isacson 6 IRS-1 6 IRED 6 IRB 6 investments 6 Investigative 6 intricate 6 intracerebroventricular 6 interpretive 6 internally 6 intermediate-term 6 intermediates 6 interferon 6 inter-articulatory 6 intentionally 6 integrates 6 inpatients 6 inorganic 6 Informatics 6 influential 6 inflated 6 Indigenous 6 indifference 6 Indian 6 India 6 incurable 6 incompatible 6 ims 6 imposes 6 impairing 6 imol 6 Immunofluorescence 6 IMAGEJ 6 Illinois 6 IKKalpha 6 IKK 6 IkB 6 IIS 6 I-IB-Mal-D-GEEEK-Nanobody 6 Identities 6 ice-hockey 6 ice-cold 6 Icahn 6 IBD-associated 6 Ian 6 hyperplasia 6 Hyman 6 Huntington 6 Hunan 6 Hui 6 hubs 6 Huber 6 Hubbard 6 HT 6 Houle 6 holistic 6 Hoang 6 hnRNPA1 6 HK 6 HIV-1 6 Hirano 6 high-rCBVNER 6 high-performance 6 herself 6 herpetic 6 Hepatology 6 Heng 6 hemispheric 6 heme-precursors 6 Hemelrijck 6 hematologic 6 HEK293T 6 HEK293 6 Heidi 6 Hear 6 HCT-116 6 Hayden 6 Haven 6 Hatano 6 Hassan 6 Hartman 6 Harder 6 Harcourt 6 Harada 6 Hanson 6 hands 6 handled 6 handle 6 handgrip 6 handedness 6 handball 6 Hahn 6 Hague 6 Hageman 6 Haemost 6 habitual 6 gymnastics 6 gure 6 guides 6 Gugleta 6 guarantors 6 grounded 6 Groen 6 Grill 6 Greek 6 Graves 6 Grave 6 Grand 6 Grady 6 graders 6 Gracco 6 GPower 6 Goto 6 Gong 6 glutamatergic 6 Glostrup 6 globulin 6 Girard 6 Giovanni 6 Gilst 6 Gerring 6 geometric 6 generalizability 6 Gems 6 Gate 6 gastrocnemius 6 garments 6 Gant 6 ganglia 6 Games 6 G1 6 FVC 6 fusiform 6 Furman 6 Fuller 6 Franconi 6 frail 6 Fowler 6 Fourteen 6 Fourier-domain 6 Fourgeux 6 foundations 6 Forrester 6 Forkhead 6 forests 6 Fong 6 foci 6 FNB 6 Fleck 6 Flachsbart 6 FK 6 Fitzgerald 6 fitted 6 fission 6 finished 6 fingertip 6 fibroblast 6 FGF21 6 fertility 6 Ferris 6 Fercher 6 femoris 6 feeling 6 Febrile 6 FCH 6 favoured 6 favorably 6 fat-suppressed 6 fatigued 6 fast-track 6 Farber 6 fall-related 6 Facts 6 FACS 6 F10 6 Extracorporeal 6 exponential 6 exit 6 exemplified 6 examines 6 exaggerated 6 evolve 6 eventual 6 esters 6 ester 6 Essen 6 Erratum 6 eroded 6 Epstein 6 epitopes 6 EPI 6 ependymoma 6 envelope 6 enumeration 6 enucleated 6 entorhinal 6 energetic 6 endogenously 6 ending 6 encompasses 6 encephalopathy 6 empty 6 emotions 6 EMA 6 else 6 electroretinography 6 electrocardiogram 6 Eisbruch 6 Eclipse 6 Ebert 6 dyspnea 6 dyslexia 6 duty 6 duplicate 6 dual-beam 6 DSS 6 DSE 6 dropping 6 drivers 6 drinkers 6 drawback 6 down-regulation 6 dot 6 dorsiflexion 6 Dordr 6 Dolan 6 Doherty 6 docosahexaenoate 6 Dixon 6 disulfide 6 distinctly 6 dissect 6 disruptive 6 dispersion 6 dismutase 6 disks 6 disease-related 6 Discov 6 discordant 6 Disabil 6 differentiates 6 didactic 6 Diatchenko 6 diagonal 6 Diabetologia 6 determinant 6 destined 6 Deschodt-Arsac 6 Derivation 6 depict 6 departmental 6 Delong 6 delivers 6 delineation 6 delineating 6 Delaney 6 deidentified 6 dehalogenation 6 degrading 6 degenerations 6 decrements 6 de-commitment 6 deciding 6 deacetylase 6 day-to-day 6 dancers 6 Damani 6 Dalmau 6 Daley 6 D3 6 D1 6 cytokine-induced 6 CYPs 6 Cyp27a1- 6 cycloaddition 6 cuff 6 crystals 6 CRCs 6 CPZ 6 CPC 6 cotinine 6 corroborates 6 corpus 6 converts 6 convert 6 Contradictory 6 contracted 6 contiguous 6 contaminated 6 constantly 6 consequent 6 Conley 6 congestive 6 confusion 6 confounded 6 confound 6 confers 6 conferred 6 concentric 6 concentrate 6 Conaway 6 compulsive 6 complicate 6 complained 6 competitions 6 comparability 6 Commons 6 commitment 6 combines 6 combat 6 colonic 6 Colleges 6 collar 6 coherent 6 coeficients 6 coculture 6 Cockcroft 6 clonally 6 clinicopathological 6 cLDLs 6 CLASICC 6 Cistern 6 circulatory 6 chronically 6 Choudhury 6 CHOP 6 cholinergic 6 cholesterol-metabolizing 6 ChIP-seq 6 childbirth 6 Chew 6 Chartier-Harlin 6 Champion 6 certification 6 CD7D 6 CCL2 6 CBb3 6 CBab 6 cautiously 6 castration-sensitive 6 Casey 6 Carmen 6 Carmeli 6 Carlsbad 6 Carlo 6 cardio-vascular 6 carboplatin 6 Cant 6 cancer-associated 6 campus 6 Campaign 6 Calgary 6 calendar 6 calcifications 6 cadence 6 cadavers 6 CAC 6 C3c 6 C3b 6 C18 6 business 6 Bus 6 Burn 6 burdens 6 bulk 6 bulb 6 builds 6 B-scan 6 Bronfenbrenner 6 Brody 6 Broderick 6 bringing 6 Bright 6 Brigham 6 Breteler 6 Brenner 6 BP-DES 6 borders 6 Books 6 BONICALZI 6 Bond 6 boiled 6 BMS-927711 6 Blum 6 blood-retina 6 blood-borne 6 Bland-Altman 6 biotin 6 Biotech 6 Biosci 6 Bioorthogonal 6 Biomech 6 Bioessays 6 Bilomas 6 Billerica 6 Bigland-Ritchie 6 Big 6 betaine-homocysteine 6 beta-cells 6 beta-cell 6 beta2-microglobulin 6 bestrophin 6 best-evidence 6 benzodiazepine 6 belonging 6 Beckman 6 Beach 6 BB 6 Basnakian 6 Basel 6 Bartlett 6 Ballantyne 6 Balancing 6 Baeyer 6 Baek 6 Avastin 6 autochthonous 6 Authority 6 Australians 6 augment 6 audience 6 at-risk 6 Atkins 6 atherogenic 6 ASPO 6 ascertained 6 arrows 6 Armstrong-Wells 6 ARIC 6 Araki 6 applies 6 appealing 6 apnea-hypopnea 6 AOM 6 anxiety-like 6 antiviral 6 anti-ageing 6 annular 6 anisotropy 6 Angew 6 anesthetics 6 Andres 6 Andrea 6 Andersson 6 Ana 6 amplified 6 ameliorates 6 alveolar 6 Alvarez 6 Alto 6 alternating 6 alpha-actin 6 Allan 6 ALG 6 Alegre 6 Ala53Thr 6 ALA 6 al4 6 A-I 6 Agarwal 6 Affymetrix 6 affordability 6 AED 6 Adobe 6 administering 6 adjacency 6 adhered 6 adenocarcinoma 6 ADCTE 6 ADCref 6 acknowledging 6 accident 6 abusers 6 abstracted 6 above-mentioned 6 abortion 6 Abernathy 6 Abella 6 ab144 6 A33-TCO-AF680 6 A10 6 979 6 927 6 922 6 904 6 883 6 879 6 860 6 851 6 843 6 823 6 816 6 814 6 813 6 805 6 804 6 7A 6 789 6 766 6 747 6 721 6 716 6 714 6 713 6 712 6 705 6 702 6 6C 6 695 6 672 6 670 6 665 6 661W 6 643 6 627 6 620 6 5-aminolevulinic 6 597 6 577 6 576 6 561 6 558 6 552 6 549 6 548 6 547 6 542 6 539 6 537 6 534 6 531 6 520 6 4E 6 4D 6 478 6 475 6 473 6 470 6 466 6 453 6 452 6 444 6 443 6 439 6 438 6 436 6 424 6 423 6 386 6 384 6 3-5 6 340 6 3-4 6 339 6 311 6 2-step 6 2-km 6 2-3 6 222 6 2009- 6 2005b 6 2004-2005 6 1to 6 1mM 6 1F 6 1Department 6 1960 6 1954 6 1542 6 1505 6 1356 6 1323 6 12-day 6 1265 6 1173 6 1-11 6 10-item 6 10-fold 6 1093 6 1080 6 1061 6 1060 6 1050 6 1048 6 044 6 018 5 Zwerver 5 Ziekenhuizen 5 zer 5 Zaire 5 Yoshida 5 YL 5 yeast-two-hybrid 5 Yates 5 Yaruss 5 xParallelGroups 5 XH 5 XBP-1 5 Wuerzberger-Davis 5 WPA 5 Woywodt 5 Wolff 5 Wojtkowski 5 withheld 5 wishes 5 Wise 5 Willer 5 wildtype 5 Wilcox 5 wherever 5 Whalley 5 Westerblad 5 well-controlled 5 wellbeing 5 welcome 5 Weinstein 5 Weinberg 5 weighing 5 Weaver 5 wealth 5 weakly 5 WBCs 5 WBC 5 Waves 5 wavelengths 5 wavelength 5 Watkins 5 Watanabe 5 warranting 5 warrant 5 waiver 5 Wahlund 5 Wade 5 VW 5 Vora 5 Voigt 5 Vogel 5 VL 5 visibility 5 VISA-P 5 Virol 5 viremia 5 Vigilance 5 viewer 5 Vickers 5 vicinity 5 vertebral 5 versatile 5 Verhoeff 5 Verhaak 5 velocimetry 5 vasodilatation 5 vascularized 5 Vandenberghe 5 valproate 5 vague 5 Vacutainer 5 UVA 5 urea 5 Urbina 5 upmc 5 UPDRS 5 unsuccessful 5 unremarkable 5 Universitari 5 unimpaired 5 unifying 5 unfavorable 5 Unequivocal 5 undetectable 5 understudied 5 und 5 uncus 5 uncertainties 5 unavailable 5 unambiguously 5 unadjusted 5 UN 5 UMR 5 ultrasounds 5 Ultramarathon 5 Ultrahigh 5 Ulrich 5 ulcerations 5 UH 5 UCLA 5 UB 5 Tz-Bn-NOTA 5 tympanogram 5 two-fold 5 Tuveson 5 Tuo 5 Tunisia 5 tumor-to-blood 5 Tsien 5 tsaugenklinik 5 Tsao 5 Tryggestad 5 troponin 5 triangular 5 tremendous 5 Treatment-naive 5 Trans-Tasman 5 transparent 5 transparency 5 transmitter 5 Transmission-and 5 Transm 5 transit 5 transiently 5 transformations 5 transcriptase 5 trance 5 tracts 5 traced 5 trabecular 5 topologies 5 Toga 5 TNF 5 timepoint 5 time-domain 5 thrombocytopenia 5 threatened 5 thoroughly 5 thinner 5 Theuns 5 thermodilution 5 thereof 5 therapist 5 Thanks 5 Thaibaoui 5 Th1 5 Textbook 5 Terumo 5 Terry 5 territory 5 ternary 5 terminus 5 terminated 5 Tensin 5 telemedicine-based 5 tele-AMD 5 technically 5 teach 5 TCO 5 Tasker 5 Tao 5 Takeda 5 tacrolimus 5 tachycardic 5 Tabas 5 t0 5 Szkandera 5 synchronous 5 symptom-limited 5 symptomatology 5 SYmmetric 5 Sydes 5 Swindell 5 swearing 5 suture 5 Sussman 5 suspicious 5 suspect 5 surveyed 5 supranuclear 5 supraglottic 5 Supervising 5 Sul 5 Suh 5 sugar 5 suffers 5 subspecialties 5 submucosal 5 sub-groups 5 subcutaneously 5 subacute 5 Stuart 5 stretching 5 Stress-related 5 stresses 5 strengthen 5 Strano 5 Strange 5 Stotz 5 stones 5 Stephens 5 statisticians 5 stasis 5 Stapleton 5 Staples 5 Stanley 5 Stam 5 stains 5 stabilize 5 SSI 5 squares 5 sprint 5 sportsci 5 spend 5 speeds 5 specialised 5 sparks 5 spared 5 Soriano 5 somatostatin 5 solitary 5 sold 5 Sokolow 5 Sohrab 5 SNARE 5 SMS 5 Smith-Lemli-Opitz 5 Small-molecule 5 SLO 5 SLC19A3 5 Slavotinek 5 SLAgg 5 sized 5 Sixteen 5 single-screening 5 simulate 5 simplest 5 Simmonds 5 sIL-2R 5 Signa 5 Sidransky 5 Sibai 5 short-course 5 Shore 5 shockwave 5 Shimoyama 5 SHH 5 Sherrington 5 shave 5 Shanghai 5 sham-treated 5 shaking 5 Shadyside 5 sg2 5 SF-36 5 sex-related 5 Serrano 5 separable 5 semicircular 5 seeing 5 Sedatives 5 sector 5 sectioned 5 sec 5 Schuman 5 Schott 5 Schniering 5 Schmidt-Erfurth 5 Schizophrenic 5 schema 5 SCAP 5 Sawyer 5 Saver 5 Sauser 5 SARLOS 5 Sandberg 5 Sanchez 5 Salomon 5 saliva 5 Salinero 5 Salem 5 Saint 5 Sadda 5 sacrifice 5 Sacramento 5 Sabine 5 S8 5 S2D 5 S1A 5 S129D 5 Rudolph 5 Rubin 5 Rubenstein 5 RT01 5 rs356219 5 rs12676 5 r-project 5 Royle 5 routes 5 Rosengard 5 Rosenblatt 5 Roland 5 Rojas 5 Roger 5 robotic-assisted 5 robot-assisted 5 RNAse 5 Rizzo 5 Rivera-Gaziola 5 River 5 rigidity 5 Richter 5 Rezai 5 retraining 5 resveratrol 5 restraint 5 resilience 5 reside 5 reproduced 5 reprint 5 reply 5 repeated-measures 5 Renshaw 5 remember 5 relies 5 releasing 5 Reisinger 5 reinforcement 5 Reilly 5 regurgitation 5 regressions 5 region-specific 5 Regionally 5 refusal 5 refrain 5 Ref 5 re-expression 5 Redon 5 Recursive 5 rectification 5 rectangular 5 recommending 5 recombinase 5 recognizes 5 Reardon 5 readmissions 5 readings 5 RBC-controlled 5 Raychaudhuri 5 raters 5 RAS-induced 5 random-effects 5 Ramirez 5 Raison 5 Raichle 5 RAF 5 radiotherapeutic 5 radioimaging 5 radiograph 5 radicals 5 Radic 5 R175H 5 Quintiles 5 qualify 5 QPS 5 Qiu 5 Qian 5 QD 5 purchasing 5 punishment 5 punctate 5 Pubs 5 publisher 5 puberty 5 pubertal 5 Ptenfl 5 pSyn 5 psychomotor 5 PSOM 5 PSA-detected 5 prosthetic 5 prostatic 5 PROSPERO 5 Proof-of-concept 5 progesterone 5 Procurement 5 probed 5 Prives 5 Pretoria 5 preschool 5 preprocessing 5 premorbid 5 pregnancy-related 5 predisposing 5 predictions 5 Pre2 5 PRC1 5 Prasad 5 potassium 5 postulate 5 post-RT 5 postexercise 5 postal 5 Post1 5 Portugal 5 Porto 5 portal 5 portable 5 Portability 5 Porphyrias 5 polymorphonuclear 5 Polymeropoulos 5 Polyanalgesic 5 pocket 5 PLK1 5 pleiotropic 5 plana 5 plain 5 placing 5 placentas 5 Phoenix 5 Philippe 5 PhD2 5 Phan 5 periodic 5 perfusion-free 5 perfectly 5 Pereira 5 perceive 5 Pepe 5 penetrance 5 Pellets 5 pedal 5 PeakV 5 peak-to-peak 5 PDFs 5 PBG 5 patient-focused 5 pathophysiologic 5 passages 5 Pascual-Marqui 5 parturition 5 Parihar 5 Palma 5 Palliat 5 pages 5 packs 5 P600 5 p50 5 owner 5 ovine 5 overwhelming 5 oversaw 5 overlooked 5 overlaps 5 overlapped 5 otitis 5 osteomyelitis 5 osteoclasts 5 OSCE 5 Osborne 5 orthotopic 5 Orphan 5 orofacial 5 orders 5 ordered 5 orally 5 optimum 5 opposing 5 ophthalmoscopy 5 open-access 5 oocytes 5 oncogenes 5 Omarova 5 OM 5 Olney 5 Ollendick 5 oldest 5 Olanow 5 oint 5 ofatumumab 5 occasions 5 obturator 5 obstacles 5 obstacle 5 obsessive 5 Oberlander 5 NW 5 Nutt 5 Nudo 5 Nuber 5 NSS 5 NSDUH 5 nrneurol 5 NPC1 5 Nowadays 5 North-East 5 Northeast 5 norepinephrine 5 Noren 5 non-human 5 non-connections 5 non-ACGME 5 N-methyltransferase 5 Nishiyama 5 Nishioka 5 Nicoll 5 nick 5 Nicholson 5 Niccoli 5 Nevada 5 neurotransmitters 5 neurotoxin 5 neuroreceptor 5 Neuroradiology 5 neuroplasticity 5 Neuro-Oncology 5 Neurooncol 5 Neuhaus 5 neovascularisation 5 neocortical 5 nematodes 5 needing 5 near-labor 5 NCX2 5 NCI 5 NB 5 navigating 5 Natsuaki 5 nationalauditprojects 5 nation 5 Natick 5 nascent 5 NAS 5 nanomolar 5 Nabors 5 myringotomy 5 myriad 5 myopathy 5 Myc 5 MVV 5 multiplication 5 multifraction 5 multidimensional 5 Mulligan 5 Mujat 5 MTHFR 5 MRI-negative 5 motion-corrected 5 Moss 5 more-detailed 5 moral 5 monostratified 5 monogenic 5 monitors 5 Monastir 5 Moments 5 momentary 5 moiety 5 moff 5 MoCA 5 MLR 5 ml-1 5 MKWD 5 MKW 5 MJBT 5 Mizuta 5 Miyake 5 mitochondrion 5 mitigated 5 Mississippi 5 mirVana 5 miR-146a 5 minimized 5 mini-Derenzo 5 Mimoun 5 Milton 5 military 5 milieu 5 Miki 5 midazolam 5 microphone 5 micrometers 5 Micro-level 5 Microbiology 5 Miami 5 mgh 5 Mexico 5 metals 5 metadata 5 metabolomics 5 metabolomic 5 meta 5 merit 5 merged 5 menstrual 5 Menon 5 mendelian 5 Memtsoudis 5 Meltzer 5 melanocortin 5 MedCalc 5 meals 5 MEAD 5 MDT-15-dependent 5 MDM2 5 McLaughlin 5 McKinney 5 McKenzie 5 McBride 5 Matteson 5 Masuda 5 Mastronarde 5 master 5 mastectomy 5 Massaro 5 Marques 5 Mario 5 MAPK 5 manufacturers 5 manipulating 5 manifesting 5 mandated 5 Mancini 5 Manager 5 mammary 5 MALAT1 5 magnetoencephalography 5 Macquarie 5 Mack 5 Macfarlane 5 -M 5 lysosome 5 lysed 5 lympholysis 5 Lyden 5 ly 5 Luu 5 Lujan 5 lowvolume 5 lower-level 5 Love 5 losing 5 Lopez-Otin 5 loops 5 longer-term 5 long-course 5 log10 5 localizes 5 localizations 5 Llovet 5 Liverpool 5 liveborn 5 Lisonkova 5 lipophilic 5 line-derived 5 linearly 5 lineages 5 Liegl-Atzwanger 5 licensing 5 liaison 5 lexical 5 Levitt 5 Levien 5 Leong 5 Leonard 5 lentiviral 5 lend 5 Lemeshow 5 leftsided 5 Leeuwen 5 Lecture 5 learner 5 leaders 5 LBs 5 LB-linked 5 Lausanne 5 Laurent 5 launched 5 Lateralization 5 Las 5 Larrayoz 5 landscapes 5 landmarks 5 Lancaster 5 Lake 5 lagged 5 laboured 5 labelled 5 label-free 5 Kwong 5 Kupfer 5 Kulkarni 5 Kulik 5 Kruth 5 Kroll 5 KOx 5 Kova 5 Kose 5 Komatsu 5 Koetsier 5 KN 5 Kleinfeld 5 Kikuchi 5 Khachaturian 5 kernel 5 Kern 5 Keren 5 Keereman 5 Keats 5 KCNS1 5 Katusic 5 Kathleen 5 KarP 5 Karen 5 Kalo 5 K21 5 -K 5 JWC 5 justifiable 5 JPS 5 Jourdan 5 Josep 5 Jordi 5 Jonsson 5 job 5 Joanna 5 JLD 5 Jiao 5 Jansen 5 jamapsychiatry 5 Jaffe 5 Jacques 5 JACC 5 Iwata 5 Ishii 5 I-SGMIB 5 ischaemic 5 Irwin 5 IRS-2 5 irreversible 5 Irish 5 Iris 5 IOP-lowering 5 Invivo 5 invasiveness 5 invaluable 5 intubated 5 intriguing 5 intraventricular 5 intravascular 5 intrauterine 5 intrapartum 5 intra-operative 5 intra-observer 5 intraneuronal 5 intimate 5 inthe 5 intervening 5 intersubject 5 interstitial 5 interrelated 5 interpolation 5 interoceptive 5 inter-observer 5 internet-based 5 interior 5 interferes 5 inter-assay 5 inter- 5 intentionality 5 insults 5 insult 5 instituted 5 instantaneous 5 inserts 5 Inn 5 inject 5 inhalation 5 infused 5 informing 5 Informal 5 inevitably 5 individual-level 5 indexed 5 in-depth 5 incorrectly 5 inconclusive 5 inception 5 inactivated 5 imputation 5 impoverishment 5 import 5 implementable 5 impending 5 impedes 5 immunostaining 5 immunomodulatory 5 immunoblots 5 immigration 5 imaginable 5 IkBb 5 ik 5 IH 5 ignore 5 IgM 5 idiosyncratic 5 identi 5 ICERs 5 IAP 5 hypothalamus 5 hypotension 5 hyposynchronized 5 hypertensive 5 hyperoxia 5 hyperlipidemia 5 Hyperglycemia 5 hyper 5 hydroperoxide 5 HV 5 hunger 5 Hung 5 hundreds 5 Humphries 5 humoral 5 Huberman 5 HRRT 5 HRP 5 housed 5 Hou 5 Hosp 5 Horvath 5 horseradish 5 horizontally 5 Hordaland 5 Hoppeler 5 Hoppe 5 hoped 5 Hooten 5 honestly 5 homogenates 5 homocitrulline 5 homing 5 Home-based 5 Holt 5 Holm 5 Hollyfield 5 Holland 5 holes 5 Hofer 5 Hoek 5 Hochberg 5 HN 5 HMGCR 5 HMG 5 histogram 5 histochemistry 5 Hirshfeld-Becker 5 himself 5 high-affinity 5 Herrero 5 HER2-targeted 5 HER2-positive 5 Hepatol 5 hepatocytes 5 heparin 5 helper 5 Hegi 5 Heckman 5 heavy-resistance 5 Healy 5 Hawkins 5 Harry 5 harness 5 Harding 5 Hardie 5 happens 5 happened 5 happen 5 haplotypes 5 Hanel 5 Ham 5 hallucinogenic 5 Haematol 5 habenula 5 H50Q 5 H3K27me3 5 H1047R 5 H1 5 GV 5 Gutierrez 5 Gustafson 5 Guay 5 GTR 5 GSK 5 Gruber 5 Groeneweg-Koolhoven 5 Groden 5 GRIN2B 5 Grimm 5 grew 5 Gregori 5 Gregg 5 granulomatosis 5 granules 5 granular 5 Golden 5 goes 5 Glycogenolysis 5 glutathione 5 glutamine 5 glutamic 5 glucocorticoids 5 glucocorticoid 5 glands 5 girl 5 Gibbons 5 Gi 5 Ghent 5 getting 5 germline 5 Germans 5 Gerger 5 GEO 5 gently 5 gastrostomy 5 Gastrointest 5 Gastroenterology 5 Garatachea 5 gamma-aminobutyric 5 Gallazzi 5 Gallagher 5 Galinkin 5 Galanko 5 G2 5 FY 5 fungal 5 fulfilled 5 Fukushima 5 Fujita 5 FS 5 Fresh-frozen 5 freely 5 freed 5 Fraser 5 Frackowiak 5 four-color 5 founder 5 Forno 5 formulas 5 formative 5 foreign 5 forearm 5 Fonseca 5 fMRI-based 5 FMA 5 fluorophores 5 fluoride 5 flow-dependent 5 florbetapir-PET 5 flaws 5 flags 5 fits 5 FITC 5 first-time 5 finishing 5 finds 5 financially 5 filters 5 filament 5 Figure1 5 fibrous 5 fibrillar 5 FEV1 5 Ferrara 5 Fernando 5 Felix 5 Feldmann 5 Feinstein 5 FBS 5 Fazekas 5 favoring 5 fatiguing 5 farmers 5 Failing 5 FAHA 5 F344 5 F0 5 extrapolated 5 extracting 5 experimentation 5 exercising 5 excreted 5 Excite 5 exams 5 EW 5 Event-by-Event 5 evenly 5 Evatt 5 eukaryotic 5 Eugene 5 ESSFN 5 erythrocytes 5 Erlangen 5 Eriksson 5 ergogenic 5 ERAD 5 Eppendorf 5 epochs 5 Epigenomics 5 Eperjesi 5 enzyme-linked 5 envision 5 entitled 5 entities 5 ensures 5 ensured 5 engraving 5 engineers 5 energies 5 endophthalmitis 5 endophenotypes 5 endophenotype 5 encode 5 emerges 5 EMBS 5 Elsner 5 Eliseevitchi 5 Elem 5 electroencephalogram 5 Electric 5 Eighth 5 Ehrenfeld 5 Eggermont 5 Egger 5 egg 5 eFigure 5 effcacy 5 educate 5 edn 5 ECR 5 Ecological 5 Eagle 5 dyskinesias 5 dyads 5 DV 5 Duplicates 5 Dulbecco 5 Dudley 5 DSEs 5 drug-eluting 5 DRG 5 Drexler 5 Drewnowski 5 drank 5 drafts 5 DPBS 5 Dp71 5 downwards 5 Douglas 5 Dougherty 5 double-blinded 5 DOTA-Re 5 Dostrovsky 5 Donoso 5 donation 5 Doleshal 5 Dodd 5 docs 5 docking 5 doc 5 diving 5 divide 5 distressed 5 distortions 5 disproportionately 5 disinterest 5 disgust 5 discriminating 5 discretionary 5 disabled 5 Dirks 5 Dimmeler 5 DIMER 5 dimensionality 5 dilemma 5 Digestive 5 digestion 5 diet-induced 5 diagram 5 Dhahbi 5 Deyo 5 devised 5 Devi 5 determinations 5 deteriorated 5 detachments 5 destruction 5 desert 5 deregulated 5 Dept 5 depleted 5 depicting 5 -dependent 5 dependencies 5 Dentistry 5 Denise 5 Dempsey 5 Dekker 5 decrement 5 deceased 5 Debette 5 debates 5 deals 5 deafferentation 5 DCT 5 data-driven 5 DAPK1 5 Danforth 5 Damoiseaux 5 Dam-Baggen 5 DAKO 5 Dahl 5 Dahan 5 D2 5 cytogenetic 5 CYP3A4 5 cyclotron 5 cyclization 5 CVg 5 cut-points 5 Cuthbert 5 curvature 5 Curtis 5 Curran 5 cuneus 5 crypt 5 Cryosections 5 Crombez 5 criticism 5 Cristina 5 cream 5 crd 5 coverslipped 5 covalent 5 counterpart 5 counteract 5 counselling 5 cough 5 corrects 5 corrections 5 Corcoran 5 copied 5 cooperate 5 Cooke 5 conundrum 5 contraindicated 5 constriction 5 constituting 5 constituted 5 consolidation 5 consciousness 5 consanguineous 5 Connecticut 5 conjugation 5 confounds 5 confounder 5 conformed 5 confirmatory 5 configuration 5 confidentiality 5 confidential 5 conclusively 5 conceptualized 5 complaint 5 compacta 5 Compact 5 communicating 5 Command 5 comfort 5 Cologne 5 colocalization 5 collective 5 collections 5 coincide 5 coexisting 5 coeruleus 5 coated 5 CNRS 5 clues 5 clue 5 cloning 5 clodronate 5 clinical-pathologic 5 Clifton 5 Clevers 5 clearing 5 cleaning 5 Claus 5 Claudio 5 Claudepierre 5 clarity 5 Clancy 5 Clair 5 claimed 5 Cirrus 5 circumference 5 cingulum 5 CIMT 5 cial 5 Chumakov 5 Christian 5 choriocapillaris 5 cholesterol-containing 5 cholesterol-AMD 5 Child-Pugh 5 chicken 5 chemo-therapy 5 cheaper 5 Chauhan 5 charts 5 characterizes 5 Chaperone-mediated 5 Changsha 5 chambers 5 Chalmers 5 Cha 5 cerevisiae 5 Cerebrovasc 5 Ceponien 5 CENTRIC 5 centralized 5 cellularity 5 cell-to-cell 5 cell-based 5 ceased 5 CDS 5 CCR2 5 CCL4 5 CCA 5 cavernous 5 cautionary 5 causation 5 Catholic 5 Castillo 5 cassette 5 cartilage 5 Carlos 5 cardiomyopathy 5 cardiomyocytes 5 capnographic 5 Canzi 5 cancelled 5 calpeptin 5 Calmettes 5 callosum 5 calcitonin 5 Caballero 5 C8-b4 5 BWJM 5 Buske-Kirschbaum 5 burning 5 Burbach 5 Buenos 5 Buckner 5 B-scans 5 BSA 5 Brooks-Wilson 5 brings 5 Bras 5 BRAF 5 Bradley 5 Boulton 5 bonus 5 Bodyw 5 bodily 5 Bo 5 blunted 5 blockage 5 bloc 5 blastocysts 5 Blandino 5 blame 5 bivariate 5 bisphosphonate-related 5 BIS 5 Bioconjugate 5 binomial 5 Bill 5 bilirubin 5 biggest 5 BHMT 5 betamethasone 5 beta-amyloid 5 Bensimhon 5 beneath 5 belongs 5 belong 5 Bek 5 Beitchman 5 Beirut 5 behave 5 Becton 5 beating 5 bean 5 BCC 5 Bastin 5 basolateral 5 Bartels 5 Barry 5 Barrett 5 Barbeito 5 Bar 5 Bakker 5 Bae 5 bacteria 5 azathioprine 5 AY 5 AxYZ 5 avoidant 5 avoidable 5 Aurora 5 augmenting 5 audio 5 attenuating 5 attain 5 Atkinson 5 Atilio 5 atherogenesis 5 Atf4 5 asymmetrical 5 astrocyte 5 ASTRO 5 asthma 5 assumes 5 associative 5 assigns 5 assignments 5 Ashton 5 arrow 5 arranged 5 arose 5 Arora 5 Arnett 5 approximations 5 appropriateness 5 appointments 5 Appel-Cresswell 5 Appeal 5 APP 5 Apkarian 5 Anti-N-Methyl-D-Aspartate 5 anti-NMDA 5 antimouse 5 antiinflammatory 5 anti-IkBalpha 5 anti 5 antero-posterior 5 antenatally 5 anecdotal 5 Andreoli 5 ANCOVA 5 ancestry 5 anastomoses 5 AN-associated 5 analysing 5 amphipathic 5 ammonium 5 aminoglycoside 5 Amendments 5 amenable 5 ameliorated 5 AMD-specific 5 ambiguities 5 alphavbeta3 5 allograft 5 allelic 5 Alfredo 5 AJP 5 Aires 5 ahrq 5 Agilent 5 agenda 5 age- 5 afternoon 5 aftereffects 5 aftereffect 5 afforded 5 advocate 5 Adorno 5 adopting 5 administrators 5 administrations 5 administer 5 adjunct 5 adhering 5 Ader 5 adenine 5 acidosis 5 accumbens 5 accountable 5 accessibility 5 Abu-Saad 5 Abraham 5 Abr 5 Abian-Vicen 5 Abeliovich 5 Abbvie 5 Aasly 5 A53 5 -A 5 992 5 987 5 986 5 985 5 980 5 976 5 966 5 950 5 949 5 946 5 934 5 925 5 920 5 916 5 913 5 910 5 899 5 889 5 885 5 882 5 877 5 870 5 867 5 850 5 841 5 840 5 829 5 828 5 820 5 818 5 806 5 802 5 7D 5 7-AAD 5 799 5 795 5 787 5 785 5 777 5 769 5 768 5 763 5 759 5 752 5 749 5 736 5 733 5 -70 5 6-week 5 6-tetrahydropyridine 5 6-fold 5 685 5 671 5 655 5 653 5 652 5 644 5 637 5 616 5 613 5 612 5 609 5 604 5 602 5 6- 5 5-T 5 5ng 5 5-mg 5 591 5 590 5 584 5 582 5 581 5 572 5 568 5 560 5 556 5 551 5 545 5 543 5 524 5 523 5 517 5 516 5 4G 5 499 5 491 5 483 5 472 5 46A1 5 469 5 468 5 462 5 435 5 434 5 428 5 419 5 404 5 3UTR 5 398 5 36-month 5 326 5 316 5 315 5 30min 5 24-h 5 238 5 212Pb-D 5 2015 5 1-way 5 1-mm 5 1E 5 1965 5 1939 5 1932 5 18F-labeled 5 1854 5 18-20 5 1643 5 1507 5 1-5 5 1471-0528 5 1400 5 1362 5 1303 5 1301 5 1300 5 1277 5 1273 5 125I 5 1257 5 1213 5 1194 5 1182 5 1174 5 1167 5 1138 5 1137 5 1116 5 10-minute 5 1091 5 1089 5 1078 5 1072 5 1069 5 1054 5 1052 5 1051 5 1004 5 048 5 039 5 023 5 022 5 021 5 019 4 ZJ 4 zipper 4 Zimprich 4 Zillikens 4 Ziegler 4 Zhong 4 Zervakis 4 Zeki 4 Zecca 4 YY 4 Yoshino 4 Yoshikawa 4 Yonsei 4 Yealy 4 Yazulla 4 Yavich 4 Yannuzzi 4 Yamashita 4 Yablonskiy 4 Xue 4 xn 4 X-linked 4 Xiong 4 xenobiotic 4 Xavier 4 xanthomatosis 4 xanthine 4 wrong 4 wrist 4 wrapped 4 Wpeak 4 worst-case 4 worsened 4 workplace-based 4 Woodward 4 Wolzt 4 Wolpert 4 Woitalla 4 WN 4 WMD 4 withdrew 4 wished 4 WISC-III 4 wire 4 Winter 4 Winner 4 Winn 4 Wingate 4 Wing 4 Wills 4 Wilhelm 4 wileyonlinelibrary 4 Wiley-Blackwell 4 Widaman 4 whole-genome 4 Whitaker 4 Westenbroek 4 Werblin 4 Wendy 4 well-documented 4 well-characterized 4 Weitzel 4 Weissleder 4 web-pages 4 weaned 4 wcm 4 WC2A 4 waveforms 4 Waukesha 4 wasting 4 warnings 4 wards 4 War 4 Waltham 4 walked 4 wake 4 wait 4 Wada 4 Vries 4 Vranckx 4 VR 4 voluntarily 4 Volpe 4 Volkswagen 4 Vogelstein 4 VO2peak 4 Vleuten 4 vk 4 visualizing 4 Visnes 4 visitors 4 violation 4 Vinet 4 Vilser 4 Villanueva 4 Vijg 4 VIII 4 VII 4 videos 4 video-fluoroscopy 4 Victoria 4 victims 4 VI 4 vhf 4 Veronesi 4 Verdoorn 4 Venereol 4 vehicles 4 Veeckman 4 vasoconstriction 4 vascularization 4 Vasa-Nicotera 4 Varughese 4 Vaney 4 vagus 4 vaginosis 4 vaccines 4 vacation 4 utmost 4 utilizes 4 utilitarian 4 utilising 4 Uteri 4 ureter 4 uremia 4 urbanization 4 upregulate 4 upenn 4 updates 4 UPCI 4 Unweighted 4 unscheduled 4 unrestricted 4 unreliable 4 Unraveling 4 unpredictable 4 unprecedented 4 unmodified 4 unmethylated 4 Universitatsklinikum 4 unitary 4 uninsured 4 Ungvari 4 unexplained 4 unequivocally 4 undue 4 undetected 4 underuse 4 understandable 4 underscoring 4 undergoes 4 uncoupled 4 uncomfortable 4 unaware 4 unanswered 4 um-1 4 Ultra-sound 4 ulcerative 4 Ueland 4 ucl 4 ubc 4 TY 4 Tween 4 turns 4 TUNEL 4 tumor-suppressor 4 tumor-bearing 4 Tucci 4 tubule 4 Tseng 4 Trucount 4 TRR 4 TRITC 4 Tris 4 trips 4 tripping 4 triplicate 4 triple-difference 4 triphosphate 4 trials26 4 tremor 4 Tremblay 4 Travis 4 trapped 4 transplanted 4 transnasal 4 transmit 4 translates 4 transforms 4 transferase 4 Transcriptome 4 transaminase 4 tramadol 4 training-induced 4 trail 4 tract-based 4 tracheostomy 4 toxin 4 torque 4 Torosian 4 toolbox 4 Tony 4 tonic 4 Tong 4 tomogram 4 Tomlinson 4 tolerate 4 Tokuhashi 4 Tofts 4 To-Figueras 4 tocolytic 4 Tobias 4 TLR 4 Titulaer 4 Titration 4 titrated 4 tinnitus 4 Timothy 4 time-to-event 4 time-stamped 4 time-specific 4 Time-of-Flight 4 time-dependent 4 tilted 4 tile 4 thymus 4 Thum 4 throughput 4 thromboembolic 4 three-way 4 three-fold 4 Thorin 4 Thorax 4 Thomson 4 Thiaudiere 4 thiamine 4 theSN 4 therapeutically 4 thawing 4 thawed 4 TGu 4 textbooks 4 tetrahydrocortisone 4 tetanic 4 testable 4 Testa 4 terroristic 4 Terrando 4 Teoh 4 Ten-year 4 Tengvar 4 tenets 4 Temesi 4 Telomeric 4 telcagepant 4 tech 4 tear 4 TCO-NHS 4 taxonomy 4 taxonomies 4 Taub 4 tangles 4 Tajik 4 tailor 4 tactile 4 Tabuchi 4 Tabor 4 Tablets 4 Szkulmowski 4 Szkulmowska 4 Sze 4 Szafranska 4 syringe 4 synucleinopathy 4 synucleinopathies 4 synergistically 4 synergistic 4 Symbols 4 swimming 4 Sweet 4 Swaroop 4 SVM 4 sustainable 4 suspended 4 susceptibility-weighted 4 surrogates 4 supratentorial 4 supramarginal 4 suppressors 4 suppressing 4 supportedby 4 supplies 4 superpotent 4 super 4 Sunnyvale 4 Sunninghill 4 summative 4 summaries 4 sumatriptan 4 suicidal 4 Sugiyama 4 sudden 4 suckling 4 subtracted 4 substrate-1 4 subspecialty 4 subserving 4 subscores 4 subscales 4 subjectivity 4 sub-hazard 4 sub-group 4 Subcommittee 4 stutters 4 stuttered 4 Stud 4 STT 4 struggle 4 Strettoi 4 streptozotocin-induced 4 Straube 4 Stockholm 4 Stevenson 4 sterols 4 sternum 4 Stephen 4 Steiner 4 Stefanis 4 Stavros 4 stating 4 statin 4 statewide 4 Stary 4 Starkweather 4 standardizing 4 stand-alone 4 Stamp 4 stall 4 staffing 4 SSC 4 Srinivasan 4 Srinivas 4 sprinting 4 sprawl 4 spousal 4 sporting 4 sponsors 4 Sponsored 4 spoken 4 splines 4 spiral 4 Spill 4 spikes 4 spiked 4 sphericity 4 Spherical 4 SPG 4 Spector 4 specifying 4 specialization 4 SPA 4 sorting 4 Sonographic 4 Sonka 4 somatotopy 4 solved 4 solicited 4 soil 4 Soest 4 sociology 4 smoking-related 4 S-methyltransferase 4 SMD-0 4 small-to-medium 4 Sloan-Kettering 4 slit-lamp 4 Slater 4 SLANFE 4 SLAhh 4 sketch 4 sizable 4 Sixty 4 situational 4 single-shot 4 Single-nucleotide 4 single-center 4 single-blind 4 Sing 4 sine 4 SIMI 4 Silverstein 4 Silverman 4 Silver 4 Silveira 4 silico 4 sildenafil 4 Silburn 4 sign-out 4 signify 4 Siegrist 4 side-effects 4 side-effect 4 SI2 4 shortterm 4 shortage 4 Shiomi 4 Shima 4 Shetty 4 Sherry 4 Sherar 4 Sher 4 Sheppard 4 Sheng 4 Sheline 4 Sheila 4 SHEI 4 shedding 4 Shapiro 4 shaping 4 Shankar 4 Shams 4 sex-specific 4 seventh 4 Seshadri 4 SES 4 sera 4 sequestration 4 sequenced 4 separates 4 Sennlaub 4 Sene 4 Semistructured 4 Selkoe 4 self-reporting 4 self-esteem 4 self-efficacy 4 self-care 4 self-awareness 4 Segal 4 seed-based 4 -see 4 Secondly 4 SDS-PAGE 4 screenings 4 screeners 4 SCN9A 4 Scientist 4 Schweitzer 4 Schwarz 4 Schuwirth 4 Schupf 4 Schulte 4 Schnell 4 Schneider-Kolsky 4 Schleit 4 Schlaepfer 4 schizophrenics 4 Schilling 4 Schild 4 Scheuer 4 Schering 4 schematic 4 Schatz 4 Schaefer 4 Schaechter 4 scFv-CH2-CH3 4 scarring 4 scar 4 Sbeh 4 Sauer 4 Saudi 4 sat 4 Sasaki 4 Sargent 4 Sanford 4 samhsa 4 Saltin 4 Sakai 4 sagittal 4 Sageman 4 safeguards 4 Saartok 4 S5C 4 S4D 4 S4B 4 S4A 4 S3B 4 S3A 4 S2C 4 S2B 4 S2A 4 S13 4 s-1 4 S0 4 Ruvkun 4 Rutar 4 Ruscio 4 ruptures 4 Rubio 4 Ru 4 rt-PA 4 rs356165 4 RPA 4 Rotterdam 4 Rothwell 4 rostral 4 Rossignol 4 ropivacaine 4 rooms 4 Rodrigues 4 Rocha 4 Roach 4 Rippe 4 RIPCHORD 4 Rinne 4 right-handed 4 Rieder 4 rIDI 4 Rick 4 Richmond 4 riboflavin 4 Riaz 4 rhinology 4 Rha 4 REVMAN 4 reversing 4 reuptake 4 returns 4 retinitis 4 retard 4 retains 4 retain 4 resuspended 4 restructuring 4 rested 4 Response-to-Retention 4 Resolving 4 resolvable 4 resistance-trained 4 residuals 4 residencies 4 reserved 4 rescues 4 Resch 4 reproducibly 4 replication-competent 4 repeats 4 remodelling 4 remnants 4 religious 4 reliance 4 reliabilities 4 releases 4 relapses 4 relapse-free 4 RelA 4 Rejuvenation 4 Reise 4 reinforces 4 reinforce 4 Reimold 4 Reichenbach 4 regressed 4 regards 4 refute 4 reflux 4 reflex 4 redundant 4 Redline 4 recurred 4 reconstructing 4 Reconstitution 4 receptor-targeted 4 receptor-like 4 recalcitrant 4 Rebholz 4 Rebecca 4 reach-to-grasp 4 RDK 4 RBD 4 Raz 4 Raymond 4 Raton 4 rationales 4 RAS-driven 4 ranking 4 RAND 4 Radu 4 radiotracer 4 radiometal 4 radiologic 4 quick-freeze 4 quest 4 queried 4 Quattrone 4 pyrophosphate 4 pyloromyotomy 4 pyloric 4 PWF 4 Puy 4 Puntoni 4 Puliafito 4 Pujol 4 PUFA 4 Puca 4 publish 4 PTC124 4 psychopathological 4 psychologists 4 Psycholinguistic 4 psi 4 PSD 4 Provis 4 Providence 4 Protein-associated 4 proteinase 4 Protecting 4 proteases 4 prostaglandins 4 prostaglandin 4 Prosensa 4 proposes 4 proponents 4 propionic 4 proliferating 4 projecting 4 progresses 4 programmer 4 programmed 4 Programmatic 4 programmable 4 profit 4 proficiency 4 proceed 4 procedure-specific 4 probing 4 pro-ageing 4 privilege 4 Pritchard 4 PRISMA 4 prioritizing 4 prioritized 4 prion 4 preventability 4 presurgical 4 presses 4 president 4 preserves 4 pre-plasmablast 4 premenopausal 4 pre-injury 4 pre-clinical 4 precipitating 4 precipitant 4 precedes 4 Pournaras 4 Pounds 4 post-processing 4 postimplantation 4 postburst 4 Posner 4 positron-emitting 4 Portrait 4 portions 4 Portenoy 4 Port 4 pore-forming 4 popliteal 4 Ponton 4 pontine 4 Pontifical 4 polypropylene 4 polymerized 4 Polyclinic 4 PO2 4 plug 4 plotting 4 platelet 4 plated 4 plateau 4 Plantar 4 plant 4 planar 4 Pizzagalli 4 Pitman 4 Piscataway 4 pioneering 4 pinna 4 Pijnappels 4 Piercy 4 Pierantoni 4 Pictures 4 Physiologie 4 php 4 phototherapy 4 phospholipid 4 phospholipase 4 phosphocreatine 4 Philipson 4 pharmacodynamic 4 pharmacist-led 4 phagocytosed 4 Pfrieger 4 Pflugers 4 Pfeiffer 4 Peyron 4 pertuzumab 4 perturbations 4 pertains 4 pertaining 4 Pers 4 Perrone 4 Permissions 4 Perlmutter 4 p-ERK 4 periventricular 4 peripherally 4 peripartum 4 performances 4 penalty 4 penalties 4 pelvis 4 pegfilgrastim 4 peak-exhaustive 4 PDMP 4 PDGFRA 4 PCT 4 payers 4 Paulus 4 Patrick 4 Patient-level 4 pathogenicity 4 Parish 4 parallels 4 paragraph 4 parafovea 4 Papapetropoulos 4 Papanikolaou 4 pancreas 4 pamidronate 4 palpable 4 palatability 4 pacemaker 4 p53-expressing 4 P40 4 P30 4 p2 4 p110a-RBD 4 oxytocin 4 oversee 4 oversampling 4 overestimated 4 overdosed 4 Oulu 4 Otte 4 Otorhinolaryngol 4 Ostman 4 osteoradionecrosis 4 osteogenic 4 osteoblastic 4 ostensibly 4 osmium 4 Osirix 4 oscillatory 4 Osaka 4 orthogonal 4 Ortega 4 Orsola 4 Orlando 4 originating 4 organizing 4 OQR 4 OPK 4 Ophthalmologica 4 Operators 4 operationally 4 operational 4 operate 4 operable 4 opacities 4 Ono 4 ONL 4 on-going 4 one-step 4 oncogenesis 4 Olympic 4 Olsen 4 Oliver 4 oligodendrocyte 4 olds 4 Okumura 4 ofthe 4 Officer 4 office-based 4 offering 4 Occupation 4 occlusions 4 occasional 4 occasion 4 OCB 4 obtains 4 obscure 4 Oak 4 Nygaard 4 Nunziata 4 numerically 4 Nugent 4 Nuffield 4 nrls 4 Nrf2 4 noxious 4 Novak 4 noticeably 4 Norwegian 4 Norton 4 Norstrom 4 normal-weight 4 normalizing 4 norm 4 Nordstrom 4 Nordic 4 noradrenergic 4 nonuse 4 Non-standard 4 nonsignificantly 4 non-pregnant 4 non-neovascular 4 non-motor 4 nonmetastatic 4 non-linear 4 Non-Episodic 4 nondisabled 4 nondiabetic 4 nonagenarians 4 non-aerobic 4 Noll 4 Nobili 4 nitrocellulose 4 nimh 4 night 4 Niemeijer 4 niche 4 nicely 4 NGS 4 NF 4 newsroom 4 neurovisceral 4 neurosensory 4 Neuro-sci 4 Neurorehabilitation 4 neuroplastic 4 neurophysiological 4 Neuropharmacology 4 neurologists 4 Neu-rol 4 Neuroglial 4 Neurodevelopmental 4 neurochemical 4 neurobiolaging 4 Networked 4 Nephrol 4 neonate 4 neoformation 4 neo-angiogenesis 4 Nemeroff 4 Neilsen 4 Neill 4 Neef 4 ned 4 Necrotic 4 necessitates 4 Neal 4 nasopharyngeal 4 Nashville 4 Nance 4 Nakanishi 4 NaHCO3 4 n2p 4 myopathies 4 myoclonus 4 Myhre 4 myelitis 4 Murata 4 Munro 4 multispectral 4 multisite 4 multiplying 4 multiplicity 4 multinomial 4 multi-group 4 multifetal 4 multicentric 4 multi-center 4 Mulnix 4 MRtr 4 Mouraux 4 Mourao-Miranda 4 motivate 4 Mosby 4 Morselli 4 morphologies 4 Morgantown 4 Morgagni 4 monotherapy 4 monoamine 4 Monit 4 Monica 4 Monash 4 momentum 4 Moller 4 Mohr 4 modules 4 Mobilizing 4 mmand 4 mixtures 4 mitotic 4 Mito-chondrial 4 mistakes 4 misfolded 4 misc 4 misbalance 4 mirrored 4 miR-29 4 miR-214 4 miR-15b 4 Mintun 4 Miniussi 4 minimisation 4 Mindfulness 4 Milner 4 milling 4 milligram 4 Miller-Lotan 4 mildly 4 Milam 4 Mieler 4 midwifery 4 microtiter 4 microscopically 4 microsatellite 4 MicroRNA-34a 4 microcirculation 4 microbiological 4 Microbiol 4 microarrays 4 microarray-based 4 Miaskowski 4 mevalonate 4 methionine 4 metalloproteinase 4 messengers 4 meshwork 4 mesencephalic 4 Melanocyte 4 melanocortin-1 4 Meister 4 Meissner 4 Megan 4 meets 4 Medscape 4 medio-lateral 4 Medicinal 4 medicated 4 Medac 4 MED15 4 Meco 4 meas 4 Meaney 4 Meador-Woodruff 4 MDxHealth 4 mdx 4 mdtcom 4 MDT-15DCT 4 mdt 4 MD2 4 McNicoll 4 McNeely 4 MCI 4 McGraw-Hill 4 McGrath 4 McGough 4 McEwen 4 McCoy 4 McConnell 4 McCall 4 Mayhew 4 Mayberg 4 Maxillofacial 4 Maurer 4 maturational 4 Matsushita 4 Matsuda 4 Matrigel 4 Mathew 4 maternally 4 Mate-Munoz 4 mask 4 Marzetti 4 Martins 4 Marmorstein 4 marketing 4 Marin 4 Marie 4 marian 4 marginal 4 Marcos 4 Marcora 4 Marco 4 manpower 4 Manolio 4 manoeuvres 4 Mannheim 4 Manne 4 manipulate 4 Maniega 4 Mangelsdorf 4 Manco-Johnson 4 mammographic 4 Maloney 4 Malik 4 maladaptive 4 Makris 4 Mak 4 maintains 4 Mahr 4 Mahler 4 Mahajan 4 Magstim 4 magnet 4 Madrid 4 Madison 4 Madar 4 MacNeil 4 Macleod 4 MacFabe 4 Maarten 4 M3 4 LZ 4 Lynn 4 Lurie 4 Luoma 4 luminal 4 Luke 4 Luk 4 Luhmann 4 luciferase 4 Lucentis 4 LSD 4 low-income 4 Lovio 4 Lou 4 loss-of-function 4 Lorenz 4 loosely 4 loose 4 long-standing 4 long-lasting 4 longest 4 Loke 4 Lohmann 4 Logopedics 4 locoregional 4 locate 4 lobular 4 loadings 4 lncRNA 4 Llewellyn 4 lithium 4 listening 4 Lipsitz 4 lipogenesis 4 lipid-rich 4 lipidation 4 linoleate 4 linker 4 Lingner 4 Linda 4 limbs 4 limbic 4 Lieb 4 Lidocaine 4 Li-Cor 4 Lichtheim 4 libitum 4 Lian 4 Leverenz 4 Lever 4 leukostasis 4 Leuk 4 Lethe 4 lessen 4 Leonardi 4 Leigh 4 Lehman 4 legally 4 legalizing 4 Leeuwenburgh 4 Leeuw 4 LeBlanc 4 Lebanon 4 LDV 4 LDL-C 4 LBW 4 LB-containing 4 Lay 4 Lax 4 Lauer 4 laterality 4 latencies 4 larynx 4 Laryngol 4 larvae 4 laparotomy 4 Lanza 4 Langevin 4 Landau 4 Lalloo 4 Lakes 4 Laine 4 lag 4 lactic 4 -L 4 Kwok 4 Kung 4 Kudo 4 Kroemer 4 Kristensen 4 Krebs 4 Kraytsberg 4 Kravchenko 4 KrasG12 4 Krankenhaus 4 Kozak 4 Koyama 4 Koshevoy 4 Koprich 4 Koozekanani 4 Kooijman 4 Kooij 4 Koller 4 Kolbitsch 4 Kolar 4 knock-out 4 Klopstock 4 Kley 4 KIRSON 4 Kirby 4 Kinesiology 4 kill 4 Kiely 4 Kiel 4 Kids 4 Ki-67 4 Ki 4 Khodr 4 Kevin 4 keratouveitis 4 Kenneth 4 Kean 4 KDIGO 4 Kawakami 4 Kasiske 4 Kashy 4 karyotype 4 Karnofsky 4 Karlsson 4 Kapahi 4 Kannus 4 Kannel 4 Kamasawa 4 Kalia 4 Kalaany 4 Junnila 4 Juan 4 Jpn 4 Joshua 4 Jorgensen 4 Jonker 4 Jolla 4 join 4 Johansen 4 Johannesburg 4 Johannes 4 JKK 4 JJN3 4 Jernigan 4 Jerger 4 Jenkinson 4 Jelic 4 Jean 4 JCT 4 JCO 4 Jang 4 jamaoto 4 Jacobson 4 Jacob 4 Jack 4 Izumi 4 IWCLL 4 IW 4 IU 4 Itoh 4 Italia 4 Issa 4 isothiocyanate 4 isokinetic 4 Ishigaki 4 ISH 4 irritable 4 Ire1-Xbp1s 4 iodinated 4 Ioannidis 4 in-vitro 4 invariant 4 intubation 4 introduces 4 intravesical 4 intra-retinal 4 intra-rater 4 intramyofibrillar 4 intracytoplasmic 4 intima 4 intestines 4 interviewed 4 interstate 4 interrupted 4 interrupt 4 interpretability 4 interobserver 4 internationally 4 intermyofibrillar 4 interleukin-8 4 Interleukin-1 4 interferometry 4 interfering 4 intercourse 4 interactome 4 intent-to-treat 4 intentional 4 intensified 4 intend 4 intakes 4 Instrumental 4 instructive 4 instruction 4 Instituto 4 Institut 4 INSIG 4 insensitive 4 innocent 4 injecting 4 Inj 4 infrequent 4 infiltrative 4 inexpensive 4 inert 4 ineligible 4 inefficiencies 4 industries 4 inducible 4 indomethacin 4 incubations 4 inconsistencies 4 incisional 4 incidental 4 inbreeding 4 inadvertently 4 imprecision 4 impractical 4 impose 4 implying 4 implicating 4 impediment 4 immunosuppressant 4 immunolabeling 4 immunolabeled 4 immunoblotting 4 IMF 4 imagine 4 imagery 4 Imager 4 illustrations 4 illness-specific 4 illicit 4 IL-17 4 Ikkbeta 4 IkBalpha-deficient 4 Ikappa 4 Iima 4 IIIA 4 I-IB-Mal-D-GEEEK 4 IDL 4 IDIBAPS 4 IDEOLOGICAL 4 idelalisib 4 ICF 4 ICD9CM 4 IAUC 4 IARC 4 hypoglycaemia 4 Hypnosis 4 hyperphosphorylated 4 hyperdynamic 4 hydrophobic 4 hydrochloride 4 hydraulic 4 Hybridoma 4 Husserl 4 Hurley 4 humanlongevity 4 Hull 4 Hsiao 4 HSCT 4 Hoxb8 4 housestaff 4 housekeeping 4 Houlden 4 Hosmer 4 horns 4 Horikawa 4 hopefully 4 homogenous 4 Holmboe 4 Hogerlinden 4 Hogan 4 hof 4 Hodge 4 Hoda 4 HN-QOL 4 hitherto 4 Hinton 4 hindered 4 hinder 4 Hillman 4 high-load 4 high-cholesterol 4 high- 4 HI 4 heterozygotes 4 heterocellular 4 Herzog 4 herpes 4 Herbert 4 Hepple 4 hepg2 4 HEPES 4 Hendriksen 4 Henan 4 Hemmings 4 helps 4 Helios-Klinikum 4 Helgadottir 4 Hekimi 4 Heinrich 4 hedgehog 4 heated 4 Heard 4 health-care 4 HCl 4 Hay 4 Harvest 4 Haroutunian 4 hardly 4 Harden 4 harboring 4 haplogroups 4 Hanover 4 Hannan 4 Hanger 4 hamster 4 Hallek 4 Hainaut 4 HAGR 4 haemorrhage 4 haemoglobin 4 Hadzic 4 Haddad 4 Gynaecologists 4 gyms 4 guess 4 Guenther 4 GTT 4 GTP 4 GSEA 4 Grunwald 4 grounds 4 Grondin 4 grommets 4 Grivennikov 4 grip 4 GRIN2A 4 Grether 4 Grenoble 4 Greicius 4 Greenberg 4 gravis 4 granted 4 Grande 4 gradient-echo 4 Goodall 4 Gonzalez-Millan 4 gonadotropin 4 Golgi 4 Goldschmidt 4 Goldnger 4 Goeschel 4 Goedert 4 Godara 4 glycinergic 4 glycemic 4 Glioblastomas 4 Glickman 4 Gleeson 4 glaucomatous 4 Glaser 4 Glare 4 Glahn 4 Gispert 4 Gibbs 4 Gibb 4 Gianello 4 Ghorbel 4 gestations 4 gestation-matched 4 Gerontologist 4 Geriatrics 4 Georgia 4 geometries 4 Geodesic 4 Genotypic 4 genitourinary 4 Geneva 4 generously 4 gene-related 4 generations 4 generalize 4 generalizable 4 Generalitat 4 gene-expression 4 gcs-1p 4 Gcn4 4 Gavin 4 Gathercole 4 Gaston 4 Gary 4 Garrow 4 Garrett 4 Garrahan 4 garnered 4 Gandhi 4 Gaiddon 4 Gage 4 gadobutrol 4 Gabri 4 Gabor 4 FW 4 fundamentally 4 functionality 4 Funatsu 4 fulfilling 4 Fujiwara 4 Fugl-Meyer 4 fuel 4 fsl 4 Frumkes 4 fruitful 4 Fromm 4 Froidevaux 4 Fritsch 4 fringe 4 Fried 4 Frey 4 freeze 4 freestanding 4 free-floating 4 Freedman 4 Frassineti 4 Franke 4 FRA-negative 4 fragment 4 fractionated 4 fourfold 4 four-dimensional 4 Fortune 4 formats 4 formate 4 Forl 4 foreseeable 4 forelimb 4 forebrain 4 Fondo 4 Fonarow 4 follow-ups 4 folding 4 foam 4 fluoresence 4 fluid-attenuated 4 Flores 4 florbetapir 4 flicker-induced 4 flexors 4 flexor 4 flexed 4 Fleisher 4 Flawless 4 flanking 4 flank 4 Flammer 4 fixative 4 Five-Year 4 Fishman 4 first-episode 4 financing 4 films 4 Fifty 4 fibres 4 FERPA 4 Feinberg 4 feet 4 feces 4 Fearon 4 Fearnley 4 favourable 4 Faulkner 4 fats 4 fast-twitch 4 fasciculi 4 Farwell 4 Farley 4 Fandino 4 famous 4 familiarity 4 Fallon 4 fallen 4 Faith 4 Fahey 4 factor-alpha 4 facile 4 Faber 4 Ezhkova 4 extrusion 4 extravascular 4 extramuscular 4 extinction 4 expresses 4 exported 4 explores 4 exploiting 4 exploited 4 expansions 4 exhaled 4 excludes 4 excitation 4 exam 4 EVT 4 everyone 4 Eve 4 evaporated 4 evacuated 4 EuroQol 4 EuroIntervention 4 Euroimmun 4 Euclid 4 ethnicities 4 Esserman 4 Esser 4 ESAS 4 ERSPC 4 EROs 4 Erlbaum 4 Erickson 4 Erasmus 4 equivalence 4 equals 4 eponym 4 epitope 4 epinephrine 4 Epilepsia 4 entrance 4 enteric 4 enrolment 4 Enquiries 4 enjoyment 4 Engel 4 Engebretsen 4 energy-dense 4 endometritis 4 endocrinological 4 endemic 4 endarterectomy 4 encompassing 4 encephalopathies 4 EMR 4 employs 4 emphasizing 4 emphasizes 4 eluting 4 elucidating 4 Elson 4 Elner 4 El-Naggar 4 Elman 4 Ellisman 4 Eli 4 electronics 4 electromyography 4 electrolyte 4 elastin 4 El-Agnaf 4 elaborate 4 Ekstrand 4 ejection 4 eigenvalues 4 Eichmann 4 Egan 4 Efron 4 effusion 4 Eerola 4 educated 4 Ebrahimi 4 Eavg 4 dysplastic 4 dyslipidemia 4 dynamometer 4 Dutta 4 Durr 4 duration-dependent 4 duplications 4 Dunst 4 Dundee 4 Dumitrescu 4 Dumay 4 Dukes 4 Dufour 4 Dufouil 4 Duffy 4 duct 4 Dublin 4 Dubis 4 Dub 4 dual-source 4 DSTs 4 DST 4 Droszcz 4 dropouts 4 Driscoll 4 drift 4 dozens 4 doxorubicin 4 down-stream 4 down-regulated 4 dosages 4 Dorner 4 Dorman 4 Donnelly 4 documenting 4 DMV 4 DMEM 4 DMC 4 divisions 4 divides 4 diversion 4 Disturbed 4 distortion 4 distensibility 4 disseminating 4 disposal 4 dispensaries 4 disorganization 4 discriminated 4 discrepant 4 discovering 4 discontinuations 4 disconnection 4 discomforts 4 dilutions 4 digitized 4 diffusive 4 diffusion-restricted 4 diffusing 4 dienophile 4 Diels 4 Diee 4 Diaz 4 diarrhea 4 diaries 4 Diamond 4 DHN 4 Deybach 4 Dexter 4 Dexa-methasone 4 Dewar 4 Devries 4 Devisetti 4 deterministic 4 deserts 4 descriptor 4 descriptively 4 descending 4 desaturases 4 Desai 4 dermatitis 4 deriving 4 depot 4 deposited 4 deployed 4 deny 4 dental 4 denatured 4 dementias 4 DeMartini 4 Delso 4 Dell 4 delineate 4 delicate 4 Delgado 4 de-identified 4 degrade 4 deg 4 deformity 4 Deer 4 deconditioning 4 decision-maker 4 Decisional 4 debilitating 4 Dean 4 deafness 4 DDS 4 DCCT 4 D-binding 4 Davids 4 Dave 4 daughter 4 data-base 4 DAS-7 4 Darios 4 dangerous 4 Dana 4 Damon 4 Dam 4 cytosol 4 CYK 4 cyclohydrolase 4 cyclin 4 cycle-ergometer 4 CX3CL1 4 CVrep 4 cuts 4 Cummings 4 culturally 4 cube 4 cryoprotected 4 Cross-validation 4 Crook 4 Cronbach 4 crises 4 credentialing 4 Craciunescu 4 Cowen 4 Coutre 4 Court 4 Courquin 4 Cosyns 4 Costafreda 4 COs 4 corrosion 4 correlating 4 Corbetta 4 coprolalia 4 cooperates 4 converting 4 converge 4 control-treated 4 controlled-trials 4 contraindication 4 contradict 4 contractures 4 contraception 4 continuation 4 Contextual 4 constrained 4 constituents 4 consist 4 conform 4 confluent 4 confines 4 conferences 4 conduction 4 conductance 4 concordant 4 concomitants 4 concomitantly 4 conceptually 4 concealment 4 computers 4 computationally 4 complicates 4 Complexities 4 compilation 4 com-pared 4 comparatively 4 committed 4 Comin 4 comfortably 4 Combadiere 4 Columbus 4 colorimetric 4 colony-stimulating 4 colocalized 4 collision 4 Collier 4 colleagues17 4 collateral 4 Colin 4 Cogn 4 coeficient 4 Cody 4 codon 4 Co-culture 4 cocaine 4 coagulopathy 4 coadministered 4 CMcB 4 CMAJ 4 clustered 4 closest 4 clones 4 Clinico-pathological 4 climbing 4 Cleeland 4 cleaned 4 clarifying 4 cit 4 Cirstea 4 cirrhosis 4 circumvent 4 circumstantial 4 circumstance 4 circumcision 4 circulate 4 ciency 4 chromosomal 4 Chromatin-Bound 4 Christine 4 Christina 4 Chris 4 Chou 4 Cholesterol-rich 4 Choe 4 chi-squared 4 ChIP-on-chip 4 chico 4 Chiang 4 chewing 4 Cherubini 4 Cherry 4 chemosensitivity 4 chelators 4 chelation 4 chelating 4 Chee 4 checklists 4 CHDH 4 CHD 4 Chasm 4 Charney 4 Charlottesville 4 chapters 4 chaperone 4 chances 4 Champions 4 Chambless 4 Chairperson 4 Chabolle 4 CGH 4 CFRI 4 CFR 4 cfm 4 cerebrotendinous 4 cell-free 4 cell-derived 4 Cella 4 CE-2 4 CCT 4 CCL19 4 CBb4w 4 Caudill 4 Catts 4 catheterization 4 Catherine 4 category-less 4 categorize 4 categorised 4 cataract-related 4 castration-resistant 4 caspase-9 4 casein 4 carving 4 carve-out 4 carries 4 Caron 4 carnitine 4 Carlson 4 Carlen 4 Carey 4 cardiothoracic 4 cardiologists 4 cardinal 4 Carcinog 4 carcass 4 Capuron 4 capsule 4 capacities 4 Cantwell 4 Campisi 4 Calvary 4 Callahan 4 caliber 4 calculates 4 Cairns 4 Cahalin 4 cages 4 cacy 4 Cable 4 Cabin 4 by-products 4 byproducts 4 Byers 4 BxYZ 4 buttock 4 Bursell 4 Burnley 4 Burnett 4 Burlingame 4 bupivacaine 4 Bulletin 4 budget 4 Bud 4 Buchner 4 Buchman 4 Buchanan 4 BTZ-sensitive 4 Bryman 4 Bryan 4 Brustovetsky 4 Brooke 4 bronchial 4 Brodaty 4 brightness 4 BRFSS 4 Breslow 4 breaths 4 breath-by-breath 4 Breasts 4 BrdU 4 Brazilian 4 Brar 4 Brandon 4 branched 4 Brady 4 Brace 4 Bq 4 Boyd 4 Boy 4 boxes 4 Bowen 4 Bourne 4 Boulogne-Billancourt 4 Bottiglieri 4 Bossi 4 Bosch 4 Borg 4 bordering 4 boost 4 Bonnet 4 Bonn 4 Boca 4 blurred 4 Bloodstein 4 blood-aqueous 4 blisters 4 Blanco 4 BJU 4 Biswas 4 bispectral 4 birthplace 4 biosynthetic 4 biomolecules 4 Biometrika 4 Biograph 4 bioenergetic 4 bioactive 4 Bigelow 4 Bigas 4 biexponential 4 Biber 4 BFR 4 beta-actin 4 beta5 4 Berwick 4 Berkeley 4 benzodiazepines 4 Benoit 4 Bellemare 4 Bellaria 4 Belconnen 4 Beidel 4 behaviorally 4 Bedford 4 bears 4 Bearelly 4 BCh 4 BCA 4 Bauman 4 Bassi 4 basement 4 -based 4 Barzilai 4 Barriga 4 Baron 4 Bandello 4 Ban 4 Ballenger 4 bait 4 Baeuerle 4 backbone 4 axilla 4 axially 4 axes 4 awaiting 4 autonomous 4 Automation 4 autoaggression 4 autistic 4 authorized 4 Australasian 4 Augustin 4 Attribution-NonCommercial-No 4 attracted 4 Attitudes 4 attendings 4 ATS 4 ATP-binding 4 atopic 4 atomic 4 Athl 4 Atheroscler 4 atheoretical 4 Athens 4 asymptotic 4 astrocytic 4 assets 4 assembled 4 Aspenberg 4 asleep 4 Asia 4 Ashwood 4 articulate 4 arriving 4 arrive 4 arrests 4 Armonk 4 Arkansas 4 argonaute 4 Argentina 4 Arg218Cys 4 ArchOphthalmol 4 archival 4 Archer 4 aquaporin-4 4 approves 4 apoA-1 4 apathetic 4 anyone 4 Antonella 4 Anton 4 antitumour 4 Anti-rabbit 4 antipsychotics 4 antiplatelet 4 antioxidants 4 anti-mouse 4 anti-miR-135b 4 antigoat 4 anti-epidermal 4 anticonvulsant 4 anticoagulation 4 anticipation 4 Anticipate 4 anti-Cav1 4 anti-AQP4 4 Anselmi 4 annulus 4 Annesi 4 Anim 4 angiotensin 4 Angelo 4 anesthetists 4 Anesthesiol 4 ANE 4 Andreas 4 Anat 4 analogy 4 anabolism 4 amyloid-like 4 amyloid-beta 4 amputation 4 amplifiers 4 ampli 4 AMPA 4 ammation 4 Amini 4 amine-reactive 4 Ames 4 Amersham 4 amended 4 ameliorate 4 a-melanotropin 4 ambiguity 4 ama 4 Alvarez-Erviti 4 Alternate 4 Alpharetta 4 alpha-particle 4 Alpha-MSH 4 alpha-melanocyte-stimulating 4 Alopecia 4 Almen 4 all-trans 4 allodynia 4 Alliance 4 Alleviating 4 aligns 4 aligning 4 Alcon 4 Akt1 4 Ain 4 AHP 4 agitation 4 aggregating 4 Afterward 4 after-race 4 Affleck 4 affirms 4 advocacy 4 advertisement 4 advantaged 4 advancements 4 adult-onset 4 adjustable 4 adipocytes 4 adequacy 4 Adenomatous 4 adenoma 4 adeno-associated 4 Adelaide 4 Addendum 4 adaptability 4 acylation 4 Acton 4 ActiveStep 4 actin 4 ACTH 4 ACTB 4 ACSM 4 Acronyms 4 acquiring 4 acknowledges 4 acetylcholine 4 acetylated 4 acetate 4 accustomed 4 accuracies 4 accommodation 4 acclimatization 4 acclimation 4 accessing 4 aca 4 A-C 4 abundantly 4 absolutely 4 absenteeism 4 abruption 4 abrogated 4 Ablonczy 4 Abeta-induced 4 Abdel-Wahab 4 Abdelmohsen 4 AASSFN 4 Aarts 4 Aarhus 4 Aarau 4 AAB 4 A9 4 A2E-laden 4 a2d 4 A2 4 99mTc-MIBI 4 99mTc-CCMSH 4 994 4 991 4 989 4 978 4 975 4 974 4 971 4 964 4 963 4 960 4 959 4 956 4 939 4 936 4 933 4 932 4 926 4 918 4 917 4 914 4 911 4 90i 4 909 4 908 4 903 4 902 4 8th 4 8A 4 890 4 880 4 852 4 849 4 847 4 839 4 837 4 832 4 825 4 8-10 4 810 4 808 4 807 4 7-fold 4 7C 4 797 4 796 4 793 4 784 4 783 4 780 4 771 4 75th 4 756 4 754 4 751 4 748 4 7424 4 737 4 727 4 724 4 723 4 711 4 709 4 701 4 700-0005 4 -7 4 6-year-old 4 6J 4 698 4 683 4 682 4 680 4 6-8 4 673 4 669 4 668 4 6657 4 664 4 663 4 660 4 654 4 650 4 64Cu-labeled 4 64Cu-CBTE2A-Re 4 646 4 640 4 639 4 635 4 633 4 631 4 623 4 622 4 619 4 618 4 615 4 614 4 605 4 603 4 6000 4 -6 4 5mM 4 5mg 4 5-methyltetrahydrofolate 4 5-HT1A 4 5E 4 5Department 4 5alpha-tetrahydrocortisol 4 595 4 592 4 5870 4 586 4 580 4 578 4 574 4 570 4 562 4 527 4 513 4 5-10 4 5000 4 4-point 4 4-hydroxynonenal 4 4Department 4 484 4 482 4 459 4 432 4 431 4 418 4 4024 4 4000 4 3T 4 3LY 4 3Department 4 3-and 4 373 4 353 4 31P-MRS 4 -3 4 2-week 4 2M 4 2-IR 4 2-compartment 4 29th 4 27A1 4 262 4 25th 4 25-hydroxyvitamin 4 244 4 2380 4 2321 4 211At 4 2109 4 20-ms 4 20-fold 4 2017 4 2012-2014 4 2008-2012 4 -2 4 1st 4 1e3 4 19th 4 19-9-8 4 1966 4 1963 4 1957 4 1950 4 1941 4 1913 4 -19 4 18kDa 4 1822 4 1734 4 1606 4 15min 4 1592 4 1552 4 1531 4 1521 4 1492 4 1447 4 13-cis 4 1371 4 1368 4 1350 4 1335 4 1325 4 1316 4 1311 4 1308 4 1307 4 1305 4 12-week 4 12-hour 4 1280 4 1275 4 1269 4 1260 4 124I 4 1249 4 1245 4 1238 4 12- 4 1177 4 1176 4 1169 4 1166 4 1165 4 1158 4 1152 4 1149 4 1-14 4 1-13 4 1119 4 1117 4 1115 4 1105 4 10th 4 10mM 4 1098-7339 4 1090 4 1076 4 1066 4 1064 4 1063 4 1059 4 1057 4 1055 4 1053 4 1047 4 1032 4 1023 4 1020 4 1019 4 1013 4 1012 4 1010 4 0s 4 0991 4 087 4 082 4 041 4 040 4 036 4 0196-0644 4 0020-9996 4 0000 3 Zwart 3 zur 3 z-scores 3 Zou 3 Zotter 3 ZonMW 3 Zoll 3 Zimmerman 3 Zimmer-Galler 3 Zhuang 3 Zhan 3 zebrafish 3 Zawinka 3 Zarbin 3 Zamarripa 3 Zalcenstein 3 Zaike 3 Zaha 3 Zafiris 3 Zafirelis 3 Zache 3 Zabetian 3 z2 3 z1 3 Yuji 3 yrs 3 young-onset 3 Yoshimoto 3 YF 3 Yeudall 3 yellowish 3 Yearout 3 year-old 3 Yamakado 3 Yamaguchi 3 yA 3 y1 3 -Y 3 xs 3 XLOC 3 Xiromerisiou 3 Xin 3 xhtml 3 X-chromosome 3 XBP1-silenced 3 x2-test 3 Wu-Chou 3 writes 3 Writer 3 Wouters 3 wounds 3 worthy 3 workup 3 Workman 3 work-force 3 wording 3 Woodhams 3 wooden 3 Wolter 3 WO 3 WMFT 3 Wittink 3 within-session 3 withholding 3 Withall 3 witha 3 Wirth 3 winner-take-all 3 Windle 3 Wilt 3 Willis 3 Williams-Gray 3 Wikstrom 3 widening 3 Wick 3 Whole-exome 3 Whitmore 3 Whitcup 3 Wheeler 3 Westra 3 Weltman 3 well-designed 3 Wellcome 3 Weissman 3 Weiskopf 3 Weill 3 Weiler 3 weightings 3 weighed 3 Wedl 3 wedge 3 web-site 3 Webb 3 wear 3 WAY-100635 3 wavy 3 wavelet 3 Waterloo 3 Wasserman 3 wash-out 3 Warwick 3 warm 3 Walerych 3 Wald 3 WAIS-IIIUK 3 Wahl 3 Waehringer 3 w8 3 w1 3 VY 3 VX2 3 vulnerabilities 3 VU 3 voxel-wise 3 Voutsinas 3 Voula 3 vouchers 3 Vorgerd 3 voor 3 Vollset 3 Volkmann 3 Volk 3 voids 3 Vogt 3 Voci 3 Vo 3 VMD2 3 vitreoretinal 3 Vitale 3 Vista 3 Visser 3 VISR 3 Viruses 3 virtue 3 violent 3 Vilari 3 Vigen 3 videotaped 3 Videofluoroscopy-based 3 Victor 3 vicious 3 Viatour 3 Vetlesen 3 Veteran 3 vertebrates 3 Veronese 3 Verlag 3 Verkhratsky 3 verifying 3 Vergata 3 verbatim 3 Veninga 3 Veng 3 Veiby 3 VEGFA 3 Vegas 3 Vega 3 Vectashield 3 Vecchio 3 VDR 3 VD 3 vascularity 3 Varni 3 Vardi 3 valued 3 value-based 3 Valley 3 Vallely 3 Valle 3 Vallabhapurapu 3 Valente 3 Valencia 3 valenced 3 Vajda 3 vaguely 3 vacuum 3 ux 3 UV 3 Utah 3 ut 3 Urology 3 urologist 3 up-to-date 3 uptakes 3 UPS 3 upregulates 3 up-regulate 3 uploads 3 upgraded 3 upfront 3 updating 3 untreatable 3 Unsworth 3 unsure 3 unsuitable 3 unspecified 3 unrestrained 3 unreported 3 unrealistic 3 unperturbed 3 unpaired 3 unloading 3 unlabeled 3 Universities 3 Universiteit 3 univariable 3 Univ 3 uninvolved 3 unidimensional 3 Unhelpful 3 Unger 3 unfamiliar 3 unexplored 3 unenhanced 3 underutilized 3 undertreated 3 underpinnings 3 underlines 3 underline 3 uncovered 3 Uncorrected 3 unconsciousness 3 unambiguous 3 Umberto 3 UM 3 ultra-trail 3 ultra-sound-guided 3 ultra 3 UK-based 3 uic 3 Ueno 3 uence 3 Ueda 3 Uchiyama 3 typhoid 3 tympanic 3 TXtr- 3 two-group 3 Twig 3 Twenty-one 3 Twenty-five 3 Tuzcu 3 Turco 3 tunnel 3 tumor-targeting 3 tumorigenic 3 Tumor-associated 3 Tulandi 3 tubular 3 tubal 3 TSP-1 3 tsch 3 Truong 3 Troy 3 Troncoso 3 Triton-X 3 tritium 3 trip-related 3 Trinidad 3 trimethylsilyl 3 tries 3 Trias 3 triacylglycerol 3 Trezona 3 Treg 3 treats 3 treadmills 3 traverse 3 Transplant-Free 3 transitioned 3 transgenicmice 3 transgene 3 transfection 3 Transducers 3 transduced 3 transcription-PCR 3 trainee 3 tractography 3 tractable 3 Tracey 3 toxins 3 Townsend 3 touted 3 Toulouse 3 tothe 3 totally 3 tonerelated 3 Tomography-guided 3 Tomiyama 3 Tombaugh 3 Tom 3 tolerable 3 Tokunaga 3 Tofaris 3 toddler 3 Toda 3 tobe 3 to-0 3 titrating 3 tissue-based 3 Tissue4D 3 Timpson 3 time-loss 3 tiles 3 Tilburg 3 Tiitinen 3 Tibboel 3 Thuringia 3 thumb 3 throw 3 thrombotic 3 thromboembolism 3 three-group 3 thoughtful 3 Thorin-Trescases 3 thoracolumbar 3 Thomas-Crusells 3 THN 3 Thirty-two 3 Thirty-day 3 thirds 3 thiocyanate 3 thing 3 There-fore 3 Theologiae 3 Theodore 3 theatre 3 THDOC 3 thaw 3 thatIkBalpha 3 TGF-beta 3 TGF-b 3 Tex 3 Teunissen 3 tetramer 3 tetrahydrocortisol 3 tetrahydrobiopterin 3 tetracycline 3 Tesla 3 TEs 3 Terzian 3 Teresa 3 tens 3 Tenn 3 tendinopathies 3 tenderness 3 tender 3 temporomandibular 3 tempo 3 templates 3 template-based 3 Temel 3 telemetric 3 Teismann 3 Teija 3 teh 3 Technetium-99m 3 TEACHH 3 TCF7L2-rs7903146 3 TCF 3 TBI-exposed 3 Tausk 3 Tatar 3 task-dependent 3 Tasdemir 3 Taschenberger 3 taps 3 tantalizing 3 tamponade 3 Tammen 3 Tamar 3 Tam 3 Talmud 3 Tallal 3 Takeshi 3 Taira 3 Taipei 3 tailoring 3 Taguchi 3 Tada 3 tabulation 3 T5988C 3 SZ 3 Syto16 3 systole 3 systemically 3 synergize 3 synaptogenesis 3 symptomsin 3 switched 3 Swick 3 swept-source 3 sweets 3 suturing 3 sutures 3 Sustained-release 3 suspicion 3 surveying 3 surrounded 3 surgery-specific 3 surgery-related 3 surge 3 surface-expressed 3 surely 3 supramaximal 3 supraglottoplasty 3 suprabasal 3 supposedly 3 supposed 3 supplied 3 supervisors 3 Sunshine 3 Sundaresan 3 sumoylation 3 summation 3 summarizing 3 Summa 3 Sukstanskii 3 sugars 3 suctioning 3 successively 3 succeed 3 subtoxic 3 substaging 3 subnanomolar 3 subgroup-specific 3 subfield 3 subepidermal 3 subdivided 3 Subclassification 3 subcapsular 3 subanesthetic 3 subanalysis 3 stutterer 3 Stupp 3 Studio 3 studies21 3 Stroke-associated 3 STROBE 3 strive 3 stripped 3 strip 3 strings 3 Stringaris 3 stride-by-stride 3 stressful 3 stressed 3 strengthens 3 stream 3 Strauss 3 Strahlenther 3 Storkel 3 Stork 3 storing 3 store-and-forward 3 Stojakovic 3 sTNFR 3 stitching 3 stimulators 3 stimulants 3 Stilgenbauer 3 stigmasterol 3 steroid-induced 3 Sterky 3 stereotypic 3 stereotyped 3 Stereoscopic 3 stereological 3 stereo 3 Stephane 3 Stephan 3 stenting 3 stems 3 stemming 3 Ste-Marie 3 Steinheim 3 steatosis 3 stayed 3 Statistica 3 Statist 3 stations 3 Station 3 state-space 3 STAT3 3 Starkes 3 Stark 3 Starita 3 stands 3 standardize 3 stammering 3 Stalmans 3 Stairs 3 Stahl 3 sta 3 sseldorf 3 SR-BII 3 squared 3 sprouting 3 sprinters 3 Sportscience 3 sponsor-investigator 3 spoiled 3 spm 3 spirometry 3 Spira 3 spin 3 Spiess 3 SPIE 3 spheres 3 Speech-Language-Hearing 3 speculum 3 specification 3 Specht 3 speaks 3 SPCG-4 3 spatiotemporal 3 Spada 3 space-filling 3 Southwest 3 Soubrane 3 Soto-Ortolaza 3 Sorensen 3 Sophia 3 Soong 3 Soo 3 Sony 3 somnolence 3 Somma 3 Somers 3 soma 3 solute 3 solubility 3 Solernou 3 Soininen 3 Sohal 3 Soh 3 Soerensen 3 soda 3 SNpc-injected 3 Snow 3 snmjournals 3 Snijders 3 Snellen 3 Snedecor 3 snacks 3 Smits 3 SmartTots 3 Small-scale 3 slowed 3 slips 3 slide 3 sleeping 3 Sleepiness 3 Slaughter 3 S-LANSS 3 Slagboom 3 Slade 3 Skinner 3 skiing 3 skew 3 skeletal-related 3 Six-month 3 six-item 3 six-community 3 site-specific 3 Sirtori 3 Siren 3 Sinha 3 singles 3 single-item 3 single-arm 3 Singapore 3 Sin 3 simvastatin 3 simulation-based 3 simulating 3 Sim 3 silylation 3 Silvia 3 silicone 3 Silder 3 Silber 3 Sigulinsky 3 sign-inverting 3 significances 3 Sigmund 3 sighted 3 sided 3 sickness 3 sickle 3 Sia 3 Shriver 3 shrinkage 3 short-lived 3 short-form 3 shortest 3 shoes 3 Shirendeb 3 ship 3 Shimada 3 Shim 3 shifting 3 Shepherd 3 shelves 3 Shelton 3 Sheidow 3 shear 3 Shay 3 sharply 3 Shapiro-Shelef 3 Shapira 3 Shao 3 Shan 3 shallow 3 shall 3 shaker 3 Shadmehr 3 Sha 3 SGA 3 SFeeT 3 Seymour 3 Sexton 3 sex-matched 3 severance 3 set-up 3 Sessler 3 Session1 3 Serruys 3 seronegative 3 seriously 3 serif 3 sequel 3 septum 3 septal 3 Sept 3 sentences 3 sensibility 3 Sennheiser 3 senescence-associated 3 Semoun 3 semi-automatic 3 semiautomated 3 Semiannual 3 Semel 3 Selvin 3 self-selected 3 self-reports 3 self-rated 3 self-pay 3 self-monitoring 3 self-loathing 3 self-injurious 3 self-focussed 3 self-assessment 3 seldom 3 Sekine 3 Seitz 3 Sehi 3 segmenting 3 secreting 3 Secondarily 3 Sdb 3 Sculptoreanu 3 Sclerotherapy 3 sclerochoroidal 3 SciUSA 3 Scientifique 3 Schuurman 3 Schutt 3 Schunemann 3 Schroepfer 3 school-aged 3 school-age 3 Scholar 3 Schneeberger 3 Schmittgen 3 Schmid 3 Schlanitz 3 schizoaffective 3 Schimel 3 Schiff 3 Schetter 3 Schallert 3 SCHAER 3 scatterplot 3 scarcity 3 scarcely 3 Scandinavian 3 SCAF 3 sc-328-G 3 SBP-1 3 Sayers 3 Saving 3 Saunders 3 Sattler 3 Sassa 3 Sarah 3 Santhera 3 Santarelli 3 Sanitaria 3 SanGiovanni 3 Sanders 3 sand 3 Sampson 3 Sampor 3 sample-size 3 Samonigg 3 salvage 3 Salud 3 Salthouse 3 SAL-RNA1 3 Salminen 3 Sally 3 Salles 3 salience 3 sales 3 Sala 3 Sakuragi 3 Saiki 3 Sahoo 3 Sadikot 3 Sacco 3 Saccharomyces 3 Sabrina 3 Sabr 3 Sabate 3 Sabadell 3 S9 3 S7A 3 S5D 3 S5B 3 S4C 3 S3C 3 S1E 3 S1D 3 S1C 3 S1B 3 S1700 3 S1568-1637 3 s11 3 Rye 3 ryanodine 3 Ruderman 3 Rudavsky 3 Rub 3 rs754203 3 rs2583988 3 RPMI-8226 3 Rowan 3 Roux 3 Routledge 3 Rourke 3 rounding 3 rounded 3 Rouland 3 rotations 3 rotates 3 rostrocaudal 3 Rossman 3 Rosa 3 Roosevelt 3 Roos 3 Rooij 3 Romer 3 romantic 3 Romano 3 Rollins 3 Rohrer 3 Roeder 3 Rodr 3 Rockenstein 3 Rock 3 Rocca 3 robustly 3 rMT 3 rmed 3 Rizza 3 Ritz 3 rituximab-induced 3 risk-reduction 3 Riskowski 3 Risk-conferring 3 RIPA 3 rimexolone 3 Rifai 3 Riedel 3 Ridgway 3 Ribacoba 3 rhodopsin 3 Rhodes 3 RHO 3 rhinosinusitis 3 rhinitis 3 rheumatologic 3 rheumatic 3 Rhee 3 RGD-Lys- 3 rewards 3 revising 3 reversion 3 reversed-phase 3 reversals 3 Rett 3 retropalatal 3 retreated 3 RETRA 3 retinyl 3 retinoic 3 retinal-choroidal 3 reticulata 3 resynthesis 3 resurgence 3 resumed 3 resume 3 restraining 3 restarted 3 ression 3 responsibilities 3 respiratory-triggered 3 resource-limited 3 resonant 3 Resnick 3 resemble 3 resemblance 3 resampled 3 repressive 3 replicative 3 repeating 3 repeat-containing 3 Renisch 3 rendered 3 Remple 3 remarks 3 REM 3 reluctant 3 relievers 3 relaxed 3 relapsing 3 Rel 3 rejector 3 Reinhard 3 Reindl 3 re-imaging 3 Reich 3 Rehmsmeier 3 regret 3 regimes 3 Regar 3 refugees 3 Refsum 3 reforms 3 reflectivity 3 reflections 3 refining 3 refilled 3 reevaluated 3 Rees 3 redundancy 3 recur 3 rectus 3 recovering 3 reconstruct 3 recognising 3 recapitulating 3 reassessment 3 rearrangements 3 rear 3 realization 3 realism 3 -Re 3 Raviola 3 Raven 3 rational 3 rater 3 Ratamess 3 Rash 3 Rapicavoli 3 rapeutic 3 ranks 3 rankings 3 Randwick 3 randoms 3 Ramos 3 Ramachandran 3 Ralph 3 Raj 3 Rahim-Williams 3 RAGE 3 radiopharmaceutical 3 radioligands 3 Radiographics 3 Rachel 3 Racette 3 Rabiner 3 Rabbitt 3 rAAV 3 R248W 3 r1 3 quoted 3 quote 3 Quinlan 3 quiet 3 Questionnaire-25 3 queries 3 QUARTZ 3 quarterly 3 quarter 3 Quadri 3 QLQ-C30 3 pyelonephritis 3 Putten 3 putatively 3 pursuing 3 pursued 3 purchases 3 purchase 3 Pumariega 3 PUCRS 3 pub2 3 pSyn-positive 3 PsycINFO 3 Psychosomatics 3 psychosomatic 3 psychoses 3 Psychophysiology 3 Psychopharmacology 3 psychoactive 3 psychiatrist 3 Psych 3 PSF 3 pseudo-phakic 3 pseudodiffusion 3 PSDs 3 Przybysz 3 Przuntek 3 Pruritus 3 proving 3 PROVHILO 3 proves 3 Provenance 3 proton-coupled 3 Protoc 3 protein-1 3 Protas 3 Propofol-Induced 3 promyelocytic 3 promptly 3 PROMODE 3 prolongations 3 ProLong 3 prognostically 3 prognoses 3 profiled 3 Professorship 3 productive 3 Proctor 3 probabilistically 3 proangiogenic 3 prioritize 3 prioritization 3 prion-like 3 Prinz 3 principally 3 primed 3 previa 3 preventative 3 prevalences 3 prevails 3 pretransplant 3 presurgery 3 presently 3 prescriber 3 pre-postoperative 3 Preoxygenation 3 Prentice 3 Prensa 3 preneoplastic 3 Premier 3 prelabour 3 Preinjection 3 preformed 3 prefer 3 preeclamptic 3 predoctoral 3 predispose 3 predictable 3 precipitation 3 precedent 3 Prado 3 PPVs 3 Powers 3 Poulton 3 Potsaid 3 potently 3 posttreatment 3 posttraumatic 3 posttranslational 3 post-radiosurgery 3 post-race 3 postnatally 3 post-mortem 3 postinoculation 3 post-germinal 3 postfixed 3 postcontrast 3 postcode 3 postchemoembolization 3 postanesthesia 3 post- 3 possession 3 possessing 3 posits 3 positivity 3 portends 3 Portals 3 pores 3 Pooler 3 pone 3 Pompeu 3 polysomnography 3 Polyak 3 poly 3 Polunina 3 polo-like 3 Pollock 3 Polite 3 Polar 3 Pol 3 Poeze 3 Poe 3 Pocock 3 PNI 3 PNBs 3 plyometric 3 pluripotent 3 Plummer 3 Plexico 3 plethora 3 Please 3 PLCO 3 Platzer 3 Platt 3 plaster 3 planus 3 plants 3 planes 3 Placebocontrolled 3 PIVOT 3 Pitler 3 Pirbhai 3 pioneered 3 Pinder 3 Pikuleva 3 PI-induced 3 pigmentosa 3 pigmentary 3 Pigazzi 3 pig 3 Pietrement 3 Pieter 3 pieces 3 Pickard 3 PI11 3 physico-chemical 3 Photoshop 3 photographed 3 philosophers 3 Philip 3 phIGFBP-1 3 phasic 3 phase-resolved 3 phased 3 Pharmacother 3 pharmacogenomics 3 pharmacogenetics 3 PharmacoEconomics 3 pharmacodynamics 3 Pham 3 PFA 3 Peyton 3 PETCO2 3 pesticide 3 Pession 3 perturb 3 Perticone 3 Perth 3 personalised 3 persistently 3 Perrin 3 peroxisome 3 permutations 3 permutation 3 permissible 3 permanently 3 Perkins 3 perirhinal 3 Perinatol 3 Perier 3 peribronchial 3 perfused 3 per-formed 3 Percio 3 percept 3 Penninx 3 Pennington 3 Pendlebury 3 Pegelow 3 peer-to-peer 3 Peek 3 pedunculopontine 3 pediatric-specific 3 peculiar 3 pectoris 3 Pearsall 3 PDX-1 3 PDW 3 PD-1 3 pcpi 3 PcG 3 PBMC 3 Payami 3 PAX5 3 Pavol 3 Patton 3 patterning 3 Patricia 3 Patnaik 3 Patil 3 patient-based 3 path-lengths 3 path-length 3 Pathare 3 Paterson 3 paternal 3 patellofemoral 3 patella 3 patchy 3 Patchell 3 patch 3 Passtoors 3 passing 3 Pas 3 Parvathi 3 partitions 3 partition 3 particulate 3 Parsons 3 parliament 3 Parkville 3 parkinsonian-pyramidal 3 paraquat 3 paraplegia 3 paramedics 3 paramagnetic 3 Paradoxically 3 paper-based 3 Paolo 3 Panzarella 3 Pankratz 3 panic 3 panelists 3 Pals 3 Palmieri 3 Palliated 3 Palkovits 3 pale 3 palatal 3 Pakarinen 3 PAIS 3 pairing 3 Padova 3 pad 3 packed 3 p53-mediated 3 p110b 3 oz 3 oxygenated 3 oximetry 3 oxime 3 oxidizing 3 oxaloacetic 3 ox 3 ownership 3 overwhelmed 3 overseen 3 overlook 3 overhead 3 outperformed 3 Outpatients 3 out-patient 3 out-of-hospital 3 outlook 3 outlines 3 outlier 3 outlets 3 outbursts 3 Oudijk 3 Ottolini 3 Otorhinolaryngology 3 Ota 3 ot 3 OSU 3 Oster 3 osteopenia 3 osmotic 3 OSER 3 OSCCs 3 orthodenticle 3 Orrison 3 originates 3 oriented 3 organismic 3 ordering 3 orbit 3 optimism 3 oppositional 3 Opmeer 3 Opladen 3 opiate-related 3 operculum 3 opercular 3 opens 3 open-ended 3 open-angle 3 Ontogeny 3 Onkol 3 Onken 3 Ongur 3 Ong 3 one-year 3 one-tailed 3 one-quarter 3 one-carbon 3 Omri 3 Omodei 3 omics 3 omega-3 3 Olympus 3 Oliva 3 oligodeoxynucleotides 3 Oldfors 3 OL 3 ohsu 3 Ogata 3 ofhuman 3 off-line 3 officials 3 Oertel 3 OECD 3 Odyssey 3 Oda 3 occupancy 3 OC 3 obtainable 3 obscuring 3 Obeso 3 Oberlaender 3 OB 3 nystagmus 3 Nyquist 3 NV 3 Nuytemans 3 nutritionally 3 Nute 3 nulliparity 3 nudge 3 nucleotides 3 NPSA 3 notwithstanding 3 notations 3 NOTA-modified 3 nota 3 nosology 3 Northumbria 3 Northoff 3 normovolemic 3 normalised 3 Nordberg 3 non-UK 3 nontrivial 3 nonstuttering 3 non-sex-related 3 nonsense-mediated 3 nonoverlapping 3 non-ocular 3 non-natural 3 nonmedically 3 nonmedical 3 non-invasively 3 noninvasively 3 noninstitutionalized 3 noninflammatory 3 noninferior 3 noninbred 3 non-Hp 3 Non-hepatic 3 nonexistent 3 nonevent 3 nonessential 3 nondonor 3 non-commercial 3 nonclonal 3 nonclinical 3 non-chronic 3 non-abandonment 3 Non-A2E-loaded 3 Nomura 3 nominally 3 nodule 3 Noakes 3 ning 3 nigraneurons 3 Nigeria 3 Niesen 3 Niemitalo-Haapola 3 Nieman 3 Nieder 3 NICU 3 Nicola 3 Nicholls 3 Nicholas 3 nic 3 NHRs 3 NHLBI 3 NGF 3 nger 3 NF-Y 3 NFL 3 next-generation 3 newsevents 3 Newacheck 3 neuroradiologist 3 neuropsychologists 3 Neuropsychiatr 3 neuropeptides 3 neuropathologically 3 neuron-to-neuron 3 neurometabolic 3 neurologist 3 neuroinflammatory 3 Neuroimmunol 3 neurogenic 3 neurofibrillary 3 neuroethics 3 Neuroepidemiology 3 neurode-generation 3 Neuro-biol 3 neuroapoptosis 3 Neuroanat 3 neuroactive 3 neuritis 3 Neuman 3 Ness 3 Nephrology 3 Nepal 3 neovessels 3 neo-plastic 3 neo-adjuvant 3 Nemeth 3 Nemani 3 Neil 3 Negro 3 needn 3 Necela 3 Nebel 3 near-infrared 3 nearest 3 ndez 3 NCT02007044 3 NCT01190566 3 NCCN 3 navigational 3 natively 3 Nathaen 3 Natanson 3 narrow-field 3 Narendran 3 NAPamide 3 nanoscale 3 nancy 3 Nair 3 Nagpal 3 Nagasaki 3 NACP-Rep1 3 NaCl 3 Nabid 3 Naar 3 N400 3 myofibrils 3 myeloid 3 myasthenia 3 myalgia 3 mutationsin 3 mutationin 3 Museum 3 musculature 3 muscle-specific 3 Murrell 3 Munz 3 multisystem 3 multi-scale 3 multiplexed 3 multiparous 3 multiorgan 3 multimodality 3 multi-joint 3 multi-ethnic 3 multiethnic 3 Mulkern 3 mucositis 3 Mucke 3 MSH-DTPA 3 MRM 3 Mrejen 3 MRD 3 Mraz 3 MQ 3 MPTP-induced 3 MPP 3 Moy 3 mounts 3 Mountains 3 MOULDER 3 motorized 3 motoneuron 3 motivations 3 motions 3 motherhood 3 Motac 3 Moseley 3 Mortimer 3 Morse 3 Moretti 3 Moreno 3 Moreira 3 morbid 3 Morales 3 Moorthy 3 Mooney 3 Montine 3 Montebugnoli 3 monolingual 3 Mongkolwat 3 monetary 3 Monaco 3 Moll 3 Molina-Arcas 3 Moja 3 Mohsen 3 Mohamed 3 Mogensen 3 Moen 3 modulatory 3 modifiers 3 modi 3 moderate-to-vigorous 3 moderated 3 modelled 3 mobilized 3 mobilize 3 MNI 3 mMR 3 MMPs 3 MMP 3 Mme 3 MLRs 3 MK-801 3 Mizushima 3 mixing 3 mixed-effects 3 mitosis 3 Mitosciences 3 mitogen-activated 3 MIT 3 misregistration 3 Mishra 3 miscellaneous 3 Mirzaei 3 mirrors 3 miRNeasy 3 Miraux 3 Miranda 3 miR-80 3 miR-223 3 miR-217 3 miR-181b 3 miR-155 3 Ministerio 3 minima 3 Minerva 3 Minelli 3 minds 3 mimetics 3 mimetic 3 Mimecan 3 millions 3 Milligan 3 Millar 3 milestone-based 3 Miles 3 mile 3 midwives 3 midget 3 Microvasc 3 microsurgery 3 microsomal 3 microRNA-30c 3 microRNA-22 3 microplate 3 microPET 3 Microcircuitry 3 MICHNA 3 miceexpressing 3 MHC 3 mfn2 3 Meuli 3 METs 3 methylprednisolone 3 methylenetetrahydrofolate 3 methotrexate 3 Methodol 3 Metcalfe 3 metazoan 3 metalloproteinases 3 metallic 3 metachronous 3 metabolome 3 meta-analytic 3 message 3 Merkel 3 merely 3 Mennerick 3 membrane-bound 3 melting 3 Mellings 3 melanotropins 3 Melanotropic 3 Meis 3 Mega 3 Medina 3 medically-healthy 3 Mediante 3 Mechanistically 3 mechanics 3 meaningless 3 meal 3 MDT-6 3 MDT-15tm2182 3 McNaught 3 McLeod 3 McLellan 3 McKhann 3 McKee 3 McHugh 3 McGue 3 McFarland 3 McCullough 3 McCulloch 3 McCracken 3 McConkey 3 Mccoll 3 McCabe 3 Mazzola 3 maximally 3 maxilla 3 Mauro 3 Mauchley 3 maturing 3 Matteo 3 Matsuyama 3 Mathers 3 maternal-FIR 3 Masuoka 3 mastoidbone 3 Mastaglia 3 MASCC 3 Marxreiter 3 Marx 3 Marwan 3 Marucci 3 Marty 3 Mart 3 Markopoulou 3 marketed 3 Marinelli 3 Marignier 3 Mariani 3 Margaret 3 Marder 3 Marczylo 3 Marchenko 3 manuscripts 3 Mantel 3 Manitt 3 manipulated 3 maneuver 3 Managers 3 Malhotra 3 malformations 3 maleimide 3 malaria 3 malabsorption 3 Maixner 3 mainstay 3 Mahmoud 3 Maher 3 Magnusson 3 MAGMA 3 Magaziner 3 Mag 3 Maeder 3 Maeda 3 Maecke 3 Madjarov 3 MacVicar 3 maculas 3 macronutrients 3 Macro-autophagy 3 Maclean 3 MacKenzie 3 machines 3 M0 3 -Lys5-Nalpha-maleimido-Gly1-GEEEK 3 Lypson 3 Lyons 3 lymphopenia 3 Lydiard 3 LXRb 3 lutein 3 Lupi 3 Lunetta 3 Lundby 3 Lukashchuk 3 luck 3 Luciano 3 low-stakes 3 low-hanging 3 low-gain 3 lower-intensity 3 low-count 3 low-angle 3 Lovinger 3 Lovely 3 Lovell 3 Lovat 3 Lovasik 3 Lothian 3 loteprednol 3 losartan 3 Lombardi 3 logins 3 login 3 Lockwood 3 locked 3 LOCF 3 localizing 3 lobar 3 Lloyd 3 lkb1 3 Lizio 3 Livak 3 littermates 3 Litt 3 literally 3 Liston 3 Listeners 3 Lipsman 3 lipoprotein-mediated 3 lipoprotein-like 3 lipopolysaccharide-induced 3 Lipman 3 Lipid-preserving 3 lining 3 lingual 3 line-by-line 3 Lindahl-Jacobsen 3 limbus 3 Lightowlers 3 lichen 3 lib 3 LIAISONS 3 liable 3 lgyi 3 Lewin 3 levers 3 Leutner 3 leucocytes 3 Leu 3 lethargy 3 Lepage 3 Leon 3 Lennon 3 lends 3 Leithner 3 Leite 3 Leicester 3 Lefebvre 3 lecturer 3 Lebel 3 leave-one-out 3 Leary 3 leaking 3 LC-MS 3 LCAT 3 LB-like 3 LB-derived 3 layered 3 Lawton 3 Lawson 3 lavage 3 Laufs 3 Latino 3 Latin 3 Lariviere 3 laparoscopically 3 Lao 3 Lanzl 3 Lansing 3 languages 3 Langerhans 3 landmarkbased 3 Landis 3 Lamy 3 Lamont 3 laminin 3 Lamborn 3 laid 3 laggrin 3 Lafaille 3 laboring 3 Laboratoires 3 labelling 3 L8A4 3 kVp 3 Kuwahara 3 Kurt 3 Kurinczuk 3 Kuppermann 3 Kuningas 3 Kumaran 3 Kully 3 Kuchibhotla 3 Kubu 3 Kubota 3 Kubo 3 Kroh 3 Kris-Etherton 3 Kreiskrankenhaus 3 Kreis 3 Kras-induced 3 Krakauer 3 Kowalski 3 Kowalczyk 3 Koulouris 3 Kothari 3 Kostic 3 Koster 3 Kostan 3 Koreishi 3 Kopp 3 Kopnin 3 Koong 3 Koo 3 Kono 3 Kongsgaard 3 Kondo 3 Kohn 3 Kogan-Sakin 3 Kogalur 3 Knox 3 knowing 3 Knopp 3 Knol 3 knockin 3 knees 3 Knee-extensor 3 KmVp 3 KmVox 3 KML 3 Kluwer 3 Klumpp 3 Klemp 3 Kjaer 3 Kita 3 Kirchhof 3 Kinzler 3 Kinki 3 kindreds 3 Kimball 3 killing 3 Kilbreath 3 Kiernan 3 K-HT 3 Khawaja 3 Khanifar 3 kg-1 3 Keystone 3 Keypoints 3 Keyes 3 ketofol 3 Kessel 3 Kerns 3 Kergoat 3 keratoplasty 3 Kent-Braun 3 Kenna 3 Ken 3 Kelley 3 Keith 3 kCal 3 kBq 3 Kazdin 3 Kaye 3 Kawamura 3 Kavalali 3 Katzman 3 Kathiresan 3 Kataoka 3 Kasinski 3 Karlstetter 3 Karlsruhe 3 Karl 3 Karim 3 Kaposi 3 Kapadia 3 Kaneko 3 Kamath 3 Kam 3 Kalra 3 Kalloniatis 3 Kahle 3 Kabat-Zinn 3 Kaarniranta 3 K12 3 JZ 3 justifies 3 jurisdictions 3 junctional 3 Jun 3 Julian 3 judging 3 judgements 3 Ju 3 Joynt 3 Jongh 3 joints 3 jointcommission 3 Joehanes 3 Jody 3 Joachim 3 jnm 3 JMagn 3 J-M 3 Jill 3 Jesus 3 Jessica 3 Jesse 3 Jes 3 Jerusalem 3 Jemal 3 Jellinger 3 Jedidi 3 Jayanthi 3 Javoy-Agid 3 Jason 3 Janet 3 Janes 3 Janelle 3 Janeiro 3 Jamieson 3 jamapediatrics 3 Jaliffa 3 Jaillon 3 Jabbour 3 Iwamoto 3 Iwakoshi 3 Ivanov 3 Ivanisenko 3 Itokawa 3 iteratively 3 iteration 3 ISS 3 ISRCTN 3 isolevuglandins 3 isolate 3 Isobe 3 iso 3 Ishwaran 3 Ishihara 3 IRS1 3 irregular 3 IPW 3 ions 3 ionotropic 3 involuntary 3 investigativeradiology 3 inverted 3 introns 3 intratumor 3 intrarater 3 intrapatient 3 intraneurally 3 intramuscularly 3 Intramural 3 Intra-class 3 intracerebroventricularly 3 intracellularly 3 intra-assay 3 intimately 3 interviewees 3 intervene 3 interrogation 3 interrogated 3 interrater 3 interpatient 3 Internationale 3 Internat 3 internalize 3 interictal 3 interferon-alpha 3 intercollegiate 3 intercepts 3 inter-articulator 3 interactivity 3 inter 3 Insulin-stimulated 3 insufficiently 3 instrumentation 3 inspected 3 insertions 3 INSERM 3 Insel 3 insecurity 3 inquiry 3 inquiries 3 in-person 3 innovations 3 Inna 3 injector 3 inhumans 3 inheritance 3 inhabitants 3 Ingenuity 3 in-gel 3 Influenza 3 Inflamm 3 infiltrating 3 inferential 3 individuality 3 indispensable 3 Indians 3 indefinitely 3 incurred 3 increments 3 incrementally 3 increment 3 incompletely 3 incapacity 3 incapable 3 imprinting 3 impressive 3 imprecise 3 imported 3 implements 3 impetus 3 impacted 3 immunostains 3 immunologic 3 immunolocalizations 3 immunogenicity 3 immunized 3 immune-based 3 immature 3 IMIM 3 Imai 3 image-guided 3 illustrative 3 illuminating 3 iliac 3 IL8 3 IL6R 3 Ikeuchi 3 IId 3 ignored 3 IGF1 3 IF-FISH 3 ies 3 Ierino 3 IDMS 3 identifications 3 idempotent 3 Ide 3 I-CAN 3 IC50 3 IBD 3 Ibanez-Ventoso 3 Iba 3 Iatrogenically 3 iatrogenic 3 Iannetti 3 hypoxanthine 3 hypothesised 3 hypothalamo 3 hypopnea 3 hypoechoic 3 hyperscattering 3 HyperRESEARCH 3 hyperreflective 3 Hyperkinetic 3 hyperintense 3 hyperemia 3 hyperbilirubinaemia 3 hyper- 3 Hyland 3 Hygiene 3 hydroxychloroquinetoxic 3 hydrophilic 3 Hydrolysates 3 Hyde 3 hybridized 3 Hyattsville 3 HUVECs 3 Hurt 3 humerus 3 Hultman 3 hugely 3 Hugdahl 3 Huerta 3 hue 3 hub 3 huA33 3 HTRA2 3 Hsp90 3 hs-CRP 3 HRP-conjugated 3 HR2 3 HR1 3 HPA 3 How-ever 3 Howald 3 Hoving 3 Houssami 3 households 3 hotmail 3 hostile 3 hospital-level 3 hospices 3 Hoskin 3 Hoshi 3 Hornig 3 Horm 3 Horikoshi 3 Hopital 3 hop 3 Hoover 3 Honest 3 homunculus 3 homozygosity 3 homologs 3 homologous 3 homogenizer 3 homelessness 3 Holzer 3 Holmberg 3 Hollander 3 Holen 3 hole 3 Holcomb 3 Hofman 3 Hodselmans 3 Hodges 3 HMBS 3 Hlatky 3 HIV-associated 3 hits 3 hit 3 historic 3 Histopathol 3 Histol 3 Histochem 3 Hispanics 3 Hinoi 3 Hines 3 Hiner 3 hindsight 3 high-value 3 High-throughput 3 high-sensitivity 3 High-level 3 high-frequency 3 higher-intensity 3 High-energy 3 high-dose-rate 3 Hift 3 Hicks 3 Hewat 3 heuristic 3 heterozygosity 3 heterogenous 3 Hester 3 Hertz-Picciotto 3 hertz 3 Hertweck 3 Herbig 3 HER2-specific 3 Hepplewhite 3 hepatobiliary 3 Heo 3 Henneberg 3 hemorrhages 3 hemolytic 3 hemiplegia 3 Hematology-Oncology 3 helplessness 3 Hellhammer 3 Helen 3 Heiss 3 Heilman 3 HEDIS 3 hed 3 Hecht 3 Hebert 3 heavy-chain 3 Heaman 3 healthspan 3 head-to-head 3 heads 3 HDL-cholesterol 3 HDACs 3 HDAC6 3 HDAC 3 hcp 3 Haythornthwaite 3 Hays 3 Hayman 3 Hayley 3 Hasler 3 Harper 3 Harlan 3 Hariz 3 Hanumanthiah 3 Hansson 3 Hannah 3 handoff 3 Handicap 3 handheld 3 hamper 3 Hamdy 3 Hamada 3 Halilovic 3 Haley 3 hairpin 3 HA-IkBalpha 3 Hagenah 3 Hagen 3 haematological 3 Haacke 3 H3K27 3 h-1 3 Gwinn-Hardy 3 Guzzetta 3 Guyton 3 Guy 3 Gutman 3 Gungor 3 Guillaume 3 guiding 3 Guidances 3 Guertel 3 Gudenberg 3 Guarneri 3 guarantee 3 GS-101 3 Gruppen 3 groundwork 3 grossly 3 grocery 3 Gripp 3 GRIN1 3 Griffith 3 Grif 3 Greenland 3 Greenburg 3 Greenamyre 3 Gravenstein 3 Graphics 3 graphically 3 graphic 3 Grajciar 3 grafted 3 graduation 3 grader 3 Grad 3 Grace 3 Gow 3 government-sponsored 3 governments 3 Gotzinger 3 Gottingen 3 got 3 Goris 3 Gorbatyuk 3 goods 3 Goo 3 gone 3 Goldschmidt-Clermont 3 goldfish 3 Golbe 3 Gogna 3 Goffman 3 Goetz 3 Goebeler 3 GN 3 glycol 3 glycogenoses 3 glycogen-dependent 3 glycine 3 GluN1 3 glucuronide 3 Glover 3 Glimmix 3 Glick 3 Glasser 3 Giovannini 3 Giovannantonio 3 Gillies 3 Gielen 3 Giblin 3 Gianotti 3 Giacaman 3 Ghika 3 Ghai 3 Ghaderi 3 gestures 3 Gerlach 3 geometrical 3 Geoffrey 3 Gentschew 3 genotype-dependent 3 genistein 3 gene-specific 3 generalised 3 Gendlin 3 genders 3 Geier 3 Geffen 3 GDS-15 3 GBMs 3 gaze 3 Gawryl 3 Gauthier 3 Gautam 3 Gault 3 Gaudio 3 Gatti 3 Gatidis 3 Gasparini 3 Garne 3 Garland 3 Garg 3 Garcia-Larrea 3 Garagnani 3 Gale 3 Gaietta 3 Gaedcke 3 gadolinium-enhanced 3 GADD34 3 GABAA 3 Ga-68 3 G61 3 G51D 3 Futures 3 Furie 3 fur 3 fungi 3 funders 3 funder 3 fundamentals 3 fundal 3 Funct 3 Funayama 3 Funakoshi 3 Fulton 3 full-text 3 fullness 3 FSC 3 frustration 3 Frost 3 frontier 3 Friston 3 Friel 3 Friberg 3 Frew 3 Freitag 3 free-standing 3 fragmented 3 fractured 3 FP 3 FOXO3 3 Foschini 3 Fortunately 3 Forte 3 fornix 3 Forman 3 formalin-free 3 formalin-fixation 3 formaldehyde 3 forefront 3 Forchheim 3 Fontemaggi 3 Fontana 3 Fondazione 3 Foltynie 3 Folia 3 folates 3 FO 3 Flynn 3 fly 3 fluoxetine 3 fluorescently 3 fluorescence-guided 3 FluencyDisorders 3 flowtrace 3 flow-mediated 3 flora 3 floors 3 flex 3 Flash 3 flag 3 fIVIMmono 3 Fitzsimmons 3 Fitzpatrick 3 fishing 3 first-degree 3 FIR 3 Finnish 3 Finnell 3 Finkelstein 3 Fink 3 fine-needle 3 filtering 3 film 3 Filippo 3 filamentous 3 Figure3A 3 Figure1F 3 Figure1E 3 Figure1D 3 figurative 3 Figueroa 3 Figarska 3 Fifty-seven 3 Fiedler 3 fhet 3 Feudtner 3 fertilisation 3 ferric 3 Ferri 3 Ferreri 3 Ferrer 3 Ferrell 3 fenestrae 3 feels 3 fee-for-service 3 feeds 3 feed-back 3 Fee 3 Fedorow 3 fecal 3 fearful 3 FDML 3 FDG-PET 3 FD 3 FcyRIIIa 3 FCCP 3 faxed 3 Faul 3 fat-5 3 fastest 3 fascinating 3 Fas 3 Farsiu 3 fare 3 Fang 3 false-positive 3 Fairchild 3 Fairbanks 3 faint 3 FAc-treated 3 factor-I 3 factor-beta 3 Fabrication 3 fabricated 3 Fabra 3 Fabbri 3 F344xBN 3 F2 3 F12 3 eyeblink 3 ey 3 exudates 3 extubated 3 extraordinarily 3 extra-hepatic 3 extrahepatic 3 externalizing 3 exterior 3 exposing 3 expose 3 explosive 3 explosion 3 ExploreDTI 3 exploit 3 expired 3 expands 3 expanders 3 exogenously 3 exocytosis 3 exited 3 exhibition 3 exerting 3 exemplifies 3 execute 3 excitotoxicity 3 excessively 3 exceptionally 3 examiners 3 Evol 3 evidences 3 Evers 3 everolimus-eluting 3 Evaluative 3 evaluates 3 Euthanasia 3 europa 3 Eunice 3 etiopathogenesis 3 ethylene 3 ESSR 3 essentials 3 Espinoza 3 esophageal 3 Esch 3 escalation 3 erythrocyte 3 ERT 3 Eric 3 erence 3 equates 3 equated 3 equate 3 Epworth 3 e-pub 3 Epplen 3 epineurium 3 epileptiform 3 ephedrine 3 EOC 3 envisioned 3 environ-mental 3 entropy 3 Entrenched 3 entirety 3 entertainment 3 enterocytes 3 enteral 3 entails 3 ENS 3 enrol 3 enhancers 3 Engraved 3 English-language 3 Engelman 3 energy-dependent 3 enduring 3 end-tidal 3 ends 3 end-products 3 endo-thelial 3 endoscopy 3 endorsing 3 endocardial 3 Endo 3 encephalocele 3 emptied 3 empower 3 emphysema 3 emphasise 3 Emory 3 Emmanouilidou 3 emergent 3 embraced 3 embolic 3 Eltchaninoff 3 Elstner 3 ElSharawy 3 Elkassabany 3 elegantly 3 electrophysiological 3 electrophysiologic 3 electrons 3 electromagnetic 3 electroencephalography 3 Electroencephalogr 3 electroconvulsive 3 elect 3 Eldred 3 Elbaz 3 elapsed 3 Eklund 3 Eisai 3 Eira 3 Eindhoven 3 Eikelboom 3 Eij 3 Ehrlich 3 eggers 3 EED 3 Edouard 3 EDIC 3 Edelman 3 ectopic 3 ective 3 ected 3 EC-rich 3 Economy 3 echo-planar 3 EC-enriched 3 Eby 3 Ebmeier 3 ears 3 earnings 3 Eapen 3 E6 3 DZ 3 dyskinesia 3 dysfunctions 3 dynamical 3 dying 3 dyes 3 DY 3 Dwyer 3 Duvekot 3 Dupont 3 Dunton 3 Dunn 3 Dunlop 3 Duncker 3 Duker 3 Duff 3 DTPA 3 DSM-IV-TR 3 DSM-III 3 DSM 3 DSL 3 DSA 3 Drummond 3 drug-development 3 drowsiness 3 Drouin 3 dried 3 Drasdo 3 drain 3 Dragostinoff 3 drag 3 DPvdH 3 DPBS-T 3 Dp116 3 Doz 3 Downs 3 downloads 3 Downing 3 doubling 3 double-mutated 3 double-labeled 3 Dotti 3 dose-matched 3 dose-escalation 3 dose-effect 3 dopa-responsive 3 door 3 donor-specific 3 Donnell 3 Donnan 3 Donato 3 donated 3 Dominguez 3 dominates 3 dominate 3 dominant-negative 3 domestic 3 domain-containing 3 Domagala-Kulawik 3 Dollaghan 3 Dohner 3 dogs 3 Dodson 3 doctrine 3 Docosahexaenoic 3 docetaxel 3 Dobson 3 dizzy 3 Dittmer 3 disuse 3 distribute 3 distinguishes 3 dissertation 3 Dissen 3 Dissecting 3 disrupting 3 dispersed 3 disparity 3 Diserens 3 discriminatory 3 discourage 3 discounted 3 discontinuing 3 discernible 3 discectomy 3 directionality 3 dip 3 diodes 3 dinucleotide 3 dimly 3 Dimitri 3 dimensionless 3 dimeglumine 3 DiMauro 3 DiMaggio 3 Dikranian 3 dificulties 3 difference-in-differences 3 Diestel 3 Dierks 3 didn 3 dictated 3 dictate 3 Dickstein 3 Dichgans 3 diathesis 3 Diarrhoea 3 Diantha 3 diagnostically 3 diagnosis-specific 3 Diab 3 Dhabhar 3 dexterity 3 devoid 3 deviated 3 Devereaux 3 Deutsch 3 detailing 3 destructive 3 destinations 3 destabilizing 3 designations 3 Desgrosellier 3 Derm 3 derives 3 Derikx 3 depressives 3 Depress 3 deployment 3 deplete 3 depicts 3 de-novo 3 denoted 3 denominators 3 Denis 3 denial 3 denervation 3 Democratic 3 Delwart 3 delinquency 3 deliberation 3 dehydrated 3 Dehay 3 defiant 3 DECT 3 decongestant 3 decision-analytic 3 Decis 3 decides 3 decay-corrected 3 Dec 3 debatable 3 Deans 3 dealing 3 deacetylation 3 deacetylases 3 DDR 3 DDCT 3 day-1 3 Davison 3 Davila 3 Datar 3 dashed 3 Danis 3 Dan 3 dampen 3 Damme 3 damages 3 Dalton 3 Dal 3 Dahlgaard 3 Dadelszen 3 Dacheux 3 Czeh 3 cytosolic 3 cytoskeletal 3 cytometer 3 cytochromes 3 cystoscopy 3 CYP7A1 3 CYP 3 cylindrical 3 Cyberonics 3 Cybernetics 3 CXCL12 3 currents 3 Curie 3 cured 3 curcumin 3 Cunningham 3 Cunha-Vaz 3 Cumming 3 CTRS 3 CTL 3 CSC 3 cryoprotectant 3 crucially 3 cross-talk 3 crosses 3 Crosiers 3 Crosby 3 Criqui 3 Creeley 3 credibility 3 credence 3 Creactive 3 CRD42012003035 3 Cras 3 cran 3 CPI 3 CpG 3 Coyne 3 Coyle 3 Cowan 3 Covey 3 coverings 3 co-varying 3 covaried 3 covalently 3 Couto 3 Courneya 3 couple-based 3 counterbalanced 3 counteracted 3 Cotton 3 Cotrufo 3 cotreatment 3 Coto 3 Cote 3 Costes 3 Costello 3 COSTART 3 COSMIN 3 cosine 3 Coscas 3 Cortopassi 3 Correia 3 Correcting 3 coronaryheart 3 corollary 3 Corning 3 Cornelis 3 Corey 3 cores 3 Coppede 3 coordinators 3 coordinative 3 Coon 3 cooling 3 cool 3 Cookson 3 Conway 3 convex 3 converse 3 convention 3 convalescence 3 controversies 3 controllers 3 contrasted 3 contracting 3 contingency 3 continental 3 contextrelated 3 contentious 3 contention 3 Contaminating 3 containers 3 contacting 3 consultants 3 ConsultanteAllergan 3 Constable 3 Conspicuously 3 Consort 3 connexins 3 Conneely 3 connect 3 Congo 3 Cong 3 configurations 3 confident 3 cone-driven 3 cone-dominant 3 conductivity 3 conducive 3 concur 3 concluding 3 concert 3 computer-based 3 compromising 3 comprehend 3 complicating 3 complemented 3 complementation 3 complementarity 3 complain 3 co-morbidity 3 community-acquired 3 commodity 3 committing 3 commit 3 commenced 3 Comm 3 comb 3 coma 3 Colvin 3 colors 3 Colony 3 Colombo 3 Colloid 3 collegiate 3 colleagues1 3 collaterals 3 collapse 3 collagenase 3 collaborators 3 collaborating 3 coli 3 Colcher 3 co-intervention 3 coincident 3 Coenen 3 cochrane-handbook 3 coauthors 3 c-Myc 3 CMVECs 3 cmH2O 3 cm3 3 clubs 3 clinician-administered 3 client 3 clicking 3 Clermont 3 cleavage-stage 3 clearer 3 ClearCanvas 3 classically 3 classed 3 Claire 3 Civilian 3 cisplatin 3 Cisler 3 circumferential 3 CIpat 3 cigars 3 cient 3 Ciencia 3 Cicero 3 cicatricial 3 CIBERNED 3 Chuang 3 Chua 3 Christopher 3 Christiansen 3 chorioretinopathy 3 choriocapillaries 3 cholinesterase 3 cholesterol-lowering 3 Cholesterol-24S-hydroxylase 3 chloroform 3 Chitnis 3 chimeric 3 Childs 3 Chicas 3 Chiba 3 Cheresh 3 Cheney 3 Chenevert 3 chemoresistant 3 chelate 3 checkpoints 3 checking 3 cheapest 3 Chau 3 charging 3 character 3 Channin 3 Chaiworapongsa 3 chairman 3 chaired 3 Chai 3 CH3CN 3 CGH-array 3 CFTR 3 certificates 3 Cephalalgia 3 centroids 3 centroid 3 centenarian 3 Cense 3 cellulitis 3 cell-specific 3 cell-flare 3 cell-cycle 3 CEACs 3 CEAC 3 CEA 3 CD86 3 CD68 3 CD452133 3 CD36 3 CD34 3 CBa1w 3 caveat 3 Cava 3 caudate 3 cauda 3 Catt-Research-Group 3 cattle 3 catheters 3 catecholaminergic 3 catalyzes 3 Castrucci 3 caspase-cleaved 3 carve-in 3 Caruso 3 cart 3 Carretta 3 Carmichael 3 Carmack 3 Carlin 3 Carleton 3 carfilzomib 3 CAREN 3 cared 3 Cardona 3 Cardo 3 cardiovas-cular 3 cardiotoxicity 3 Cardiopulm 3 cardiomyocyte 3 carci-noma 3 carbamylation-derived 3 Car 3 capped 3 capillarization 3 Cape 3 cannula 3 candies 3 Campo 3 Campinas 3 cAMP-dependent 3 calpain-dependent 3 calorimetry 3 Callaghan 3 Calin-Jageman 3 calibrators 3 CALGB 3 calendars 3 Caledonian 3 Caldes 3 Calder 3 calculus 3 calculi 3 Calam 3 Cairo 3 cage 3 CAFs 3 CACTI 3 caac 3 CA016672 3 C677T 3 C57 3 C3H 3 C2 3 Byrnes 3 BV 3 buy-in 3 buy 3 butyrate 3 Butcher 3 Bushnell 3 burst 3 Bukhari 3 build-up 3 Buggy 3 Buganim 3 buffering 3 Buckley 3 Buckinghamshire 3 Buchem 3 BTZ-Induced 3 Bryant 3 Bruneau 3 Brull 3 Bruin 3 Bruder 3 Bruchez 3 Brotman 3 Brosh 3 Brookes 3 Brock 3 broadened 3 Britain 3 Brisbane 3 Brinkmann 3 bridge-cyclized 3 Brice-style 3 Brevern 3 bregma 3 Breeman 3 breed 3 bred 3 breast-conserving 3 breakthrough 3 breaking 3 break 3 BRCA 3 Bray 3 Bravo 3 Braun 3 Brandt 3 Brammer 3 Brambrink 3 Brakenhoff 3 brainwashing 3 Braggio 3 Bradlow 3 Braakhuis 3 Bowman 3 Bower 3 Bovell 3 Bove 3 Bouter 3 Bourgeois 3 Bourdel-Marchasson 3 Bouma 3 Bougeard 3 bothersome 3 Botella 3 Bosaleh 3 bonds 3 bonding 3 Bollob 3 Bolam 3 BOHUI 3 Bogod 3 Bogers 3 Bogels 3 Boey 3 Boetes 3 bodybuilders 3 Boddeke 3 Boberg 3 board-certified 3 Blvd 3 Bluhmki 3 blues 3 blood-retinal 3 blom 3 Bloemenkamp 3 blockades 3 Blanc 3 Biswal 3 bispecific 3 Biotechnol 3 Biophysics 3 Biolimus-Eluting 3 BioLegend 3 Biogerontology 3 Bioethics 3 biochemically 3 bins 3 Binetti 3 billings 3 billing 3 bilinear 3 biliary 3 bigger 3 bifurcation 3 Bianchi 3 Bhuiyan 3 Bhattacharya 3 Bhatt 3 Bhatia 3 BH4 3 between-within 3 between-region 3 Betts-Henderson 3 BET 3 best-case 3 Berson 3 Berrocal-Zaragoza 3 Bernardes 3 Berman 3 Berglund 3 Berde 3 Ber 3 benzamide 3 Benz 3 Bent 3 Benowitz 3 BEN-JOSEPH 3 Benjamini 3 Beneyto 3 benefit-to-risk 3 Bendor 3 benckiser 3 benchmark 3 Bella 3 belief 3 Belfort 3 Beissert 3 Beijing 3 Behrman 3 Behar-Cohen 3 Beg 3 Beek 3 Beckmann 3 Beaver 3 Beaudet 3 Beauchamp 3 Beatson 3 Beasley 3 Bea 3 Bayersdorfer 3 Baumeister 3 bats 3 baths 3 Bastien 3 Bass 3 Baskys 3 Bartres-Faz 3 Barsan 3 Barnsley 3 Barkil-Oteo 3 Bargonetti 3 barely 3 Bare 3 Bard 3 Barbaresi 3 Bannister 3 bankruptcy 3 band-pass 3 banality 3 Bamberg 3 Baloyannis 3 -Ballart 3 Ballard 3 Balkom 3 Baldini 3 Balafkan 3 Balady 3 Bal 3 Bailey 3 Bahgat 3 Badalona 3 b-actin 3 backscatter 3 backflow 3 Bachur 3 Babiker 3 Azeredo 3 Aydin 3 A-W 3 Avraham 3 averted 3 Availableat 3 autopsy 3 autophagosomes 3 autophagosome 3 autologous 3 authorised 3 authentic 3 auspices 3 augments 3 Auger 3 Audiol 3 Auburger 3 Attwell 3 attractiveness 3 attitude 3 attenuations 3 attenuation-matched 3 Attendance 3 ATRA 3 Atlases 3 Athanassiadou 3 asylum 3 AstraZeneca 3 Asterisks 3 assuring 3 assured 3 assessors 3 assessable 3 assemble 3 Assaraf 3 aspirating 3 Asmundson 3 Asleh 3 Aslam 3 Asklepios 3 Asklepieion 3 Asians 3 Ashizawa 3 aseptic 3 ascribed 3 ARVO 3 articulatory 3 articulation 3 arteriovenous 3 ARs 3 Arroyo 3 arrhythmia 3 arousal 3 Aronson 3 Arn 3 Arlington 3 Arkadiy 3 arisen 3 arduous 3 archiving 3 archives 3 architectural 3 Arbuckle 3 arborize 3 arborizations 3 arborization 3 Araujo 3 Arai 3 aprospective 3 appreciable 3 appraise 3 applicants 3 appended 3 apoB-lipoproteins 3 APL 3 aphakia 3 Aperio 3 Apeldoorn 3 APC-EGFP 3 Aoun 3 anywhere 3 anymore 3 anxiety-related 3 Anvret 3 antithymocyte 3 anti-SM-22alpha 3 antiserum 3 antirabbit 3 anti-proliferative 3 antioxidative 3 anti-oxidant 3 anti-insulin 3 antigenic 3 anti-chimeric 3 antibody-negative 3 antibody-mediated 3 anti-atherogenic 3 anti-135b 3 anthropomorphic 3 anthropometry 3 anthropometric 3 anthropological 3 anteriorly 3 antecubital 3 answering 3 Anne 3 ankyrin 3 Anitschkow 3 anisotropic 3 Anisman 3 angry 3 Angold 3 angioplasty 3 angiomatous 3 angioma 3 aneurysm 3 andtheir 3 andthe 3 Andre 3 Andolfatto 3 andcardiovascular 3 anastomosis 3 anaplastic 3 Analgetic 3 amputated 3 AMP-to-ATP 3 amplifies 3 amounted 3 amorphous 3 Amoroso 3 aminotransferase 3 Amin 3 Amico 3 AM-FM 3 amelioration 3 AMED 3 Ambion 3 ambient 3 Alzheimer0s 3 Alt 3 alphavbeta5 3 alpha-subunits 3 alpha-melanotropin 3 Alonso 3 Almkvist 3 allometric 3 Allison 3 alleviated 3 allergic 3 Aliza 3 Aliquots 3 alike 3 Alfredson 3 alfentanil 3 Alexandros 3 Alexandria 3 alert 3 Aleman 3 Aldape 3 albuminuria 3 albipunctatus 3 Alberto 3 Alberta 3 Albanese 3 Alba 3 Alanine 3 al7 3 al43 3 al1 3 Akker-Scheek 3 Akademie 3 aisle 3 airways 3 Ahringer 3 Ahmad 3 Ahlskog 3 Ago2 3 agitated 3 aggressively 3 aggregations 3 aggravated 3 afterhyperpolarization 3 AFM 3 afford 3 a-fetoprotein 3 aetiological 3 Aebischer 3 advise 3 adversity 3 AD-specific 3 adoptive 3 Admixture 3 admitting 3 Admittedly 3 admits 3 admit 3 adjudication 3 ADInstruments 3 adhesions 3 adherens 3 ADFs 3 adenylate 3 adenovirus 3 adenosine-stress 3 adenocarcinomas 3 ADEM 3 adducts 3 adduction 3 ADCmono 3 ADCC 3 acylcarnitine 3 activeness 3 activators 3 acted 3 acronym 3 ACRIN 3 ACOG 3 Acknowledgement 3 acinar 3 achieves 3 achievements 3 Ac-dLys2 3 accreta 3 accommodates 3 accelerations 3 accelerating 3 accelerates 3 accelerate 3 Acampora 3 academia 3 Abtahi 3 abstr 3 absorptiometry 3 absorbs 3 Absenger 3 abrogation 3 Abratte 3 abovementioned 3 aberrations 3 aberrantly 3 Abecasis 3 abbreviation 3 abbreviated 3 Abajian 3 Aaronson 3 Aandahl 3 A431 3 A2-E 3 A18T 3 A179 3 9th 3 99mTc-labeled 3 998 3 996 3 995 3 9863 3 984 3 982 3 977 3 9746 3 961 3 957 3 954 3 952 3 951 3 9500 3 948 3 942 3 935 3 931 3 930 3 928 3 91-9 3 90th 3 907 3 906 3 905 3 901 3 8-channel 3 89Zr-labeled 3 897 3 896 3 894 3 891 3 886 3 881 3 876 3 873 3 872 3 86Y-DOTA-Re 3 869 3 865 3 862 3 854 3 846 3 845 3 8447 3 838 3 836 3 833 3 830 3 827 3 819 3 812 3 809 3 800CW 3 8000 3 7-year 3 7-dehydrocholesterol 3 794 3 788 3 774 3 773 3 770 3 762 3 758 3 757 3 750 3 745 3 744 3 742 3 741 3 732 3 730 3 729 3 726 3 708 3 703 3 6-well 3 6mm 3 6-diamidino-2-phenylindole 3 697 3 692 3 68Ga-DOTA-Re 3 689 3 684 3 679 3 676 3 674 3 666 3 658 3 648 3 634 3 629 3 628 3 625 3 621 3 6-20 3 611 3 6032 3 601 3 5-year-old 3 5-point 3 5-mm 3 5beta 3 5alpha-androstan-3beta-ol 3 599 3 596 3 593 3 585 3 579 3 5-7 3 566 3 5500 3 546 3 544 3 5-3 3 52242 3 5-1 3 50-fold 3 4-year 3 4-mm 3 4-Guanidinomethyl-3-Iodobenzoate 3 4F 3 498 3 490 3 486 3 476 3 474 3 463 3 4-6 3 4-5 3 43-49 3 4204 3 408 3 3to 3 3-T 3 3-s 3 3H 3 3F 3 3b-hydroxyl 3 396 3 37C 3 3322 3 3303 3 31-40 3 30UTR 3 3050 3 30-40 3 2-to 3 2-month 3 2mm 3 2-lesion 3 2I 3 2Department 3 29- 3 2804 3 2664 3 2616 3 25-hydroxy-vitamin 3 2543 3 2539 3 2516 3 24S-hydroxycholesterol 3 24-month 3 24-hydroxylase 3 2417 3 2-4 3 2349 3 2323 3 2117 3 -21 3 20min 3 20lm-thick 3 2083 3 2059 3 2013-4060 3 2011-2013 3 2010-2012 3 2009-2011 3 2007-2012 3 2004b 3 2004a 3 2004-05 3 200-206 3 2001a 3 2000s 3 1University 3 1-Pb-Ph 3 1ng 3 1-h 3 1beta 3 1BD 3 1and 3 1-a 3 1999a 3 19-9-7 3 19-9-0 3 1970s 3 1961 3 1960s 3 1959 3 1953 3 1950s 3 1948 3 1942 3 1940 3 1921 3 1914 3 19104 3 1906 3 1904 3 1-9 3 18S1 3 18F-FB 3 1829 3 1821 3 1820 3 1812 3 1805 3 1-8 3 1797 3 1796 3 1783 3 1759 3 1745 3 1739 3 17-22 3 16-fold 3 1640 3 16-22 3 1621 3 1617 3 1616 3 1605 3 1601 3 15-year-old 3 15-kDa 3 1599 3 1595 3 1594 3 1585 3 1563 3 1543 3 1536 3 1532 3 15292 3 1518 3 15-17 3 150-kDa 3 1503 3 1497 3 1487 3 1485 3 1473 3 14651858 3 1464 3 1459 3 1450 3 1433 3 1423 3 1414 3 1410 3 -14 3 1392 3 1385 3 1380 3 1375 3 1365 3 1364 3 1354 3 1344 3 1334 3 1327 3 1321 3 131I-SGMIB 3 1313 3 -13 3 1284 3 1270 3 1266 3 125I-Tyr2 3 1259 3 1250 3 1243 3 1242 3 1241 3 123I 3 1239 3 1235 3 1232 3 1221 3 12-15 3 1206 3 1202 3 -12 3 11-point 3 11beta-hydroxysteroid 3 11A1 3 1197 3 1196 3 1195 3 1192 3 1191 3 1171 3 1164 3 1159 3 1150 3 1143 3 1141 3 1139 3 1135 3 1131 3 1128 3 111In-labeled 3 111In-DOTA-GlyGlu-CycMSH 3 1110 3 1107 3 1106 3 1101 3 1100 3 1099 3 1092 3 1088 3 1082 3 1068 3 1065 3 1062 3 10-59 3 1058 3 1044 3 1041 3 1037 3 1027 3 1026 3 1025 3 10-2 3 1005 3 1003 3 0-T 3 0-fold 3 075 3 074 3 0661 3 057 3 056 3 054 3 053 3 050 3 045 3 0306 3 015 3 0125 3 0124 3 0091-6331 3 0085 2 zygosity 2 Zweckstetter 2 Zwahlen 2 Zurayk 2 Zubieta 2 Zubicaray 2 Zuber 2 zT 2 ZQ 2 zorg 2 Zoonotic 2 zona 2 Zometa 2 Zoledronate 2 zip 2 Zimmet 2 Zimmer 2 Zikria 2 Zigmond 2 Zhuo 2 ZHT 2 Zhai 2 ZG 2 z-flying 2 Zerdoumi 2 Zeller 2 Zelcer 2 Zeitz 2 Zeit 2 Zeimer 2 Zeile 2 Zeiher 2 Zeglis 2 Zed 2 Zech 2 Zecchin 2 zeaxanthin 2 zdova 2 Zaykin 2 Zautra 2 Zaun 2 Zarranz 2 Zantwijk 2 Zange 2 Zang 2 Zamora 2 Zambon 2 Zalos 2 Zalesky 2 Zald 2 Zak 2 Zajicek 2 Zaina 2 Zahi 2 Zagzag 2 Zafarmand 2 Zachwieja 2 Zabel 2 ZA 2 YX 2 Yuson 2 Yurasov 2 Yun-Lin 2 Yuki 2 Yueh 2 Yudkowsky 2 yttrium 2 Ysseldyke 2 YP 2 Younis 2 youngsters 2 young-old 2 Youdim 2 Yoshii 2 Yongjie 2 Yong 2 Yoder 2 YK 2 Yip 2 Yilmaz 2 Yih 2 Yeung 2 Yehia 2 Yeh 2 Yee 2 Yeatman 2 yeasts 2 Yau 2 Yatagai 2 Yasuda 2 Yarden 2 Yarasheski 2 Yanyali 2 Yano 2 Yankeelov 2 Yanget 2 Yanez 2 Yancey 2 Yanagisawa 2 Yanagihara 2 Yamauchi 2 Yamatoji 2 Yamasaki 2 Yamaoka 2 Yamano 2 Yamanari 2 yahoo 2 YAG 2 Yaffe 2 Yablon 2 Y2-Y1 2 y2 2 xylazine 2 XY 2 XXIII 2 X-rays 2 xml 2 Xing 2 XIENCE 2 Xiao-Yan 2 Xiao 2 xerostomia 2 xenotransplanted 2 Xbp1s-silenced 2 XBP1s-P326R 2 Xbp1slow 2 Xbp1s-driven 2 XBP1-L167I 2 WZ 2 Wynn 2 Wyman 2 Wylie 2 Wyatt 2 Wuyam 2 wustl 2 Wurst 2 Wrigley 2 Wright-Giemsa 2 wraps 2 wrapping 2 Wragg 2 Woyach 2 worry 2 work-up 2 workstation 2 workspace 2 workloads 2 worker 2 wore 2 Worcester 2 Woolsey 2 Woolf 2 Wood-Kaczmar 2 Woodall 2 Wonshik 2 women-based 2 Wolfson 2 Wolfensberger 2 Wolch 2 Wojtaszewski 2 Wojdyla 2 Woiski 2 WML 2 WMHs 2 WMFT-FAS 2 Witwer 2 Wittenberg 2 Witteman 2 witnessed 2 Witkovsky 2 withstand 2 withParkinson 2 within-individual 2 withdraw 2 withAMD 2 wissenschaftlichen 2 Wisniewski 2 wishful 2 Wisely 2 Wisconsin-Madison 2 Wis 2 wiring 2 wires 2 wiped 2 Winton 2 Wingerchuk 2 Winckel 2 Winblad 2 Williston 2 Willingham 2 Williamson 2 Willem 2 Willekes 2 Wilcock 2 Wikvall 2 Wijck 2 Wiig 2 Wierzbicki 2 Wien 2 Wiegmann 2 Wiebking 2 widths 2 Widner 2 wide-spread 2 wide-ranging 2 widened 2 widefield 2 wide-angle 2 Wibom 2 Whyte 2 wholly 2 Whitland 2 Whitener 2 White-matter 2 Whitehouse 2 whisker 2 whichever 2 wherein 2 Wharton 2 WFNS 2 WFN 2 Weymuller 2 Wexler 2 Wetzel 2 Westphal 2 Weston 2 Wessa 2 Wernicke 2 Werfel 2 Wenzl 2 Wentzel-Larsen 2 Wennberg 2 Wenger 2 Welsh-Bohmer 2 well-tolerated 2 well-rounded 2 well-educated 2 well-developed 2 Weismann 2 Weiser 2 Weis 2 Weinitz 2 Weinger 2 Weiller 2 Weihofen 2 weight-loss 2 Weigert 2 wearing 2 wean 2 Waxman 2 wax 2 Wavre-Shapton 2 wavelength-tuning 2 Waugh 2 Watroba 2 wastes 2 waste 2 Wassle 2 washout 2 Wary 2 Ware 2 Warden 2 Wardemann 2 Waraich 2 wants 2 Wanson 2 Walters 2 Walt 2 Walston 2 Walser 2 Walmsley 2 Wallman 2 Wallenstein 2 Walker-Warburg 2 Waldmann 2 Walden 2 Walczak 2 Wako 2 waking 2 Wakana 2 wages 2 Wagenknecht 2 wa36 2 w90 2 w75 2 w70 2 w500 2 w50 2 w40 2 Vugt 2 v-Src 2 Vrtiska 2 Vroman 2 Vrabec 2 voxelwise 2 Vowles 2 voting 2 Votaw 2 Votavova 2 volunteered 2 Volles 2 Volkow 2 Volinia 2 volar 2 Vojtekova 2 Vogiatzi 2 Voges 2 Vogell 2 Vogalis 2 vocational 2 Vles 2 Vlag 2 v-Jun 2 vitrectomized 2 Vitkin 2 Vitevich 2 vitelliruptive 2 vitelliformmacular 2 vitally 2 Vitality 2 visuospatial 2 visuomotor 2 visfatin 2 Visentini 2 virulent 2 virologic 2 Virmani 2 Virchows 2 Vinukonda 2 Vincow 2 Vina 2 Villwock 2 Villiger 2 Villa 2 Vilela-Filho 2 Viewpoints 2 Vieregge 2 videofluoroscopies 2 Vidal 2 Victorian 2 vibration 2 VG 2 VF 2 Vetter 2 Vetrugno 2 Vestling 2 vesicular 2 Vescovi 2 Verzar 2 vertically 2 vertebrae 2 vertebra 2 Verstappen 2 Versace 2 Verrall 2 Veronique 2 Veronica 2 Verkerk 2 veritable 2 Verhagen 2 Verhaegh 2 Verburg 2 verbally 2 verapamil 2 Veprintsev 2 venules 2 Venturelli 2 Ventromedial 2 ventricles 2 ventilation-perfusion 2 ventilated 2 Velthoven 2 Velotron 2 Vellai 2 Veletza 2 Velden 2 Velazquez 2 Vekrellis 2 vehicle-treated 2 Vectorial 2 VB 2 vault 2 Vats 2 Vasto 2 vastly 2 vasopressors 2 vasodilator 2 vasculopathy 2 Vasconcelos 2 Vartiainen 2 Varma 2 Varley 2 variegate 2 variable-oriented 2 variabilities 2 Vargas-Rojas 2 Vantage 2 Vanryckeghem 2 Vannini 2 vanLieshout 2 Vangalen 2 Vaneycken 2 VanderLaan 2 VandenBoom 2 VandenBerg 2 valvular 2 Valkema 2 Valkama 2 validates 2 Valenzuela 2 Valenciana 2 Valades 2 val158met 2 Vakifahmetoglu-Norberg 2 Vaisid 2 Vaishnav 2 Vaisar 2 Vainionp 2 Vahter 2 Vagnoni 2 Vage 2 vagal 2 vacuo 2 vaccination 2 V9 2 v5 2 V2014 2 v2 2 UZ 2 UWQOL 2 UW 2 utoronto 2 utilisation 2 Uswatte 2 U-shaped 2 useless 2 USDo 2 USD 2 US-based 2 Urogynecology 2 Urogynecol 2 URLhttp 2 urges 2 urgently 2 Urena 2 URCA 2 Urbanisation 2 Urano 2 up-stream 2 Upston 2 Upstate 2 uprisings 2 upregulating 2 uppermost 2 upper-ipsilateral 2 Upper-body 2 uphs 2 Upadhyay 2 unwanted 2 unveiled 2 unused 2 untranslated 2 unsustainable 2 unsuspected 2 unsurprising 2 unstructured 2 unspecific 2 Unsedated 2 unscreened 2 unsaturated 2 unresponsive 2 unrecombined 2 unrecognized 2 unprotected 2 unmet 2 unmeasured 2 unmasked 2 unmarried 2 unload 2 unknowingly 2 University-iMinds-IBiTech 2 university-affiliated 2 Universite 2 Unity 2 unintentionally 2 unimportant 2 unimelb 2 uniformity 2 unidentified 2 UNICEF 2 unforeseen 2 unfold 2 unexposed 2 unemployment 2 undoing 2 undifferentiated 2 undiagnosed 2 underway 2 underused 2 under-reported 2 underpin 2 under-performance 2 under-estimated 2 undeniable 2 uncouples 2 unconditional 2 uncinate 2 unchallenged 2 unavailability 2 unanticipated 2 unaltered 2 unaccounted 2 umol 2 umn 2 umich 2 Umezaki 2 Umea 2 umbilicus 2 Ultravist 2 ultrashort 2 ultra-high-speed 2 ultraendurance 2 ulceration 2 ulcer 2 UL1 2 UKOSS 2 Ukai 2 -UK 2 Uitti 2 uitkomst 2 uid 2 Ugarte 2 Ueda-Arakawa 2 Ueber 2 UCSD 2 Uchimaru 2 Uchikado 2 Uchida 2 ubiquitously 2 ubiquitinated 2 u2 2 u1 2 U01 2 -U 2 Tz-to-mAb 2 Tz-to-A33 2 Tzoulaki 2 Tzeitlin 2 typified 2 type-specific 2 type-1 2 TXtr-based 2 Two-stage 2 two-part 2 Twinkle 2 twice-weekly 2 Twenty-year 2 Twenty-two 2 Twenty-three 2 Tween-20 2 TV3 2 Tuszynski 2 Turpin 2 Turnham 2 Turku 2 Turkey 2 Turin 2 turbo 2 Tuohy 2 tuning 2 Tunik 2 tuned 2 tune 2 tumoral 2 Tulsa 2 Tulder 2 Tufail 2 tuberous 2 tuberosity 2 tter 2 Tsuruta 2 Tsung 2 Tsuang 2 TSS 2 Tso 2 tsmedizin 2 tsklinikum 2 Tsika 2 Truman 2 troublesome 2 Trotti 2 Trott 2 trophectoderm 2 trochanter 2 Triton-X100 2 tritium-labeled 2 trisomy 2 Tris-buffered 2 triptans 2 trios 2 Trinh 2 Trinchese 2 trimmed 2 trimesters 2 Trimble 2 Trim 2 trigeminal 2 trichloroacetic 2 triangles 2 trials39 2 trial5 2 trial10 2 Trevelyan 2 tremendously 2 Treharne 2 treat-and-release 2 treasure 2 tread-mill 2 TRC 2 TRB-3 2 traversing 2 Traumatol 2 Trasischker 2 trapping 2 Trap 2 Transwell 2 transversal 2 transvaginal 2 transscleral 2 transrectal 2 Transposable 2 transmitters 2 translocated 2 translatable 2 transitioning 2 transgenerational 2 transfecting 2 transcutaneous 2 Transcriptomics 2 Transcription-Mediated 2 transcription-factor-binding 2 transcribe 2 transconductance 2 transcends 2 Tranel 2 tradeoffs 2 Trade 2 trachea 2 tracers 2 traceable 2 trabeculectomy 2 Toyota 2 tournament 2 Tounian 2 touchpoint 2 totals 2 totalitarianism 2 totalitarian 2 totaling 2 Toshiba 2 Tos 2 Torzicky 2 torso 2 Toronto-affiliated 2 Topographic 2 Topham 2 Toole 2 Tontonoz 2 ton-sillectomy 2 tone-related 2 Tonegawa 2 Tomohiro 2 Tomograph 2 Tomany 2 Tolosa 2 Tollerud 2 Toll 2 Told 2 Tol 2 Tokuda 2 Toku 2 Toftga 2 Tofler 2 Toescu 2 Tobler 2 tobacco-specific 2 TnT 2 TNF- 2 tml 2 tm331 2 tm1817 2 T-lymphotropic 2 TKRs 2 TJP 2 tion 2 tiny 2 time-synchronization 2 timeline 2 time-efficient 2 time-attenuation 2 Tim 2 tilt 2 Tilsen 2 tilings 2 Tili 2 Tijdschr 2 Tighiouart 2 tiger 2 Tienhoven 2 Tienari 2 Tien 2 Tick 2 Tichenoff 2 tibial 2 Tiangyou 2 thyrohyoid 2 Thurber 2 Thunell 2 throws 2 ThromboGenics 2 thrombocytopenic 2 Thresholding-Based 2 three-state 2 three-level 2 Threat-related 2 Thorsten 2 Thorne 2 Thomee 2 thirty 2 third-party 2 thiol 2 thin-layer 2 thickest 2 thickened 2 thermosensory 2 thermode 2 thera 2 theprognostic 2 theorem 2 thematically 2 Theelen 2 theAOSLO 2 Thatcher 2 Thase 2 than10 2 Thai 2 Thacker 2 Th2 2 Texture-based 2 Teva 2 Tetzlaff 2 Tetsuji 2 tetramers 2 tetrahydrocannabinol 2 tetraacetic 2 tethering 2 testis-specific 2 testament 2 Teslovich 2 Terzioglu 2 tertiles 2 Tertiary-care 2 TERT 2 Terrinoni 2 terminologies 2 terminate 2 teratoma 2 teratogenic 2 Terapia 2 Tenti 2 tensions 2 Tennant 2 ten-core 2 tempting 2 temporally 2 Temperament 2 temper 2 telling 2 telescreening 2 teleophthalmology 2 Telemed 2 Telehealth 2 Telegraph 2 Tejada 2 Tegels 2 teen 2 teasing 2 Tearney 2 team-based 2 TCIA 2 TCF-binding 2 TBV 2 TBR 2 Tau2 2 Tattersall 2 Tatrai 2 Tatjana 2 Tata 2 Tassi 2 Tarrytown 2 tar 2 Taq 2 tapping 2 tapes 2 tapering 2 tantrums 2 tanning 2 Tanila 2 Tangier 2 tangential 2 tampered 2 tamoxifen-treated 2 Tammela 2 taller 2 tale 2 Talbot 2 Takemoto 2 take-home 2 Takatsu 2 Takaomi 2 Takamitsu 2 Takai 2 Takagi 2 Taiwanese 2 Taivassalo 2 Tait 2 tails 2 Tague 2 tagged 2 tactics 2 tactical 2 Tacrolimus1 2 tacroli-mus 2 Tachibana 2 Tachi 2 tabular 2 TableS1 2 Table2 2 t7 2 t44 2 T2w 2 T2b 2 T2a 2 T1c 2 T10 2 Syto16low 2 syrup 2 -synucleininclusions 2 Synthesizing 2 synthesizes 2 Syntec 2 Synphilin-1 2 Synofzik 2 Syngo 2 synergies 2 synchronicity 2 Synchron 2 synaptosome 2 synaptophysin 2 Synaptix 2 Symons 2 symmetrically 2 symmetrical 2 symbolic 2 Sylvia 2 syllable-internal 2 syllabic 2 Sydow 2 SYBR 2 Swinton 2 swing-phase 2 sweetener 2 sweating 2 Swanson 2 SW620 2 Sveistrup 2 Suttorp-Schulten 2 Sutherland 2 sustained-delivery 2 sustainability 2 Susser 2 Susanne 2 Sury 2 surviving 2 Surviv 2 Surveill 2 surrounds 2 surroundings 2 Surrey 2 surpass 2 sure 2 Sur 2 suprasternal 2 supraclavicular 2 supplying 2 supervisory 2 superselective 2 superiors 2 superfluous 2 superclass 2 Suomalainen 2 Sundt 2 Sundquist 2 Sundal 2 sumoylated 2 SUMO2 2 SUMO 2 summit 2 summarises 2 Summ 2 Sulfo-NHS 2 sulfatase 2 sulcus 2 Sukiennik 2 Suka 2 Suk 2 suicidality 2 Sugimoto 2 Sugawara 2 sugar-sweetened 2 Suffredini 2 suffcient 2 Sue 2 Sudhop 2 sudanophilic 2 succinctly 2 succinate 2 successor 2 suburban 2 sub-types 2 subtraction 2 substudy 2 substitutes 2 substituted 2 substituents 2 substantiated 2 substantianigra 2 subspecialist 2 subsidizing 2 SUBSERVED 2 subscript 2 subregions 2 Subramaniam 2 sub-populations 2 sub-optimal 2 subnetworks 2 submucous 2 submitting 2 submicrogram 2 sub-maximal 2 subgrouping 2 subgrade 2 subgluteal 2 subfertility 2 subdural 2 subdivisions 2 subclone 2 Subbarayan 2 subaward 2 subarachnoid 2 sub-analysis 2 stved 2 Stutz 2 Stuttgart 2 Stukel 2 study-related 2 study4 2 study21 2 Studies-depression 2 structure-function 2 Stroop 2 Strom 2 stroke-related 2 stroke-affected 2 striving 2 Strips 2 Strimmer 2 Striessnig 2 striated 2 striatally-injected 2 striatally 2 stretch-shorten 2 stress-responsive 2 stressor-induced 2 stressing 2 streptococcal 2 Streilein 2 Streeten 2 Strebhardt 2 stratifying 2 stratify 2 stratifications 2 Stratagene 2 Strasberg-Rieber 2 straighten 2 straight 2 Strahlman 2 Stovner 2 Stouthamer-Loeber 2 stories 2 stops 2 Stoot 2 Stomrud 2 Stokoe 2 Stokes 2 stoichiometry 2 Stoelting 2 Stockler 2 stochastic 2 sTNFR1 2 sTNF 2 stirrer 2 stimulatory 2 Stimul 2 STIMA-1 2 stigma 2 stiffer 2 stiffening 2 stiff 2 Stichting 2 Steverink 2 stereotactic-focused 2 stereology 2 StereoInvestigator 2 stepped 2 Stelmach 2 Stellos 2 Steinbach 2 Stegeman 2 Steffens 2 Stefano 2 Stefan 2 steep 2 Steenland 2 steady-state 2 steadily 2 Ste 2 Stavrou 2 Staudt 2 StatView 2 statuses 2 stature 2 Stathmin 2 state-transition 2 statement-only 2 Stasinopoulos 2 Stargardt 2 Stapells 2 Stanton 2 stances 2 Stampfer 2 STAMPEDE 2 stammer 2 stalk 2 Stajich 2 Stagliano 2 stage-specific 2 Stadler 2 Stadelmann 2 Stacy 2 Stacks 2 Staal 2 SSWhite 2 SSCE 2 SRT 2 Srirompotong 2 SREBPs 2 SRC-MEFs 2 sRAGE 2 spurts 2 spurious 2 spur 2 Spruill 2 Springs 2 Springfield 2 spreads 2 Spratt 2 Sprague-Dawley 2 Sportel 2 splitting 2 spliced 2 Spiro 2 spiritual 2 Spirit 2 spinothalamic 2 spines 2 spin-echo 2 Spindler 2 spindle 2 Spertus 2 spermatozoa 2 Sperling 2 Sperduto 2 spell-out 2 spelling 2 Spelbrink 2 speech-related 2 Speechley 2 speech-induced 2 spectroscopic 2 spectrophotometry 2 spectrophotometric 2 spectrophotometer 2 Spectris 2 spectrin 2 spectrally 2 Specter 2 spectacular 2 specifics 2 SPCS 2 spastic 2 spasms 2 Spano 2 spanned 2 Spaltenstein 2 SPAI 2 Spahr 2 Spady 2 Spadafora 2 sown 2 Souza-Junior 2 Soussi 2 Sousa 2 Sourial 2 Soto 2 Sotiriou 2 SOS-mediated 2 Sos 2 sort 2 sore 2 Sopasakis 2 Sontheimer 2 sonography 2 sonographers 2 Sonoda 2 Sonntag 2 sonic 2 Soni 2 Sonego 2 somatotopographical 2 somato-sensory 2 somatopause 2 Somatization 2 solving 2 Solvason 2 Solit 2 Solingen 2 solids 2 solicitous 2 soleus 2 Soldati 2 Solca 2 Sokolov 2 Sohn 2 softening 2 Sofic 2 Sodergren 2 sod-3 2 Sociol 2 sociocultural 2 SOB 2 SNS 2 Snowden 2 snowball 2 snoRNAs 2 SNneurons 2 Snell-Bergeon 2 SNCA-Rep1 2 SNCA98 2 SNCA140 2 SNCA126 2 SNCA112 2 SNARE-mediated 2 Snapp 2 Snapinn 2 Snaith 2 snack 2 Smulders-Srinivasan 2 smoothly 2 Smolka 2 Smitsengelsman 2 Smita 2 Smirnov 2 Smiddy 2 SMCV 2 SMB 2 small-for-gestational 2 Small-Bowel 2 SM-22alpha 2 Sly 2 slows 2 slow-progressing 2 Slit 2 Sligo 2 Slide-mounted 2 slice-to-slice 2 Sletten 2 SLC52A 2 Slakter 2 SKMM2 2 Sklar 2 Skipper 2 skins 2 skinned 2 ski 2 skewing 2 skeleton 2 Skanderborg 2 S-K 2 sjpoon 2 Sjogren 2 Sjo 2 SJM 2 S-J 2 size-exclusion 2 sixth-grade 2 Sivina 2 Sivaswamy 2 sit-to-stand 2 sister 2 Sisson 2 SIRT6 2 SIRT-1 2 Sir2p 2 sinonasal 2 sinogram 2 singular 2 single-level 2 single-hemifield 2 single-gene-deletion 2 single-gene 2 single-dose 2 SINAPSE 2 Sims 2 simplistic 2 simplify 2 Simone 2 Simmons 2 Simhi 2 simethicone 2 Simao 2 Silveri 2 Silman 2 silicon 2 silica 2 Silbert 2 Silbershatz 2 Silbernagel 2 Silbergeld 2 Sikkema 2 signifying 2 signifies 2 signiffcant 2 signicantly 2 signficantly 2 signed-rank 2 sign-conserving 2 signal-regulated 2 sIg 2 Siega-Riz 2 sidewall 2 Siciliano 2 SIbase 2 SIAARTI 2 shutter 2 Shulman 2 shtml 2 Shroff 2 Shriberg 2 shrank 2 short-duration 2 short-chain 2 short-and 2 Shogren-Knaak 2 Shoffner 2 shoe 2 Shivakumar 2 Shisca 2 Shinoda 2 Shinn 2 shimming 2 Shilov 2 Shiga 2 shield 2 Shibata 2 SHH-driven 2 Sherman 2 Sherer 2 Sherbrooke 2 Sheraidah 2 Shephard 2 shell 2 shelf 2 Sheffield 2 Sheetz 2 sheer 2 sheath 2 Shea 2 shaving 2 shaved 2 Shaulian 2 Shatzmiller 2 Sharrow 2 Sharpless 2 Sharpe 2 Sharman 2 Sharkey 2 Shariat 2 Shappell 2 Shanmugaratnam 2 Shamsi 2 shamanism 2 shaman 2 Shahidi 2 shadowing 2 shading 2 Shabalina 2 SGP 2 SGMIB-Nanobody 2 seventeen 2 sevens 2 seven-item 2 Seung 2 Setubal 2 s-Esteve 2 Sesbou 2 Serrels 2 Serra 2 serous 2 serotonin1A 2 serological 2 serologic 2 serially 2 SerialEM 2 Sergeeva 2 Sereduk 2 Serdula 2 SERCA 2 Ser-129 2 sequesters 2 sequester 2 septorhinoplasty 2 septicemia 2 Sepramaniam 2 Sep-Pak 2 Seok 2 Seo 2 sensory-motor 2 sensori-motor 2 sensitizing 2 Senagore 2 Sena 2 semi-quantitative 2 Semina 2 Sellner 2 Sellers 2 Selivanova 2 Selhub 2 self-suggested 2 self-propagate 2 self-identified 2 self-help 2 self-governed 2 self-consciousness 2 selenium 2 Sein 2 Seiichiro 2 Seidman 2 segregation 2 segregated 2 Segall 2 sees 2 Seeley 2 seekers 2 seeds 2 seeded 2 Sedlmaier 2 sedimentation 2 sedated 2 securing 2 Secular 2 secretor 2 secretions 2 secretes 2 Secord 2 second-wind 2 second-look 2 second-line 2 Sebranek 2 Sebel 2 Seasonal 2 Searle 2 seamlessly 2 SEAD 2 SDOCT 2 SD- 2 Scriver 2 scrambling 2 scrambled 2 scramble 2 scotopic 2 scotomas 2 Scopus 2 SCN2A 2 Scler 2 Scintigraphic 2 science-driven 2 Scian 2 Schwrzler 2 Schwerin 2 Schwenzer 2 Schwenk 2 Schweizer 2 Schwarzschild 2 Schwarzenbach 2 Schwab-Stone 2 Schwab 2 Schuz 2 Schuurmans 2 Schulze 2 Schulman 2 Schuldt 2 Schulder 2 Schug 2 Schuff 2 Schuchter 2 Schroder 2 Schriefl 2 Schrans 2 Schrag 2 Schr 2 schooling 2 Schoolcraft 2 Schonfeld 2 Schomaker 2 Scholes 2 Schoffelen 2 Schneuwly 2 Schnabel 2 Schmitt 2 Schmidt-Supprian 2 Schlossmacher 2 Schlaepfer3 2 Schl 2 schizo-affective 2 Schiller 2 Schiffer 2 Schie 2 Schevon 2 Schermelleh-Engel 2 Scherer 2 Schembri 2 Scheltens 2 Schellingerhout 2 Schellenberg 2 Scheidtmann 2 Scheff 2 Scheel 2 Schechtmann 2 Schechter 2 Schans 2 Schaible 2 Schaftzel 2 Schafer 2 Schabitz 2 scenes 2 scavenge 2 Scarr 2 s-Cardama 2 scant 2 Scanscope 2 Scaln 2 ScaledIIIUK 2 scalable 2 Scaife 2 sc-67141 2 sc-17951 2 Sbriccoli 2 SBF 2 Sawcer 2 Savoia 2 Savio 2 Savinova 2 Savin 2 Saves 2 save 2 Savage 2 Sauve 2 Saufley 2 Saud 2 Sattmann 2 Satoh 2 satellite 2 Satake 2 Sastre 2 Sas2p 2 Sarnak 2 Sarka 2 Saritas 2 Sarig 2 Sardanelli 2 sarcoplasm 2 sarcoma-specific 2 sarcolemma 2 sarco 2 Saraswat 2 Sara 2 Sapiens 2 Santos-Weiss 2 Santosh 2 Santonastaso 2 Santalla 2 San-som 2 Sans 2 Sano 2 Sanger 2 Sanfilippo 2 Sandweiss 2 Sandra 2 Sandoval 2 Sandin 2 Sanai 2 Samuelsson 2 Samir 2 Samii 2 Samia 2 SameSpots 2 Samantha 2 Sama 2 Salvioli 2 Salvador 2 Salut 2 Salum 2 salty 2 SAL-RNAs 2 SAL-RNA3 2 Salkowski 2 Salford 2 Saleh 2 sale 2 Salarirad 2 salamander 2 Sala-Blanch 2 Sal 2 Sakmann 2 Sakkinen 2 Sakas 2 Sakagami 2 Sajdel-Sulkowska 2 Saint-Cyr 2 Saini 2 Sahni 2 Saher 2 Sagrati 2 Saetta 2 Saelens 2 SAE 2 S-adenosylmethionine 2 Sadagurski 2 sacrificed 2 Sacks 2 Sackin 2 Sachdev 2 saccharin 2 sac 2 Sabatini 2 Sabapathy 2 Saager 2 S93 2 S7B 2 S6K 2 S6B 2 S6A 2 S5E 2 S4F 2 S4E 2 S3G 2 S3F 2 S3E 2 S3D 2 S1F 2 S188 2 S179 2 S16 2 rzburg 2 Rytsar 2 Rymar 2 rvenp 2 r-values 2 Rustin 2 Rust 2 Russia 2 Ruscello 2 ruptured 2 Rupp 2 Ruotsalainen 2 Rundle 2 Ruiz-Narvaez 2 Ruggiero 2 Ruegg 2 Rue 2 Rudrauf 2 Rudow 2 Rudnicka 2 Ruberti 2 Rubens 2 rubber 2 RT-qPCR 2 RTK 2 RTC13 2 RT0 2 R-square 2 RSN 2 rs920915 2 rs7903146 2 rs493258 2 rs429358 2 rs13702 2 rs11931074 2 rs11146020 2 rs10468017 2 RRC 2 RQ 2 RPSSclose 2 RPMI 2 RPE-secreted 2 RPD 2 Rozell 2 Royalties 2 Rowland 2 routines 2 Rouse 2 round-the-clock 2 roundtable 2 rough 2 rotten 2 Rotman 2 Rothschild 2 Rothenberg 2 rotational 2 rotated 2 rosuvastatin 2 Rosenwald 2 Rosenbaum 2 rope 2 root-mean-square 2 Roock 2 Ronnebaum 2 Rong 2 Romundstad 2 Rombouts 2 Romann 2 Roma 2 Rollis 2 roller 2 Rolland 2 Rogina 2 rofecoxib 2 Rodriguez-Oroz 2 rod-rich 2 Rodger 2 Rodero 2 Rodale 2 Rockman 2 Rockhill 2 robotics 2 robotically-assisted 2 robotically 2 Robins 2 Robin 2 Roberto 2 Robert-Jan 2 Roberta 2 Robb 2 roadmap 2 RNFL 2 Rizzolatti 2 Riyadh 2 Rivlin-Etzion 2 Rivera 2 rivastigmine 2 rituximab-dependent 2 Ritchie 2 risky 2 risk-taking 2 riskof 2 rises 2 Rippo 2 Ripley 2 ripening 2 Riolo 2 rings 2 Ringer 2 rim 2 righting 2 right- 2 Rieber 2 Riddle 2 Ridai-cho 2 rid 2 Rician 2 richtlijn 2 Richman 2 Riccardo 2 Ribeiro 2 rhombic 2 Rhim 2 rhegmatogenous 2 Rhea 2 RGD 2 RFs 2 revolutionized 2 revolutionary 2 revolution 2 Revisiting 2 Revise 2 Revesz 2 revert 2 reverberation 2 revascularization 2 Reurink 2 return-to-sport 2 retrorubral 2 retrograde 2 retired 2 retinopathies 2 retinol-binding 2 Retina-Vitreous 2 retina-specific 2 retinalphysician 2 reticulum-mitochondria 2 retarding 2 resumes 2 re-sults 2 rests 2 restrict 2 restores 2 restorative 2 Resseguie 2 responsivity 2 respects 2 resource-poor 2 resolutions 2 resolution-recovery 2 resisting 2 Resist 2 residing 2 resident-only 2 reshaping 2 reserves 2 resections 2 Researches 2 researched 2 rescaled 2 RERI 2 reprogrammed 2 reproducing 2 reproduce 2 reprobed 2 repressed 2 repress 2 repository 2 repositories 2 repositioned 2 re-ported 2 reportable 2 replied 2 replicable 2 REPLACES 2 repetitively 2 reperfusion 2 repackaged 2 Rentko 2 rent 2 Rennie 2 Rene 2 renderings 2 renamed 2 remotely 2 remit 2 remembered 2 remediation 2 RE-LY 2 reluctance 2 religion 2 relieved 2 relieve 2 relaxivity 2 Related-Samples 2 Re-labeled 2 rejects 2 reject 2 reiterated 2 Reisberg 2 Reinikainen 2 Reinberg 2 Rein 2 Reimer 2 Reilhac 2 -Reif 2 registers 2 registering 2 region-of-interest 2 regime 2 Regeneron 2 regenerate 2 Regenbogen 2 regain 2 refuse 2 refusals 2 Refshauge 2 refrained 2 reformulation 2 reflectedby 2 refines 2 refilling 2 reffect 2 referent 2 referee 2 re-examined 2 reexamination 2 reevaluation 2 reestablishment 2 re-entrant 2 reentrant 2 reeducation 2 reductionin 2 Redshaw 2 Redmond 2 re-distribution 2 redesign 2 REDD1 2 recycled 2 recurrence-free 2 recruiting 2 recov-ery 2 recovers 2 recorders 2 recorder 2 reconstructs 2 Reconstr 2 reconciliation 2 recombinations 2 recombinase-mediated 2 recognizable 2 Reckitt 2 RECIST 2 Rechtman 2 Rechavi 2 receptor-independent 2 receptor-dependent 2 receptor-blocking 2 reception 2 Recept 2 Recchia 2 recapitulates 2 recapitulated 2 rebreathing 2 rebleeding 2 re-biopsy 2 rebinning 2 rebel 2 rebate 2 reassuring 2 reasoned 2 rearrangement 2 rearranged 2 reappeared 2 real-life 2 Realizing 2 Reagan 2 ready 2 readiness 2 RDoC 2 RDMS 2 rdenas 2 RCP 2 RCOG 2 rCB-VNER 2 Raza 2 Rawlins 2 Rauch 2 Ratter 2 Rathmell 2 raster 2 RAS-effector 2 rarity 2 Rapp 2 Raposinho 2 RAP 2 Ransohoff 2 ranibizamab 2 Rangasamy 2 randomizzazione 2 Ranciat-McComb 2 Ramsey 2 Ramo 2 ramified 2 ramification 2 Rajewsky 2 Rajan 2 raft 2 Radtke 2 Radstrom 2 Radom-Aizik 2 Radloff 2 radio-TLC 2 Radiopharm 2 radiometal-based 2 radiologically 2 Radio-ligand 2 radioimmunoprecipitation 2 radiography 2 radiographs 2 radioembolization 2 radioconjugate 2 radiculopathy 2 radicular 2 radiatum 2 radiationtherapy 2 radiation-related 2 Radeke 2 raclopride 2 racing 2 RacerMate 2 Rabinovitch 2 Rabbani 2 Raastad 2 R56 2 R246S 2 R03 2 Qvortrup 2 quotient 2 quotations 2 quiz 2 Quiroga 2 Quirke 2 Quinta 2 Quinlivan 2 Quine 2 quiescent 2 Quesal 2 querying 2 quaternion 2 quaternary 2 Quantikine 2 quantifies 2 quantifiable 2 Quante 2 Quant 2 Qualls 2 qualitynet 2 Quality-Initiatives-Patient-Assessment-Instruments 2 quality-control 2 quadruped 2 quadratic 2 qua 2 Qu 2 Qtaishat 2 QnetPublic 2 QLQ 2 Qld 2 Q1 2 Pzer 2 pyridoxine 2 Pyrexia 2 pyrazolyl-diamine 2 pyramid 2 Pyo 2 Pyle 2 Pylayeva-Gupta 2 Pygmalion 2 puts 2 push-off 2 pushed 2 pursuit 2 purpura 2 purposive 2 purposeful 2 purports 2 purported 2 Purkinje 2 Purkey 2 purines 2 purine 2 Puri 2 PureLink 2 Puregene 2 pupils 2 pupillary 2 pupil 2 punctures 2 punctuations 2 pulses 2 pulsed 2 pulsatility 2 pulsatile 2 pulling 2 pull 2 Puigvert 2 Pugacheva 2 Puel 2 pubic 2 PU 2 PTB 2 pT3b 2 pT3a 2 PsyCoLaus 2 psychotomimetic 2 Psychotherapies 2 Psychother 2 psycho-social 2 Psychosoc 2 Psychophys 2 Psychologie 2 Psychologic 2 Psychogeriatr 2 pSivida 2 pseudogene 2 pseudoangiomatous 2 Psaty 2 p-S6 2 Przeworski 2 Prusiner 2 provoking 2 provoke 2 provocative 2 provirus 2 pro-vided 2 Protti 2 proteolytically 2 protein-tyrosine 2 protein-lipid 2 protea-some 2 prostate-speci 2 prostate-cancer 2 Prosser 2 prospects 2 Propp 2 proportionally 2 proportionality 2 prophylactically 2 Propaganda 2 proofread 2 proof-of-principle 2 pronunciation 2 prompts 2 prompting 2 promotive 2 pro-moter 2 promises 2 PROM 2 prolonging 2 proline 2 proliferator-activated 2 proliferate 2 projective 2 pro-gression 2 professions 2 productively 2 proctitis 2 ProCOUNT 2 proceeds 2 proceeding 2 proceeded 2 procaspase-3 2 Probst 2 problem-solving 2 pro-B 2 proatherogenic 2 proanthocyanidins 2 proactively 2 PROactive 2 PRKN 2 Priya 2 prisoners 2 prison-based 2 Printing 2 Princess 2 Prince 2 pricing 2 preview 2 prevail 2 pretty 2 pre-trial 2 pretext 2 pre-term 2 Presuming 2 Pre-specified 2 Presidents 2 presidential 2 preservatives 2 presentin 2 presenteeism 2 preselected 2 presedation 2 Prescott 2 pre-school 2 pre-recorded 2 Pre-post 2 pre-plasma-blasts 2 prepares 2 Prep 2 Preoxygenated 2 prenatally 2 premotor 2 premonitory 2 prelabor 2 pre-intervention 2 prehistoric 2 prehabilitation 2 pre-germinal 2 preferably 2 pre-existing 2 preexercise 2 Preet 2 Preemptive 2 preeminent 2 predominating 2 predominately 2 predominance 2 predisposed 2 PREDIMED 2 predictably 2 predictability 2 predicament 2 pre-defined 2 pre-cistern 2 precipitates 2 precipitate 2 pre-attentive 2 preassembled 2 preanesthetic 2 Preanalytical 2 Preacher 2 Pratt 2 Pramstaller 2 Prahallad 2 practised 2 PR42 2 PR39 2 PR25 2 PR05 2 PR04 2 PQRS 2 PPVT-III-NL 2 ppt 2 PPROMT 2 PPROMEXIL-2 2 PPP1R15A 2 Ppp1r10 2 PPN 2 PPI 2 PPARGC1A 2 PPARalpha 2 Pozo 2 Powerlab 2 Powdered 2 powder 2 povidone 2 poverty-to-income 2 Povazay 2 poultry 2 Poulter 2 pouch 2 Potucek 2 Potter 2 Pothier 2 potentiates 2 Potente 2 post-tumor 2 post-traumatic 2 post-transplant 2 post-transcriptionally 2 posttranscriptional 2 post-TBI 2 post-surgical 2 postregistration 2 postprocedural 2 post-MVC 2 postmenopausal 2 postlaparoscopic 2 post-intervention 2 posteriorly 2 Posted 2 post-doctoral 2 postdoctoral 2 postdischarge 2 postconceptual 2 Possmayer 2 possessed 2 -positive 2 posit 2 posed 2 pose 2 Porzig 2 ports 2 Portier 2 portended 2 Portage 2 Porro 2 porphyrins 2 porphyric 2 porphyria-europe 2 Porath 2 population-level 2 populated 2 Poppas 2 Pope 2 Ponugoti 2 poly-therapy 2 polytherapy 2 polysyllabic 2 polysomnographic 2 Polyposis 2 polypoidal 2 polypill 2 polypeptide 2 poly-morphisms 2 polyglutamine 2 polycystic 2 Polycomb-mediated 2 Polycomb-group 2 polling 2 Poller 2 politzeration 2 Politou 2 police 2 polarizing 2 polarization-sensitive 2 polarities 2 Polanczyk 2 Poizat 2 Poison 2 Poirier 2 Pohl 2 Pohjasvaara 2 P-OH 2 Pogue 2 PNUTS 2 PNP 2 pneumotachograph 2 pneumocystis 2 Plymouth 2 plugged 2 Plough 2 Ploner 2 Ploghaus 2 pleural 2 Pletcher 2 pleomorphic 2 Plebani 2 plausibility 2 platelet-derived 2 Plast 2 plasmon 2 plasmids 2 plasmic 2 plasmacytic 2 plasmablast 2 Plasencia 2 placeholder 2 PIVOT6 2 PI-treated 2 pitfall 2 pit 2 piston 2 Pissadaki 2 pipes 2 pipeline 2 pipe 2 Pioneer 2 Pintus 2 Pinto 2 Pinos 2 pinocytosis 2 PINK1-Parkin 2 Pinborg 2 Pilotti 2 pillars 2 Pilkonis 2 Pilepich 2 Pignataro 2 pigments 2 PIF 2 Piette 2 Pietsch 2 Pietras 2 Pietra 2 Pietenpol 2 pies 2 Pierri 2 Piedimonte 2 picks 2 Pickrell 2 Pickering 2 PI-binding 2 PIB 2 Piaggio 2 PI3-kinases 2 Physicians-American 2 physician-patient 2 phylogenetically 2 phrases 2 phrase 2 phototransduction 2 phototoxicity 2 photosensitive 2 photo-receptors 2 photo-receptor 2 photochemotherapy 2 Photobiol 2 photo 2 phosphorylation-mimicking 2 phos-phorylase 2 phosphodiesterase 2 Phoniatrics 2 Phoniatrica 2 phoneme 2 phobias 2 philosopher 2 Philos 2 Philippot 2 phenylephrine 2 pheno-type 2 phencyclidine 2 Phelan 2 PHEIC 2 PhD4 2 phase-sensitive 2 Phaseresolved 2 pharyngeal 2 Pharmacists 2 Pharmacie 2 phantoms 2 phalloidin 2 phagocytized 2 phagocytic 2 PGL3-miR-135b-P1 2 Pflzer 2 Pfeiffer-Guglielmi 2 Pfeifer 2 Pezzini 2 peutic 2 Peuralinna 2 Petrukhin 2 Petroz 2 Petrocca 2 Petrig 2 Petkov 2 Petitjean 2 petabyte 2 Perucca 2 perturbs 2 perturbing 2 pertain 2 personhood 2 personalities 2 Persona 2 persisting 2 Perruchoud 2 per-protocol 2 Peron 2 permeation 2 Perlmann 2 peritumoral 2 peritendinous 2 periosteum 2 periodontitis 2 periodontal 2 periodically 2 perineal 2 perinatally 2 Periklis 2 perigenual 2 perifibrous 2 pericardium 2 Pericak-Vance 2 Pergamin 2 performers 2 Perfection 2 Perez-Gala 2 Perera 2 Percutan 2 percepts 2 percents 2 perceives 2 pentobarbital 2 pentapeptide 2 Pennathur 2 penicillin 2 Penha 2 Penfold 2 Penetrating 2 penetrate 2 Pelt 2 Pelotas 2 pellet 2 PEF 2 Pedrotty 2 pediatrician 2 Pedapati 2 Pecoraro 2 Pearl 2 Peabody 2 PDpatients 2 PD-linked 2 PDand 2 PcXT109 2 PCFA 2 PCA 2 paying 2 Pawinski 2 pave 2 pauses 2 Paumier 2 Paulo 2 Paulien 2 Pauleikhoff 2 Paucard 2 Pattichis 2 Patocs 2 Pato 2 patient-physician 2 patient-identifiable 2 Pati 2 path-ways 2 pathologyin 2 pathologischen 2 Pathologica 2 pathogenetic 2 patho-genesis 2 pathlength 2 patches 2 Pat 2 Past-president 2 Past-Chairman 2 Pasta 2 past10 2 Pasolli 2 Pascual-Leone 2 Pascual 2 Pascolini 2 Parvathaneni 2 parvalbumin-and 2 partnersand 2 partnering 2 partitioned 2 Parthasarathy 2 Parsey 2 parse 2 Parsa 2 ParkYK 2 Parktown 2 Parkkinen 2 Parkkari 2 Parkinsons 2 PARK7 2 PARK2 2 Parisi 2 paresthesias 2 Paresh 2 parenteral 2 Parenter 2 Pare 2 parcellations 2 paravalvular 2 parasylvian 2 paramount 2 paramedical 2 Paramanandam 2 Paralympic 2 parallel-group 2 paralleled 2 paragraphs 2 Paques 2 Papp 2 papillary 2 Papanicolaou 2 Papandreou 2 Papadopoulos 2 Pantelis 2 Panretinal 2 Pannu 2 pan-neuronal 2 Panneerselvam 2 Pandya 2 pandemic 2 pancytopenia 2 Pamuk 2 Palvanen 2 palpation 2 palmitate 2 pallidus 2 pallidum 2 palliating 2 Pallanck 2 Palermo 2 Paleologou 2 Palao 2 Palais 2 Pal 2 Pakkenberg 2 Pakistani 2 Paisley 2 pairings 2 PAINWeek 2 pain-treatment 2 Paintaud 2 paint 2 pain-protective 2 pain-malady 2 painless 2 painkiller 2 Paik 2 pagina 2 Page-Thomas 2 pagename 2 Paediatrics 2 Paech 2 Padilla 2 Padhani 2 Padgett 2 packages 2 p70 2 p62 2 p53-R273H 2 P53R172H 2 P-450 2 p35 2 p21 2 -P 2 P- 2 Ozgencil 2 Ozansoyand 2 Ozaki 2 oxygen-carrying 2 oxide-induced 2 oxidativestress 2 oxidatively 2 Oxf 2 oxalate 2 Owings 2 Overviews 2 over-the-counter 2 overriding 2 overly 2 overinfusing 2 Overgaard 2 over-expressing 2 overexposure 2 overembolization 2 over-detection 2 overcomes 2 overarching 2 over-all 2 ovaries 2 oval 2 outset 2 out-of-pocket 2 outnumber 2 outmatch 2 outlining 2 outgrowth 2 ought 2 Oueslati 2 Oud-Alblas 2 Ou 2 Otto 2 Ottawa 2 otoscopic 2 otorhinolaryngo-logic 2 otological 2 otolith 2 Osvaldo 2 Ostlund 2 osteotomy 2 osteonecrotic 2 osteocytes 2 osteocyte 2 osteoclast 2 Ostendorf 2 Ospedalizzazione 2 Ospedale 2 Osnabrueck 2 Osika 2 oscillation 2 Orzalesi 2 Ortega-Azor 2 Orr 2 Oron 2 ORL 2 orifices 2 orientations 2 organize 2 organisations 2 Ordinal 2 orbiting 2 Orazi 2 ORACLE 2 Oquendo 2 optometry 2 optional 2 optimised 2 opticalcoherence 2 Opthalmol 2 opioid-weaning 2 opioid-sparing 2 ophthalmoplegia 2 Ophthal-mology 2 Ophtalmol 2 operculo-insular 2 operated-on 2 Opala 2 Oostenbrink 2 oocyte 2 Onyike 2 ontological 2 on-target 2 ons 2 Ondo 2 on-demand 2 ondansetron 2 Oncotarget 2 OMIM 2 omic 2 Omi 2 OME 2 Omary 2 Olivieri 2 OLINDA 2 oligosecretory 2 oligomerization 2 Olesen 2 old-old 2 oldest-old 2 Olah 2 Olafsen 2 Okumi 2 Oksjoki 2 Okrainec 2 Okifuji 2 Okazaki 2 Ojikutu 2 Ojha 2 Ojemann 2 Ojala-Oksala 2 OJ 2 Oizumi 2 oily 2 Ohman 2 Ohde 2 Ogden 2 ofmtDNA 2 ofIkBalpha 2 Off-target 2 ofFluency 2 ofAl 2 ofa 2 oestrogens 2 oesophageal 2 Oerlemans 2 Odermatt 2 Odense 2 OCT3 2 OCT2 2 OCI-MY5 2 occurrences 2 occupying 2 occupied 2 occludin 2 occlude 2 obstructed 2 obstruct 2 Obstetrician-Gynecologists 2 observes 2 observed-to-expected 2 obscured 2 oblique 2 obliges 2 obligation 2 objectivity 2 obinutuzumab 2 O-binding 2 obey 2 obesogenic 2 Obach 2 Oakridge 2 O6-methylguanine-DNA 2 Nygard 2 Nye 2 Nuwayhid 2 nutrient-sensing 2 Nussmeier 2 Nusse 2 nurture 2 Nurk 2 Nuovo 2 NuNu 2 Nunez 2 Nunes 2 numerators 2 nude-weighed 2 nuclearIkBalpha 2 nuclear-encoded 2 nster 2 NSFC 2 NR3B 2 NR2D 2 NR2B-containing 2 NR2 2 NPVs 2 NPD 2 NP-complete 2 NP40 2 noz 2 NOX4 2 Nowak 2 Nottingham 2 Nostra 2 Norum 2 Northwick 2 Northcott 2 normoxic 2 normotensive 2 normal-organ 2 normalise 2 Norlin 2 Nork 2 Norden-Zfoni 2 Norat 2 noradrenaline 2 Noorian 2 Noor 2 non-words 2 non-white 2 nonwhite 2 Non-volitional 2 non-visible 2 nontumorigenic 2 nontumor 2 non-treatment 2 non-transgenic 2 non-traditional 2 nontraditional 2 non-steroidal 2 non-stereo 2 non-stationary 2 nonstandard 2 non-smoking 2 nonsmoking 2 nonsmokers 2 nonrobotic 2 non-responsiveness 2 nonresidents 2 nonreassuring 2 nonrandomized 2 non-psychiatric 2 nonprofit 2 nonprescription 2 nonpathological 2 nonpathologic 2 non-paretic 2 non-palpable 2 non-overlapping 2 nonnormally 2 non-mammalians 2 Non-mammalian 2 non-malignant 2 nonloaded 2 Non-linguistic 2 non-integer 2 non-insulin-dependent 2 noninjurious 2 noninfectious 2 non-Indigenous 2 non-Hodgkin 2 nongovernmental 2 nonfat 2 non-existence 2 non-enhanced 2 non-English 2 non-diabetic 2 non-demented 2 non-contact 2 noncompliant 2 non-cell-autonomous 2 non-cancer 2 nonattainment 2 nonalcoholic 2 Non-adherence 2 non-academic 2 non- 2 nomogram 2 nomenclature 2 Noma 2 Nojima 2 Nohutcu 2 Noh 2 no-Guell 2 Noghero 2 Noels 2 nodular 2 node-positive 2 node-negative 2 Nobukazu 2 Nobuhiro 2 NOBORI 2 NOAM 2 Noah 2 nnist 2 N-methyl-D-aspartic 2 NMDAR1 2 NL493 2 NL009 2 NKG 2 Niwar 2 nity 2 nitrosamine 2 nitrate 2 nitive 2 nitinol 2 Nissl-positive 2 Nishijo 2 Nishihara 2 Nipro 2 Nippold 2 ninth-grade 2 Ninth 2 Ninewells 2 Ninety-two 2 Ninety-eight 2 Ninety 2 Nineteen 2 Nina 2 Nils 2 Nijhuis 2 Nijhoff 2 Nij 2 nihpromis 2 nigralDA 2 Nigam 2 nifedipine 2 Niesters 2 Niemann-Pick 2 Nielson 2 Niell 2 NIDCD 2 Niculescu 2 nicotinamide 2 Nicoletti 2 Nickoloff 2 Nichols 2 NIAID 2 NHL 2 n-hexane 2 NH4OAc 2 NH3 2 NH2-Bn-NOTA 2 Ngo 2 NGM 2 Ngan 2 NF-kB2 2 Newton-Cheh 2 Newport 2 Newgard 2 Newcastle-upon-Tyne 2 neutralizing 2 neurotrophin-3 2 neurotrophin 2 Neurotrauma 2 Neuroticism 2 neurosignature 2 Neuroscientist 2 NeuroScan 2 neuroradiological 2 Neuropsychologia 2 Neuropsychol 2 neuro-physiological 2 neurophysiologic 2 Neuro-physiol 2 Neuropediatrics 2 neuropathies 2 neuronopathy 2 Neuron-Glia 2 neurones 2 Neuro-Muscular 2 neuromodulatory 2 neuromas 2 neuroleptics 2 neuroleptic-free 2 Neuroimmunomodulation 2 neurohormones 2 neuroethicist 2 neuroethical 2 Neuroeng 2 neurode-generative 2 Neurodegener 2 Neurocytol 2 Neu-robiol 2 Neuroanatomical 2 NeuraSyn 2 neuralgia 2 NeuN 2 neu 2 net-works 2 Netw 2 Nettleton 2 Neptune 2 nephritis 2 Neitz 2 neighbors 2 negotiating 2 neglect 2 Needham 2 Nederlandse 2 necropsy 2 necessitating 2 necessitated 2 necessitate 2 nebulization 2 Neborsky 2 near-Baseline 2 ndings 2 NCT02044172 2 NCT01945866 2 NCT01520519 2 NCT00689221 2 NCT00193856 2 NCM460 2 NCM 2 NCI-60 2 NCHStats 2 NCF 2 NCEP 2 NCBI 2 nblow 2 nbhigh 2 navigable 2 Naval 2 Nav 2 Nauta 2 Naugler 2 Natoli 2 nationality 2 National-Eye-Institute 2 Nathalie 2 Natalie 2 Nascimento 2 Nasca 2 narrowly 2 narrowing 2 narrower 2 narrowed 2 Nariya 2 Nardinocchi 2 Narang 2 Napoli 2 NAP 2 Nanz 2 nanogenerators 2 nanodrop 2 Nano 2 Nan 2 Nakauchi 2 Nakano 2 Nakajima 2 Nakaisumi 2 Naishadham 2 Nah 2 Nagai 2 Nagahara 2 NACP 2 Nackley 2 Nabekura 2 N-300 2 N0 2 N- 2 MZ 2 Myths 2 Myrseth 2 myophos-phorylase 2 myokines 2 myofibers 2 myocardialinfarction 2 Myles 2 MyLab 2 myelosuppression 2 myeloperoxidase 2 MVCRMS 2 MVA 2 Muzyczka 2 Muyldermans 2 Mutso 2 Muthen 2 Mutez 2 mutagenesis 2 Mut 2 Mustajoki 2 Mussman 2 muscimol 2 muscarinic 2 Murtagh 2 Murry 2 Murillo 2 murder 2 Murayama 2 Murat 2 Murakami 2 Murabito 2 Munoz-Guerra 2 Muniz 2 Municipal 2 Munich 2 Mundipharma 2 Munckhof 2 Muncan 2 Munafo 2 multiyear 2 Multivessel 2 multitrauma 2 multi-stratified 2 multistratified 2 multistep 2 multi-stage 2 multi-site 2 multiscale 2 multipurpose 2 multiprotein 2 Multinational 2 Multi-Modality 2 multimedia 2 multimarker 2 multilobular 2 multi-level 2 multifunctionality 2 multifunctional 2 multi-factorial 2 multi-faceted 2 multidetector 2 multicomponent 2 multicolor 2 Multichannel 2 multi-centre 2 Mult 2 Mulrow 2 Mulero 2 Mukkamala 2 Mukherji 2 Mukherjee 2 Muir 2 Mufson 2 Muendlein 2 Muehllehner 2 mucocutaneous 2 mucinous 2 much-needed 2 MTT 2 MTM 2 MSigDB 2 MSc1 2 MRR 2 MR-PET 2 Mroczkowska 2 MRFD 2 MRCP 2 MPTP-treated 2 MPTFs 2 MPTF 2 MPO-dependent 2 MPO 2 MPlus 2 mPFC 2 Mozaffarieh 2 Mozaffarian 2 Moynihan 2 moving-phantom 2 Mouton 2 Moutier 2 Mousses 2 Mouroux 2 Mouquet 2 Moughan 2 Mouchiroud 2 Mottolese 2 motorization 2 motoneurons 2 motivating 2 motion-tracking 2 motion-free 2 motion-compensation 2 motherboard 2 Mossbock 2 Moses-Kolko 2 Moses 2 Mosconi 2 mosaics 2 mosaicism 2 Mortiboys 2 mortgage 2 mortem 2 Morrow 2 Morree 2 Morley 2 Moriuchi 2 Morino 2 Mori 2 Morgenstern 2 Morey 2 Morelli 2 Mora 2 Mor 2 Moorhouse 2 Moon-Massat 2 Moonen 2 moody 2 mood-congruent 2 Montoya 2 Monti 2 montage 2 monster 2 Monsivais 2 monosyllabic 2 monolayers 2 monochromatic 2 Monk 2 Mongan 2 Molnar 2 Molinaro 2 Molina 2 Molenaar 2 mole-cules 2 Mok 2 Mojana 2 Mohammad 2 Moghanaki 2 Mogg 2 Moerman 2 modulus 2 modelof 2 Mochizuki 2 mobilizes 2 Moayeri 2 Moawad 2 MMNs 2 MMM 2 mm-diameter 2 MJL 2 Mizoguchi 2 Miyazaki 2 mixed-model 2 mixed-effect 2 Miura 2 Mitofusin 2 mitochon-dria 2 mitochon 2 mitigating 2 mitigates 2 Mitani 2 Mitamura 2 mission 2 miss 2 Misra 2 misplacement 2 mismatches 2 misinterpreted 2 misinterpretations 2 misconceptions 2 misconception 2 Mirza 2 Miro 2 Mirnics 2 Miriam 2 Mirelman 2 miR-31 2 miR-191 2 miR-182 2 miR-126 2 miR-125b 2 MiR-122 2 miR-10a 2 miR-103 2 Miquel 2 Mipomersen 2 Minthon 2 Minn 2 Ministers 2 miniscule 2 minimization 2 minimise 2 Minder 2 Minckwitz 2 Minato-ku 2 Milyavsky 2 Miltner 2 Milpark 2 Milman 2 milliliters 2 Milliken 2 Mikula 2 migrate 2 migrants 2 Mignogna 2 Mier 2 midwife 2 Midwest 2 midway 2 midsternum 2 midst 2 Mid-pregnancy 2 midlife 2 mid-cingulate 2 midCC 2 mid-1990s 2 microtubule-interacting 2 Microsphere 2 Microsc 2 microRNAsin 2 microRNA-29 2 microRNA-21 2 micro-RNA 2 Microparticles 2 micrometastases 2 microm 2 microliter 2 microgram 2 microglial-conditioned 2 microglia-conditioned 2 microflora 2 microenvironmental 2 micro-environment 2 micro-dissection 2 microangiography 2 microaneurysms 2 Michelson 2 Michele 2 Michaille 2 Michaely 2 Michaelson 2 -mice 2 MIC 2 MIAT 2 MHT 2 MHS 2 MHP 2 MHC-restricted 2 MHC-defined 2 MHA 2 mGyIcm 2 mGy 2 MgSO4 2 mgI 2 Mezei 2 Meynert 2 Meyenfeldt 2 Metson 2 methyloxime 2 methylnitrosamino 2 methyl-groups 2 Methyl-folate 2 methylene-tetrahydrofolate 2 methylation-specific 2 methylate 2 Methodologically 2 methodologic 2 meters 2 meter 2 metazoans 2 meta-regression 2 metaphysics 2 MetaMorph 2 Metamizole 2 meta-cognitive 2 metacognitive 2 metabotropic 2 metabolized 2 metabolize 2 metabolisme 2 mesoscale 2 mescaline 2 Merrill 2 Merino 2 Merali 2 Mepham 2 Menzieset 2 Menu 2 Mentzel 2 Mentored 2 mentions 2 menopause 2 Menni 2 meningioma 2 Mendlowitz 2 Mena 2 Memon 2 membranous 2 Melville 2 melts 2 Melles 2 Melino 2 Meliga 2 Melia 2 Meleth 2 melanotropin 2 Mejetta 2 Meikle 2 Meijer 2 Meigs 2 Mei 2 Mehedint 2 Meerloo 2 Meemon 2 Meek 2 Medwatch 2 medullary 2 MedSci 2 Medrad 2 medpac 2 mednet 2 Medizinische 2 medium-sized 2 medium-income 2 meditation 2 medicolegal 2 Medicare-certified 2 Medica 2 -mediated 2 mediacentre 2 MedHub 2 MeCP2 2 mechanization 2 meat 2 Meanwhile 2 meantime 2 meaningfully 2 Meadway 2 Meador 2 MDT-15-regulated 2 MDT-15-NT 2 MDT-15-KIX 2 MDT-15DKIXDCT 2 MDT-15-binding-transcription 2 MD1 2 McVeigh 2 mCT 2 McSweeny 2 Mcritchie 2 McNemar 2 McNamara 2 MCMxxxVI 2 McMillan 2 McMichael 2 McMahon 2 McHeyzer-Williams 2 McGillem 2 McGeechan 2 McGeary 2 McDonough 2 McDonnell 2 McDermott 2 McDaid 2 McCurdy 2 McCuaig 2 McCoul 2 McBain 2 McAteer 2 Mazziotta 2 Mayer-Kress 2 Maya 2 Maxwell 2 maximization 2 Maxima 2 maxillae 2 Maugui 2 Maughan 2 Mauer 2 Mauch 2 Maturi 2 Mattie 2 Matsuoka 2 Matsunaga 2 Matsumoto 2 Matsui 2 matings 2 Mathis 2 Matherly 2 mathematically 2 Mater 2 matching-based 2 matches 2 Matas 2 Massimo 2 Maslon 2 maskers 2 Mash 2 Mases 2 Maschauer 2 Masanori 2 Maruyama 2 Martirosian 2 Martino 2 Martini 2 Martinez-Hernand 2 Martinet 2 Martijn 2 Marti 2 Martelli 2 Martel 2 Marta 2 marriage 2 Marquez 2 Marone 2 Markup 2 marking 2 MarketScan 2 markets 2 Marisa 2 Marinus 2 Marilyn 2 Marienkrankenhaus 2 Mariampillai 2 Mariakerke 2 Marengoni 2 Marek 2 Marcinek 2 Marcia 2 Marchetti 2 Marcel 2 Marcantonio 2 Maranzano 2 Maraldi 2 Maor-Aloni 2 manufacturing 2 manufacture 2 Mantovani 2 mantle 2 Mansouri 2 Man-Son-Hing 2 Manson 2 Mansfield 2 Mansell 2 Mannerkorpi 2 Manivannan 2 manikins 2 manifold 2 Mangano 2 mandibular 2 mandible 2 Mandel 2 Manchikanti 2 Manassis 2 mammoth 2 Maminishkis 2 Mami 2 Mamah 2 Malyarenko 2 Maltenfort 2 malnourished 2 Mallory 2 Malley 2 Maller 2 Malina 2 Malcolm 2 malaise 2 Makrythanasis 2 makeup 2 Majamaa 2 Maiuri 2 Maitland 2 mainstream 2 Maino 2 Maingay 2 Maier 2 Mai 2 Mahwah 2 Mahmood 2 Maheshwari 2 Mahadev 2 Mah 2 magnifying 2 magnetization 2 Magforce 2 Magee 2 Magdeburg 2 MAG2 2 Maemondo 2 Madsen 2 Madinier 2 Madigan 2 maculardystrophy 2 Macroautophagy 2 MacQueen 2 MacNeilage 2 MacLellan 2 Machtay 2 MacCallum 2 Macario 2 Macaca 2 Maat 2 Maas 2 Maahs 2 Ma2 2 Lysens 2 lysate 2 Lyoo 2 Lyness 2 lymphoe-dema 2 lymphangiogenesis 2 Lyman 2 lying 2 LY294002 2 Lutjohann 2 Lupien 2 Luper 2 Luong 2 Lunardon 2 lumpectomy 2 lump 2 luminance 2 Luis 2 Lui 2 Luebeck 2 Ludwigshafen 2 Ludlowet 2 Ludhiana 2 Luda 2 Luckhaus 2 Lucio 2 Luce 2 LTP 2 LR12ES05 2 LPS 2 loxP 2 Lowy 2 low-value 2 Lowsky 2 low-quality 2 low-pass 2 low-grade 2 low-frequency 2 lowers 2 lower-income 2 lower-cost 2 lower-body 2 low-cost 2 low-blocking 2 low-birthweight 2 low-back 2 Low-Attenuation 2 low-and 2 loved 2 loudspeakers 2 Loucks 2 Lorf 2 Lorenzo-Betancor 2 Lord 2 LoQ 2 Loo 2 Lonial 2 Longstreth 2 longevityin 2 longevity-associated 2 Long- 2 Lommatzsch 2 Loma 2 Lokshin 2 Lohse 2 log-transformed 2 logrank 2 Logopaedica 2 logistical 2 Logemann 2 Logean 2 logarithmically 2 logarithm 2 log2 2 Loffing 2 Loes 2 Loenneke 2 Loeber 2 Loduca 2 lodge 2 LoD 2 loco-motor 2 Lockley 2 locking 2 Locker 2 lobules 2 lobule 2 lobectomy 2 Loane 2 LNCS 2 LNA-mediated 2 lMAb 2 Lluis 2 Llorens 2 Lleida 2 livestock 2 liver-specific 2 litre21 2 litre-1 2 listing 2 liquids 2 Lipton 2 Lippi 2 lipoprotein-derived 2 Lipoprotein-associated 2 lipophilicity 2 lipogenic 2 Lint 2 Linnertz 2 Linkages 2 lin-14 2 limbal 2 Likert-type 2 likened 2 lij 2 lights 2 lighter 2 light- 2 ligations 2 ligament 2 lifting-type 2 lifter-tilter 2 life-year 2 Lifespans 2 lifelong 2 Liew 2 Liesenfeld 2 Lieberman 2 Lidor 2 Lidegaard 2 Liddell 2 Lidcombe 2 LiCl 2 Lichtner 2 Lichter 2 licensees 2 libraries 2 librarian 2 Libina 2 liberta 2 Liakopoulos 2 liability 2 LFS 2 lez 2 lexicon 2 Lexer 2 Lewy-like 2 Lewybody 2 Lewiss 2 levonorgestrel-based 2 levelsof 2 Leveling 2 Leval 2 leupeptin 2 Leukoreduction 2 leukomalacia 2 leukocytosis 2 Leukoc 2 Leukoaraiosis 2 Leukemic 2 leucopenia 2 Leucine 2 LETM 2 let-7 2 lesioning 2 Lerman 2 Leriche 2 Leopold 2 Lenze 2 Lenz 2 lenticular 2 Lenth 2 Lenten 2 Lengyel 2 lengthens 2 Lemaitre 2 Lemaire-Ewing 2 LEM 2 Leighton 2 Leif 2 Leidecker 2 Lei 2 Lehr 2 LeGuern 2 Legood 2 Legends 2 leftward 2 Lefkowitz 2 LEF1 2 Leer 2 Leentjens 2 LeeJI 2 Leedham 2 Lecleire-Collet 2 Lechner 2 Leboyer 2 leaves 2 least-squares 2 least1 2 learning-impaired 2 leaner 2 Leandro 2 leaked 2 leader 2 LE100100074 2 L-dopa 2 LB-inoculated 2 LB-enriched 2 LBD 2 lban 2 Lazzarini 2 lays 2 Lavie 2 Laupacis 2 launching 2 laudable 2 Laub 2 lattice 2 Latsoudis 2 Latex 2 late-stage 2 later-life 2 Lasta 2 Lasser 2 Lasky 2 laryngospasm 2 laryngectomy 2 Larvor 2 large-mass 2 Lara 2 laptop 2 Lapses 2 Laplante 2 Lapinlampi 2 lapatinib 2 Laparosc 2 Lanuzza 2 Lantz 2 Lansbury 2 Langley 2 land-use 2 Landrigan 2 LAMP-2A 2 Lamoureux 2 lamotrigine 2 LaMonte 2 Lammertsma 2 laminectomy 2 Lamina-specific 2 Lamei 2 lamada 2 Lallemand 2 Lakso 2 lags 2 Lagos 2 Ladouceur 2 lacunes 2 lacunae 2 lactation 2 Lache 2 laceration 2 LaBranche 2 laboratory-induced 2 Laaksonen 2 L142 2 L141 2 L140 2 L138 2 L136 2 Kyung 2 Kwon 2 KWM 2 Kwekkeboom 2 Kwan 2 K-variate 2 Kutas 2 Kurzberg 2 Kurz 2 Kurumada 2 Kurtz 2 Kur 2 Kuniszyk-Jozkowiak 2 Kummer 2 Kumar-Singh 2 Kuhrt 2 Kruse 2 Krumholz 2 Kruizinga 2 Krug 2 Kruer 2 Krueger 2 Kron 2 Kroenke 2 Kristine 2 Kristiansen 2 Kringelbach 2 Krieger 2 Krenning 2 Kreiskliniken 2 Krediet 2 Kraner 2 Krane 2 Krammer 2 Kourie 2 Koubova 2 Kotz 2 Kots 2 Koteras 2 Kosarev 2 Korotkova 2 Koropatnick 2 Kornhuber 2 Korner-Bitensky 2 Korman 2 Korkhov 2 Korff 2 Koren 2 Kopitz 2 Kopecek 2 Koopman 2 Konishi 2 Konduru 2 Komune 2 Kompella 2 Kolukula 2 Kolmogorov 2 Kollen 2 Kolibianakis 2 Kolesnikov 2 Kolassa 2 Kokubun 2 Koibuchi 2 Kohsaka 2 Kohrt 2 Kohl 2 Koeth 2 Koen 2 Koda 2 Kochkorov 2 Kobinger 2 Knuttinen 2 Knupp 2 Knott 2 knew 2 Kneitz 2 Knecht 2 Klungland 2 Klug 2 Klucken 2 Klotz 2 Kloet 2 Klironomos 2 Kleper 2 Klement 2 Kleinman 2 Klassen 2 Klass 2 Klais 2 Kitteringham 2 Kittel-Schneider 2 Kita-ku 2 Kitagawa 2 Kirschner 2 Kirkwood 2 Kirk 2 Kirchner 2 Kings 2 Kinet 2 kindly 2 kinase-mediated 2 kinase-MB 2 Kinanthropologie 2 KimKK 2 Kimble 2 Kimberly 2 killed 2 Kieffer 2 ki67 2 Khurana 2 Khrapko 2 Khoury 2 Khosla 2 Khoobehi 2 Khalsa 2 Khaliq 2 Khajavi 2 Keyser 2 Keuls 2 Kettner 2 Kettle 2 Kettenmann 2 Kessels 2 Kerse 2 Kerr 2 Kerner 2 Kerkeni 2 Ker 2 Keppel 2 Kentucky 2 Kenney 2 Kendal 2 Kenan 2 Kemper 2 Kempen 2 Kemp 2 Kemmerer 2 Kell 2 Keliher 2 Kehm 2 keeps 2 Keeler 2 Keedwell 2 Keck 2 Keay 2 Kearvell 2 Kearns 2 Kazmierczak 2 Kaza 2 Kayed 2 Kawiak 2 Kawai 2 Kawahara 2 Kautz 2 Kaushal 2 Kauppinen 2 Katholieke 2 Katamay 2 Kasuga 2 Kastner 2 Kasten 2 Kashyap 2 Kasabwala 2 Karsten 2 Karpinar 2 Karls 2 Karger 2 Karel 2 Kapur 2 Kaplitt 2 Kapik 2 Kaoru 2 Kao 2 Kanwar 2 Kantonsspital 2 Kang-Yi 2 Kane 2 Kandoth 2 Kanda 2 Kanagawa 2 Kan 2 Kamp 2 Kamihira 2 Kameyama 2 Kamer 2 Kamel 2 Kalvaram 2 Kalmar 2 Kalim 2 Kalet-Litman 2 Kalervo 2 Kahokehr 2 Kahana 2 Kager 2 Kagemann 2 Kachko 2 Kabitz 2 Kaan 2 K6 2 k5D 2 K24 2 K23 2 K16Ac 2 K01 2 juxtacortical 2 Juul 2 justification 2 jury 2 junk 2 Jumah 2 Julin 2 juglone 2 Juergen 2 jsp 2 J-Q 2 JQ 2 JPA 2 Joy 2 Journalof 2 Joshi 2 Jordan 2 JOphthalmol 2 Joosten 2 Joniau 2 Jongno-gu 2 Jonet 2 Jonasson 2 Jon 2 Joly 2 Jolly 2 Jokela 2 Johnstone 2 Joerg 2 Joep 2 Joe 2 jobs 2 JMP 2 JMA 2 jlnute 2 J-L 2 Jing 2 Jimmieson 2 Jimenez 2 jiL 2 Jikei 2 JHB 2 Jha 2 JFP 2 Jersey 2 Jeroen 2 Jeppesen 2 Jeon 2 Jennings 2 jelly 2 Jelleyman 2 Jefferson 2 Jayne 2 Javier 2 Jarosek 2 Jarczok 2 Janzer 2 Janowski 2 Janik 2 Janezic 2 Janakiraman 2 Jana 2 Jamar 2 jamaophthalmol 2 Jalili 2 Jakes 2 Jairo 2 jackets 2 Jablensky 2 -J 2 Izabella 2 I-you 2 IWT 2 Iwanicki 2 IVFA 2 Ivey 2 IUNA 2 Ittichaikulthol 2 Italics 2 italic 2 Italiana 2 Ital 2 Ista 2 issue-8 2 Issaeva 2 ISRCTN29313500 2 ISRCTN20141297 2 Israni 2 I-SPY 2 isotropic 2 isogenic 2 isoenzyme 2 Isnard 2 ISMRM 2 islet 2 Ishikawa 2 Ishida 2 Ischiropoulos 2 ischial 2 ISBI 2 Isarna 2 Isabel 2 IRS2 2 irritation 2 irrelevant 2 Ire 2 iovs 2 iosifescu 2 Iorio 2 iopromide 2 ionizing 2 ionization 2 iom 2 iodized 2 invoking 2 invitation 2 invisible 2 investment 2 investigates 2 Investi 2 invested 2 inventor 2 invariably 2 invalidate 2 intussusception 2 intuitively 2 intrusive 2 intrudes 2 intronic 2 Intriguingly 2 Intravitreous 2 intratumoral 2 intrathecally 2 intra-thecal 2 intrastriatal 2 intrasedation 2 intraindividual 2 intrahepatic 2 intrafascicular 2 intrafamilial 2 intraepithelial 2 intraepidermal 2 intracortical 2 intracommunity 2 intra-cellular 2 intraassay 2 intra-arterial 2 Intoxication 2 intima-media 2 intervened 2 intersphincteric 2 interspersed 2 interspecies 2 interset 2 interscalene 2 interruptions 2 interposed 2 interphotoreceptor 2 interoception 2 internship 2 interneuron 2 Intermolecular 2 intermittently 2 intermediate-to-high 2 intermediate-risk 2 interleukin-2 2 interleaved 2 inter-laboratory 2 inter-judge 2 interindividual 2 interhemispheric 2 intergenic 2 interferometer 2 interdigitation 2 interdependent 2 intercomparison 2 intercommunity 2 interchangeable 2 intercept 2 inter-action 2 interacted 2 intensively 2 intelligent 2 Intellect 2 Intel 2 integrations 2 insured 2 insulas 2 insuffiation 2 insuffcient 2 Instrument-3 2 instructing 2 instituting 2 instant 2 installed 2 install 2 inspiration 2 INSPEC 2 insightful 2 in-season 2 inPD 2 inositol 2 inosine 2 Inorg 2 Innsbruck 2 innervated 2 innervate 2 innermost 2 ink 2 injurious 2 injection-controlled 2 INIH 2 in-house 2 inhibitor-based 2 Inherit 2 ingredient 2 Ingle 2 Ingelheim 2 infrequently 2 infraumbilical 2 Infrapatellar 2 in-frame 2 infragluteal 2 informs 2 informants 2 inflation 2 Inflammation-based 2 inflammation-associated 2 inflammaging 2 inflamed 2 Infirmary 2 infinity 2 infinite 2 infiltrates 2 infer 2 infection-related 2 infantile 2 inelastic 2 inefficient 2 inefficiency 2 inducers 2 inducer 2 -induced 2 indopamine 2 indoor 2 individualization 2 indium 2 indirectness 2 Indiana 2 independent-sample 2 indelible 2 incubating 2 incredible 2 in-crease 2 incorporates 2 Incontinence 2 inclusive 2 incipient 2 Incidentally 2 Ince 2 inattention 2 I-Nanobody 2 inadvertent 2 inadequacy 2 inactivates 2 inactivate 2 inaccuracy 2 in36 2 in- 2 IMSUT 2 impute 2 impulsivity 2 impulses 2 Imposing 2 implied 2 implicitly 2 implicit 2 impinge 2 impeded 2 impedance 2 imparts 2 impacting 2 immunotherapies 2 immunostainings 2 immunopositive 2 immunophenotype 2 immuno-PET 2 Immunolocalization 2 immunohisto-chemistry 2 immuno-histochemical 2 Immunohisto-chemical 2 immunoglobulins 2 Immunofluorescent 2 Immunocytometry 2 immunoblotted 2 Immunobiology 2 immunoassay 2 immunoadsorption 2 Immunization 2 immune-modifying 2 imminent 2 immediate-release 2 IMIM-Hospital 2 IMFS 2 IMFC 2 imbued 2 imbedded 2 imbalanced 2 Imamura 2 imaginary 2 imagers 2 ImageQuant 2 image-based 2 imageable 2 Ilyinskaya 2 Ilyas 2 illusion 2 illuminated 2 illuminate 2 Illig 2 illegal 2 Illarioshkin 2 Ilijic 2 Ilhan 2 ileostomy 2 IL6ST 2 IL-2R 2 IL-23 2 IL-22 2 IL-2 2 IL-10 2 Ikram 2 IkBalpha-mediated 2 IJzendoorn 2 IIx 2 I-it 2 I-III 2 IIIc 2 -III 2 I-II 2 Iida 2 IHR 2 IHC 2 Ignoring 2 ignores 2 Iglesias 2 IGF-I 2 IGF-1R 2 IgF 2 IGEMS 2 IgA 2 IFN-gamma 2 IFN-b 2 IFN- 2 IFN 2 IFCC 2 Iezzi 2 Iekushi 2 IDRC 2 idle 2 Idiaz 2 ideation 2 ICU-level 2 icts 2 ICSmaleSF 2 ICSI 2 ICRU 2 ICREA 2 ICL 2 ICIP 2 Ichise 2 ICD-9-CM 2 ICCs 2 ibsen 2 Ibanez 2 Iba1 2 IAUCs 2 Iannitti 2 Iams 2 Iamaroon 2 Iacopo 2 IAC 2 Hyuk 2 hypoxic-ischemic 2 hypovascular 2 hypothyroidism 2 hypothalamo-pituitary-adrenal 2 hypothalamic 2 Hypotensive 2 hyporesponsiveness 2 hypopharynx 2 hypomorph 2 hypo-fluorescent 2 hypoalgesic 2 hypo 2 hyperthermia 2 hypersensitive 2 hyperpigmentation 2 hypermethylation 2 hypermethylated 2 hypermetabolic 2 hyperlocomotion 2 hyperkalemia 2 hyperhomocysteinemia 2 hyperglyce-mia 2 hyperfluorescence 2 Hyperemic 2 Hyper-CK-Emia 2 hyperbaric 2 hyperarousal 2 hyperactive 2 hyoepiglottoplasty 2 Hynes 2 Hylton 2 hydroxymethylbilane 2 hydroxycotinine 2 hydroxyapatite-based 2 hydrophobicity 2 hydrolyzed 2 hydrolases 2 Hydrocortisone 2 hydrocephalus 2 hydration 2 Hycult 2 hybridize 2 hybridisation 2 HWE 2 Hvalby 2 Huyvetter 2 Huxley 2 Hutter 2 Hutson 2 Huskamp 2 Hurst 2 hurry 2 hurdles 2 Hupp 2 Huotilainen 2 Huot 2 Hungary 2 Humphrey 2 humor 2 Humayun 2 Humanities 2 humanalpha-synuclein 2 Humana 2 Hultcrantz 2 Hulsew 2 Hulme 2 Hullu 2 Hulley 2 Hulette 2 Huguet 2 Hugosson 2 Hugonot-Diener 2 Hugh-Jones 2 Huemer 2 Hubel 2 Hubble 2 HTLV-I 2 HTLV-1-infected 2 Hsueh 2 HSPA5 2 hSNCA140driven 2 Hsin-Chu 2 HSFC 2 HSC 2 HRs 2 HRR 2 HRI 2 H-RasV12 2 HRA2 2 HQID 2 hp2010 2 HP2 2 HOXB5 2 Howells 2 Houwelingen 2 Houghton 2 Hougaard 2 Houenou 2 Houde 2 hotspot 2 host-to-graft 2 hostel 2 hosted 2 Hospitalier 2 Hoser 2 Horwitz 2 Horvat 2 Horstmann 2 horse 2 Horozoglu 2 Hornak 2 Horger 2 Hopson 2 Hoppel 2 Hoogeboom 2 Hoog 2 Hoofwijk 2 Hons 2 Honour 2 Honolulu 2 Honeycombs 2 Honda 2 homozygote 2 homotypic 2 homogenate 2 home-schooled 2 homeo-static 2 homeo-stasis 2 homeodomain 2 home-built 2 HOMA 2 Holzmueller 2 Holzmann 2 Holzman 2 Holzenberger 2 Holy 2 Holtzman 2 Holton 2 Holst 2 Holloway 2 Holloszy 2 Hollenbeck 2 holiday 2 Holger 2 Holder 2 Holden 2 Hogg 2 Hogben 2 Hoffman-Zacharska 2 Hoffer 2 Hoellenriegel 2 Hoeken 2 Hodgkin 2 Hobbs 2 HMC 2 HM1078 2 hler 2 HLA-DR 2 HIV-specific 2 Histomorphometric 2 histomics 2 histocompatible 2 histocompatibility 2 histochemically 2 Hirst 2 Hiromitsu 2 Hirata 2 hips 2 hippocampi 2 HIPAA-compliant 2 HIPAA 2 hints 2 hinders 2 him 2 Hilven 2 Hiltunen 2 Hilten 2 Hildebrandt 2 Hilbert 2 high-penetration 2 high-lighting 2 high-gain 2 high-flow 2 high-fidelity 2 highest-volume 2 higher-grade 2 high-degree 2 High-definition 2 high-capacity 2 high-altitude 2 Higashi 2 hierarchy 2 Hiele 2 Hidding 2 Hidalgo 2 Hickok 2 HGPS 2 Heydt 2 Hewitt 2 Heward 2 Heussy 2 Heussen 2 heterotopias 2 heteroplasmy 2 heterogeneities 2 heterodyne 2 Het 2 Hess 2 hesitant 2 Herzig 2 Herranz 2 Herr 2 herniation 2 Hernanz 2 Hern 2 Hermansen 2 Herlev 2 heritage 2 Hergenreider 2 here-to-fore 2 heretofore 2 Heredia 2 hereby 2 Hercules 2 herbal 2 HER-2 2 hepato-cellular 2 Henze 2 Hennings 2 Hennessey 2 Hendargo 2 henceforth 2 hemostasis 2 Hemopure 2 hemoptysis 2 Hemodynamics 2 hemispherectomy 2 hemiplegic 2 hemiarthroplasty 2 heme-arginate 2 hemearginate 2 hematological 2 Helsen 2 helpless 2 Hellums 2 Hellmut 2 helix 2 helical 2 Helfand 2 Helb 2 HEK 2 Heinemeier 2 Heights 2 Heidegger 2 Hef 2 Hee 2 hedonic 2 Heddle 2 Heckelman 2 heat-shock 2 heating 2 Hearne 2 healthliteracy 2 Healthc 2 Heagerty 2 headquarters 2 headphones 2 headphone 2 head-hanging 2 head-and-neck 2 HD-OCT 2 HDL-like 2 hazardous 2 Haywood 2 Haynes 2 Hayhow 2 Haworth 2 Haveman-Nies 2 Hausler 2 Hausel 2 Haupt 2 Haugarvoll 2 Hauff 2 hatred 2 Hatley 2 hatched 2 Hatch 2 Hastie 2 Haslam 2 Hashad 2 HAS-Flow 2 Hasegawa-Johnson 2 Hasegawa 2 Harwell 2 Harvey 2 Hartnett 2 Harth 2 Harsten 2 harsh 2 Harrington 2 Haro 2 harmonization 2 Harmer 2 Harley 2 Hariharan 2 Hari 2 Hargreaves 2 hardware 2 Hardiman 2 hardening 2 Hardarson 2 harbour 2 harbors 2 Harb 2 Harary 2 Harari 2 haptic 2 Hans 2 Hannover 2 Hannon 2 Hannigan 2 Hanley 2 Hanks 2 Hanekamp 2 hand-off 2 handles 2 hand-held 2 handful 2 hamsters 2 Hampson 2 Hampshire 2 hampered 2 Hampel 2 Hammond 2 Hammami 2 Hambrecht 2 Hamamy 2 Haluzik 2 halt 2 hallucinatory 2 Hallan 2 halflives 2 halflife 2 Halevy 2 Halcox 2 Halabi 2 Hajioff 2 Haines 2 Haimovici 2 haemorrhagic 2 haemoglobinopathies 2 haematopoietic 2 Hacke 2 habituated 2 Habib 2 H1-haplotype 2 H1299 2 gynecological 2 gynecologic 2 Guzman 2 Guymer 2 Guyer 2 Guthridge 2 Gustavsson 2 Gustave 2 Gustafsson 2 Gurha 2 Guntinas-Lichius 2 Gunning-Dixon 2 Gunning 2 Gunn 2 Gulseren 2 Gulcan 2 Guinan 2 guilty 2 Guillou 2 Guillermo 2 Guilera 2 Guidi 2 guez 2 Guerra 2 Gudkov 2 Gudbjartsson 2 Guda 2 GuazziM 2 guardians 2 guarantees 2 guanidine 2 Guadalajara 2 GTS-plus 2 GST-IkBalpha 2 gst-4p 2 gst-4 2 gst 2 GSM744581 2 GSK-3 2 GSK1120212 2 GSE24011 2 GS101-P3-CG 2 Gruyter 2 Grulkowski 2 Grugan 2 growths 2 growth-curve 2 grows 2 Grove 2 group-administered 2 Grotta 2 Groth-Marnat 2 Grossman 2 Groschl 2 Grogan 2 Grocott 2 Gris 2 Grimes 2 Griggs 2 Gretchell 2 Gresa-Arribas 2 Grehl 2 Gregor 2 Greenhill 2 greengrocers 2 greedy 2 GRECO 2 Greaves 2 gray-scale 2 gravid 2 gratitude 2 Graser 2 Grasedieck 2 Grasby 2 graphing 2 Graph-Based 2 granulocyte-macrophage 2 granulocyte 2 granularity 2 Granot 2 grand-mean 2 grandiosity 2 Grammer 2 grafting 2 graft-infiltrating 2 Gracia 2 G-protein 2 GPC 2 governmental 2 governed 2 Governance 2 Gourbali 2 Gould 2 Goudswaard 2 Gottschalk 2 Gotlib 2 Gotay 2 Gosh 2 Gorman 2 Gorlia 2 Gorisse 2 Gordiyenko 2 Gorczynska 2 GoodRx 2 Gonzalez-Fernand 2 Gonz 2 Goni-Oliver 2 Gona 2 Gomez-Isla 2 Gomez 2 Golub 2 Gollisch 2 Goll 2 gold-standard 2 Goldsmith 2 Goldner 2 Golaz 2 Goiania 2 Goh 2 Goff 2 Goetzinger 2 Godefroy 2 Gobbledygook 2 Gobbi 2 goaltenders 2 goal-directed 2 GMH 2 GM-CSF 2 Glynn 2 Glyn 2 -Gly-Glu- 2 glycosylated 2 Glycogenosis 2 glycogenolytic 2 glycerol 2 Glybina 2 Glx 2 glutamyl 2 glutamicpyruvic 2 glue 2 glucocorti-coid 2 glub 2 gloves 2 globus 2 globally 2 gliosis 2 gliopathy 2 glio-blastoma 2 glioblas-toma 2 Glimcher 2 Glier 2 gler 2 Gleichman 2 Gleich 2 GlaxoSmithKline 2 Glauer 2 Glashouwer 2 Glamser 2 Glaeser 2 Gladyshev 2 Gjerdrum 2 Givol 2 Gisslen 2 gis 2 girth 2 Giron 2 Giri 2 Girardini 2 Giorgi 2 Ginsburg 2 Ginsberg 2 Gilson 2 Gilmartin 2 Gilliam 2 Gillette 2 gill 2 Gil-Flamer 2 Giddens 2 Giant 2 Ghilardi 2 Ghez 2 Ghetti 2 Gherghel 2 Ghafouri-Fard 2 Ghafourifar 2 Geurts 2 gesture 2 Gesi 2 Geschwind 2 gerontology 2 Geroldi 2 germinal 2 German-wide 2 German-speaking 2 germanium-based 2 Germain 2 Gerd 2 Gerbrand 2 Geppert 2 GEO-PD 2 geography 2 genuine 2 Gentra 2 gentle 2 gentamicin 2 Gen-Probe 2 genotype-phenotype 2 genomewide 2 genome-scale 2 genomes 2 genocide 2 genital 2 geniohyoidpexy 2 generous 2 generators 2 gene-centric 2 Genead 2 gene15 2 gender-specific 2 GenAge 2 Gemstone 2 Gemignani 2 Gellis 2 Geller 2 Geiss 2 Geisler 2 Geiser 2 Gehrs 2 Gehlbach 2 GEHA 2 Geertzen 2 Geerard 2 Geddes 2 Gebhardt 2 Ge-68 2 GDS 2 Gc-globulin 2 GCeMS 2 GBq 2 Gaziano 2 Gaynor 2 Gaylor 2 Gay 2 Gawande 2 gavage 2 gauging 2 gauged 2 gathering 2 gather 2 gated 2 Gatchel 2 gastroesophageal 2 gastroenteritis 2 Gast 2 Gass 2 Gaspar 2 Gaskell 2 Garlipp 2 Garimella 2 Garfinkel 2 Garcia-Rios 2 Garcia-Reitbock 2 GAO-04-110 2 Ganos 2 Gambhir 2 Galuppo 2 Galter 2 Galluzzi 2 Gallardo 2 Galia 2 Galert 2 Galea 2 Galb 2 Galasko 2 Gal4DBD-MDT-15tm2182 2 Gaithersburg 2 Gainetdinov 2 Gail 2 gadopentetate 2 Gadagkar 2 Gad 2 Gabriel 2 Gabovits 2 Gabbett 2 gaba-pentin 2 GABAAR 2 G88C 2 G3 2 G245S 2 G245D 2 G245C 2 G2019S 2 G12D 2 futile 2 Fussell 2 Fusi 2 Furuyama 2 Furukawa 2 furthers 2 furthering 2 Furth 2 Furey 2 Funk 2 Fundusautofluorescence 2 Fumeron 2 full-scale 2 full-dose 2 Fukuoka 2 Fujioka 2 fuels 2 fueled 2 Fudan 2 Fuchslocher 2 Fry 2 Frueh 2 fructose 2 fronto-temporal 2 fronto-occipital 2 front-loading 2 Frontiers 2 froma 2 from0 2 frog 2 Froehling 2 Fritzberg 2 Frith 2 fringes 2 friends 2 Frieling 2 Friedrich 2 Friederici 2 friction 2 Freud 2 Freiesleben 2 Freiburg 2 Fregion 2 Freeze-thaw 2 freezer 2 free-survival 2 free-breathing 2 Frederick 2 Fredberg 2 Frazier 2 fraught 2 Frattini 2 Frattarelli 2 Franssen 2 Franois 2 Frankel 2 Frangou 2 Francom 2 Francolini 2 Franck 2 Francesco 2 Franceschi 2 Frances 2 Framme 2 framed 2 fragile 2 FP7 2 FOVof 2 fovealcone 2 fovea-centerd 2 four-way 2 Fournier 2 Four-month 2 four-level 2 foundto 2 Foundas 2 Foulon 2 Foukas 2 fostering 2 fostered 2 fossa 2 Foss 2 Forty-one 2 Forty-five 2 Fort 2 Forschungsf 2 Fornito 2 Fornai 2 formulated 2 formulate 2 formalized 2 forIkBalpha 2 forgotten 2 forgetting 2 Forget 2 foremost 2 forehead 2 forclinical 2 forchronic 2 Forbes 2 footnote 2 fonts 2 Fontanesi 2 Fontainhas 2 font 2 Fonds 2 follow- 2 follicular 2 folds 2 folded 2 FokI 2 Fog 2 fmrib 2 fMR 2 flush 2 flurbiprofen 2 fluorophore 2 fluorodeoxyglucose 2 fluorescently-labeled 2 fluoresce 2 flumazenil 2 fluid-phase 2 fluently 2 fluctuating 2 flowmetry 2 flowing 2 flower 2 Flint 2 flight 2 Flickering 2 Flesch-Kincaid 2 Flesch 2 Flemish 2 Fleissner 2 fleeting 2 flawed 2 flattening 2 flasks 2 FlashTag 2 flanked 2 Flanders 2 Flachsbartet 2 Flach 2 fixations 2 Fix 2 fivefold 2 fistulas 2 FISOGNI 2 fishes 2 Fishbein 2 Fiset 2 fiscal 2 first-trimester 2 first-stage 2 first-round 2 first-pass 2 firstly 2 firmly 2 firing 2 Fiorito 2 Fiona 2 Finke 2 fingers 2 fine-tuning 2 finely 2 Finegold 2 fined 2 Fineberg 2 finder 2 financial-incentive 2 finance 2 finalised 2 filetype 2 Figures3G 2 FigureS2I 2 Figures1C 2 Figure6D 2 Figure5F 2 Figure4F 2 Figure4D 2 Figure4C 2 Figure3E 2 Figure3C 2 Figure2N 2 Figure2I 2 Figure2G 2 Figure2 2 Figure1A 2 Fig-ure 2 Figueiredo 2 Figiel 2 Fielenbach 2 fibrocystic 2 Fibrinolysis 2 fibril 2 fiber-based 2 Fiala 2 fi 2 FGF-21 2 FFA 2 FF 2 FEV 2 Feumi 2 Feuer 2 fertile 2 ferrocyanide 2 Ferretti 2 Ferreira 2 Ferraris 2 Ferrarese 2 Ferraguti 2 Ferracin 2 Fernstrom 2 Fernanda 2 Fernagut 2 Ferdinand 2 femur 2 femininity 2 Feldt 2 Feigl 2 Feeney-Burns 2 Feener 2 feed-forward 2 feedback-seeking 2 Federmeier 2 Feder 2 FcyR 2 FCM 2 FCGR3A 2 Fayad 2 favors 2 favorite 2 favored 2 Favaro 2 Fava 2 fault 2 fatigue-induced 2 fatigability 2 fathers 2 fatality 2 fasted 2 FASE 2 fasciculus 2 fascicularis 2 Farvolden 2 Farrington 2 farnesyl 2 Fariss 2 Farinas 2 Farhat 2 fared 2 Farcas 2 Farb 2 Faouzi 2 Fanselow 2 Fandio 2 familywith 2 family-history 2 familiarized 2 familiarize 2 Falsini 2 false-negative 2 fallers 2 Fagan 2 Fadzil 2 factor-kB 2 factor-1 2 factor- 2 FACSM 2 FACSCalibur 2 facilitation 2 Fabrizio 2 Fabiola 2 Fabi 2 -F 2 Eysteinsson 2 exudation 2 extremes 2 extrasynaptic 2 extrapyramidal 2 extrapolating 2 Extraneurally 2 extra-medullary 2 extra-cellular 2 extracapsular 2 extensible 2 ext 2 export 2 explorations 2 exploits 2 explants 2 explanted 2 EXPLAN 2 expire 2 expertly 2 Experientia 2 experience-dependent 2 experi 2 expending 2 expend 2 exhaust 2 exercised 2 exempt 2 excursions 2 excitotoxic 2 excitement 2 excitation-contraction 2 examiner 2 exaggerate 2 exacerbating 2 Ewers 2 evolves 2 evokedpotentials 2 evoke 2 evidencee 2 everywhere 2 everything 2 everybody 2 Everson-Rose 2 evening 2 Evan 2 evacuation 2 eururo 2 Europische 2 Europeans 2 eurheartj 2 euphoria 2 Eun 2 Euler 2 EudraCT 2 ETS2 2 Eto 2 Etico 2 ethylenediaminetetraacetic 2 ether 2 ETH 2 ETDQ-7 2 etch 2 etanercept 2 eTable 2 eta 2 estimator 2 estimations 2 Esther 2 Esteve-Rudd 2 Esterification 2 Estate 2 establishes 2 Essers 2 essay 2 ESS 2 esophagus 2 esophagogastroduodenoscopy 2 Eskandar 2 ESHRE 2 Escera 2 Esaote 2 erythropoietin 2 ERS 2 errorless 2 erroneously 2 Err 2 erosions 2 Ermini 2 Erlangen-Nurnberg 2 Erkinjuntti 2 Erik 2 Ergonomics 2 ered 2 erectile 2 Erdfelder 2 ER-associated 2 EQUIPP 2 equina 2 equating 2 equal-probability 2 equalisation 2 Eptingen 2 Epson 2 epsilon4 2 epsilon 2 epithelial-to-mesenchymal 2 epiretinal 2 epilepsies 2 epigenomic 2 Epigenome-wide 2 epigenome 2 epidermis 2 EPIC 2 Epi4K 2 EPCand 2 e-Ouch 2 envelopes 2 enumerate 2 enthusiastic 2 entail 2 ENT 2 ensuing 2 ensue 2 enrolling 2 Enriquez 2 enolase 2 enjoy 2 enhancer 2 engulfed 2 engravings 2 engrailed 2 Englewood 2 engine 2 Enger 2 engages 2 enface 2 energizing 2 endtidal 2 endowment 2 endothelin 2 endorses 2 endorse 2 endometriosis 2 endolymph 2 Endoh 2 Endo-crinol 2 endocannabinoids 2 Enderby 2 ended 2 endeavours 2 endeavor 2 encouragement 2 encephalomyelitis 2 encephaloceles 2 encapsulated 2 enalapril 2 EMS 2 employers 2 emphasises 2 Emmer 2 Emmaus 2 emitter 2 Eming 2 Emily 2 emigration 2 Emery 2 Emerson 2 EmergencyMedicineMilestones 2 EMBC 2 Emanuela 2 Emad 2 El-Yaniv 2 Ely 2 elucidation 2 Elshorbagy 2 Eloy 2 elongation 2 Elm 2 Ellison 2 elliptic 2 Elliott 2 Ellinor 2 ellagitannin 2 Elkins 2 Elkind 2 Elkabetz 2 Eljamel 2 Elixhauser 2 ELISAs 2 Elisabeth 2 eliminates 2 elicits 2 eliciting 2 Elias 2 elevating 2 elevate 2 Elenkov 2 Elena 2 Elekta 2 electrospray 2 electronically 2 electron-demand 2 electro-convulsive 2 electrocardiography 2 electrocardiographic 2 electro 2 electrically 2 elected 2 Eldridge 2 elders 2 elaboration 2 ejected 2 Einerson 2 Eijkenaar 2 eight-item 2 Eichhorst 2 EIAED 2 Ehrenstein 2 Ehlis 2 Ehlers 2 e-Health 2 Egypt 2 EGR1 2 eggs 2 EGFP 2 efficacious 2 efficacies 2 effectsof 2 EEGs 2 EEG-recording 2 EEG-based 2 Eeden 2 educator 2 Educationand 2 Edmunds 2 Edmund 2 Edmonton 2 Edmonds 2 Edison 2 Edinb 2 Eddy 2 E-containing 2 ecologically 2 ECL 2 echocardiographic 2 ECG-triggered 2 Eccleston 2 Eccles 2 ECASS 2 Ebola-affected 2 eBioscience 2 ebi 2 Eberhard 2 Eaton 2 eaten 2 easy-to-perform 2 EASL 2 easiest 2 Earth 2 earned 2 earn 2 early-passage 2 Earle 2 EANO 2 Eamonn 2 EahKY 2 Eagles 2 Eadie 2 E-Abstract 2 e99 2 e9 2 e798 2 e70 2 e36047 2 E36 2 E35 2 e1-8 2 e1-7 2 e17 2 e15 2 e1368 2 Dzurinko 2 Dzeletovic 2 dystrophies 2 dystrophic 2 dysrepair 2 dys-regulation 2 dysphagia-related 2 Dysfunct 2 dysfluency 2 Dys 2 dynamometry 2 Dyer 2 dyad 2 DxC 2 Dworzynski 2 Dworkin 2 dwelling 2 Duygu 2 Duyckaerts 2 duty-hour 2 Dutra 2 Dur 2 Dupuis 2 DuoSet 2 duodenal 2 Dunkin 2 Dunbar 2 Dumont 2 dummy 2 Dumer 2 Duley 2 Dujardin 2 Dugger 2 Duflex 2 DUETs 2 ducts 2 Duclos 2 Duca 2 DUBs 2 Dubois 2 Dubner 2 Dubin 2 dualenergy 2 DTT 2 Dtsch 2 DTNB 2 DTH 2 DSS-treated 2 DSMB 2 D-serine 2 DSA-monitored 2 drug-specific 2 drug-seeking 2 drug-induced 2 druggable 2 drug-free 2 Droz 2 drowsy 2 drove 2 droplets 2 droplet 2 Drochmans 2 drills 2 drial 2 Drever 2 Dresler 2 Dreher 2 dreaming 2 draws 2 Draper 2 draped 2 drag-and-drop 2 DPARSF 2 Dp427 2 Downstate 2 downregulating 2 down-regulate 2 downregulate 2 down-modulation 2 Dowhan 2 Dowell 2 Dowd 2 Dovero 2 Dove 2 Douw 2 doubtful 2 Dou 2 DOTA-ReCCMSH 2 DOTA-NAPamide 2 Doshi 2 dose-response 2 Dose-Ranging 2 Dose-length 2 dosed 2 Dos 2 dorsoventral 2 dorsiflexes 2 Dorr 2 Dordrecht 2 Doran 2 dopaminergicneurons 2 Doolan 2 donor-type 2 Donna 2 Dong-Young 2 donepezil 2 Donders 2 Donati 2 Donahue 2 Domino 2 Dominique 2 dominating 2 dominance 2 dome 2 Domalpally 2 Dolors 2 Dolore 2 Dohmae 2 dogma 2 doesn 2 Dodick 2 Doblhoff-Dier 2 Dobkin 2 DNp63a 2 DNA-binding 2 DMSO 2 DLD-1 2 Djulbegovic 2 Djamshidian 2 divorce 2 diverting 2 divergence 2 Dive 2 diurnal 2 Dittrich 2 dithiothreitol 2 disturbs 2 disturbing 2 District 2 distributing 2 distressing 2 distractions 2 distorted 2 Distler 2 distinguishable 2 distinctively 2 dissonance 2 dissociated 2 dissociate 2 dissimilar 2 disrespectful 2 disproportionally 2 dispositional 2 displacements 2 dispersive 2 dispensing 2 disoriented 2 dismissed 2 disinhibition 2 disinfected 2 disfluent 2 disfigurement 2 disengaging 2 disease-causing 2 discriminant 2 discreet 2 discordance 2 disconnect 2 discoloration 2 Discipline-specific 2 disciform 2 discerning 2 DISC1 2 disappointing 2 disappear 2 disagree 2 Directorate 2 dipole 2 diphosphate 2 Dimitrova 2 diminution 2 dimers 2 Dilova 2 Dillon 2 Dijkstra 2 Dijkshoorn 2 digs 2 Dignam 2 digits 2 digitally 2 Dig 2 diffusion-tensor 2 diffusely-stratified 2 diffusely 2 diffused 2 difficult-to-treat 2 differentials 2 differentiable 2 diference 2 difer 2 Dietrich 2 Dieting 2 dietin 2 Diels-Alder 2 Diehl 2 Diefenbacher 2 dictates 2 diclo-fenac 2 Dick 2 diaphragmatic 2 diapause 2 Diane 2 Diana 2 diaminobenzidine 2 diamagnetic 2 dialysis 2 dialectic 2 diagrams 2 Diagnosis-related 2 Diaconu 2 dhsprogram 2 DHS 2 dhof 2 Dharampal 2 Dhaka 2 Dextrose 2 Dewey 2 Devoogdt 2 Devlin 2 DeVita 2 deviant-stimulus 2 deviance 2 Deveney 2 Devel 2 devascularization 2 Devaraj 2 detoxify 2 deteriorating 2 detergents 2 detergent-insoluble 2 detergent 2 deter 2 detached 2 destroyed 2 Destro 2 Destination 2 Desterro 2 Destee 2 destabilize 2 Dest 2 Desplats 2 Desperation 2 DeSouza 2 desirability 2 designates 2 desensitization 2 descent 2 descend 2 DerSimonian 2 Dershaw 2 dermis 2 derivatization 2 derangements 2 Depristo 2 depressive-like 2 depression-like 2 depression-associated 2 Deppert 2 Deporte 2 Depleting 2 Depiction 2 departure 2 Departement 2 denser 2 densely 2 denil 2 denied 2 dendrite 2 denaturing 2 demyelinated 2 demonstrable 2 Demma 2 Demler 2 DeMichele 2 dementing 2 Dement 2 Demco 2 Demartines 2 demanding 2 demanded 2 DeMaio 2 Delta32 2 Delorme 2 Delongis 2 Delmar 2 deliberate 2 delete 2 Dekel 2 DeJong 2 deiodination 2 Dehm 2 degranulation 2 degenera-tion 2 Degenerating 2 defrayed 2 deformation 2 defensive 2 defenses 2 defend 2 Deerinck 2 deep-seated 2 deep-etch 2 deepened 2 deepen 2 Deeb 2 deduced 2 Dedoussis 2 Dedhia 2 decriminalizing 2 decorated 2 decontamination 2 decompression 2 decompensate 2 decks 2 decisive 2 decision-makers 2 Deciphering 2 decimal 2 Deceptively 2 decelerations 2 decays 2 Debuc 2 debridement 2 DeBose-Boyd 2 Deborah 2 dearth 2 Dearnaley 2 Dear 2 Deakin 2 DDIT4 2 DDIT3 2 dcs 2 DCE-MRI 2 DC010047 2 DBP 2 daytime 2 Dayanand 2 Dawes 2 Davignon 2 Davidzon 2 Davey 2 Davenport 2 Daussin 2 Daugherty 2 Dato 2 data-fitting 2 databriefs 2 data-bases 2 databank 2 dat-1 2 Daskalakis 2 Dashti 2 DASB 2 Darvish 2 dapsone 2 Danvers 2 dantrolene 2 Danner 2 Dann 2 Danjoux 2 Danielson 2 Daniels 2 Dandekar 2 Dancu 2 Damianos 2 Dambrosia 2 Dall 2 Dalhaug 2 Dalens 2 Dajee 2 Dailey 2 Daiichi-Sankyo 2 Daehak-ro 2 dadlnet 2 DA-dependent 2 Dadds 2 daCosta 2 Dacakis 2 d8-Lys 2 d7-citrulline 2 D5 2 d4306 2 Czeisler 2 Czech 2 cytoskeleton 2 cytopenias 2 Cytom 2 cytocidal 2 Cytochem 2 cystotomy 2 Cys-Gly-Cys-Gly 2 Cys-481 2 Cypser 2 CYP46A1-mediated 2 Cyp46a1- 2 Cynthia 2 Cyclosporine1 2 Cyclosporin 2 cyclooxygenase 2 cyclin-dependent 2 cyclical 2 cyanocobalamin 2 CY11A1 2 CXP 2 CVpat 2 CVORs 2 CVi 2 cutting-edge 2 cutting 2 Cushing 2 Curtin 2 curtail 2 Currie 2 Curlee 2 cures 2 curbing 2 Cuodros 2 Cummins 2 Cuming 2 cumbersome 2 Culvenor 2 culprit 2 Cully 2 Cullheim 2 cue 2 cubic 2 Cuadros 2 CTSA 2 CTIS 2 CT-guidance 2 CTGF 2 C-terminus 2 C-terminally 2 CTCAEdysphagia 2 CTCAE 2 cT4b 2 cT4a 2 CT- 2 CSP 2 crystal 2 crypt-villus 2 cryotube 2 cryostat 2 cryomicrotomy 2 crying 2 Cruysberg 2 crusting 2 crustacean 2 Crowther 2 Crowe 2 cross-sections 2 cross-section 2 Crossroads 2 crosslinked 2 Crossley 2 cross-fire 2 cross-cultural 2 cross-correlation 2 cropped 2 Croen 2 Crocker 2 CRNA-only 2 CRNA 2 critique 2 criticisms 2 cristae 2 Criollo 2 crimes 2 crime 2 cricothyroid 2 cricket 2 cribrosa 2 CRG 2 Cresswell 2 Crenshaw 2 Cre-mediated 2 credited 2 creatin 2 Cray 2 Crawley 2 craniofacial 2 cramps 2 Crain 2 Cragan 2 Crabb 2 CPU 2 CPSP 2 CPET 2 cows 2 coworkers 2 Coverslips 2 coverages 2 Coventry 2 covariable 2 Cousins 2 coupler 2 counties 2 counterstained 2 counteracts 2 counteracting 2 Councils 2 Coultrap 2 Coulter 2 couldn 2 coughing 2 Cotto 2 cotransfection 2 cotransfected 2 Cotia 2 co-stimulatory 2 Costigan 2 cost- 2 Cosio 2 Cosgrove 2 Cortisol-d4 2 corticotropin-releasing 2 corticotrophin-releasing 2 Corticomotor 2 corticomedullary 2 corticolimbic 2 corticocortical 2 corticobasal 2 Corsini 2 Corrosive 2 correspondences 2 Corral-Debrinski 2 Corral 2 Cornish 2 Cormier 2 Corley 2 Coriat 2 corepressors 2 Corellaet 2 coregulator 2 coregulates 2 coregulate 2 Coregistration 2 Corder 2 Corbett 2 Corbera 2 copurify 2 coprecipitation 2 Copped 2 Cooney 2 CoolSnap 2 Cooks 2 cooking 2 cookies 2 co-occurs 2 convulsion 2 convincingly 2 conveyed 2 convexity 2 conversations 2 converging 2 convergent 2 conventions 2 Conture 2 con-trolling 2 Control-injected 2 contradicted 2 contracture 2 contracts 2 contractor 2 contraction-induced 2 contraceptives 2 continents 2 Continence 2 context-specific 2 ContentServer 2 construed 2 Constipation 2 constellation 2 conspicuous 2 Consenting 2 Conrath 2 Conrad 2 Connolly 2 Conger 2 Congdon 2 confront 2 conforming 2 confluence 2 confidently 2 conductances 2 condensed 2 Condensation 2 concussion 2 Concrete 2 concise 2 conceptualize 2 conceptualizations 2 concentration-dependent 2 conceiving 2 concealed 2 concatenated 2 computerised 2 Computer-Assisted 2 compulsory 2 Compston 2 comprehensible 2 comprehended 2 Compr 2 Compounding 2 compounded 2 complies 2 complementing 2 complement-dependent 2 compiled 2 compile 2 Compex 2 compete 2 compensating 2 compensates 2 compatibility 2 comparators 2 companion 2 co-morbidities 2 Communicative 2 Commonwealth 2 commonality 2 commissure 2 commend 2 commands 2 Comitato 2 combs 2 Com-badiere 2 comatose 2 Columb 2 Colton 2 colony-forming 2 colonization 2 colonised 2 Colombia 2 Colmain 2 Collin 2 Collimore 2 Colligan 2 Colli 2 collects 2 collaboratively 2 collaborations 2 colitis-associated 2 Colitis 2 Coletta 2 colectomy 2 Colditz 2 Colchester 2 Colbourne 2 Col3A1 2 Col1A1 2 co-infection 2 coincubated 2 coincides 2 Coimbra 2 coherency 2 cognizant 2 cogni-tive 2 cognate 2 co-first-authorship 2 co-first 2 Coffey 2 cofactor 2 coef 2 codons 2 Codman 2 codified 2 Codd 2 cochlear 2 Cochair 2 Cobo 2 Coben 2 Cobb 2 cobalt 2 co-authors 2 Coates 2 Coast 2 coarse 2 Coalition 2 Coadministration 2 coaching 2 coaches 2 coach 2 CNVs 2 cncr 2 CMP 2 CMOS 2 cmmt 2 C-Means 2 Clutton-Brock 2 clustering-based 2 ClustalW 2 clumps 2 CLSI 2 clotting 2 clothes 2 Cloos 2 Clontech 2 clonogenic 2 clonidine 2 cloned 2 clinic-referred 2 ClinicalPsychology 2 climate 2 clicks 2 CLIA 2 clerkships 2 Clemson 2 Clemons 2 Clements 2 cleft 2 cleaves 2 cleave 2 Clearinghouse 2 clear-cut 2 Clavien-Dindo 2 Clavell 2 Clausen 2 class-specific 2 classi 2 Clarkson 2 Clara 2 Clapp 2 clamp 2 ckrich 2 CJM 2 Civil 2 citing 2 citation 2 circumscribed 2 Circa 2 Cintron 2 Cincinnati 2 CINA 2 Cimmino 2 ciliary 2 CIHR 2 cid 2 CIBER 2 Ciatto 2 CI-1 2 CI-0 2 chylomicrons 2 Church 2 Chudnofsky 2 Chrousos 2 Chronobiol 2 chronicpain 2 chromosomes 2 Chromatogr 2 chromatic 2 Christie 2 Christen 2 Christel 2 Christakis 2 Chowers 2 choosingwisely 2 Chomont 2 choline-deficient 2 cholesterol-like 2 cholesterol-derived 2 cholestenoic 2 cholestatrienol-containing 2 chocolate 2 chlorambucil 2 Chitra 2 Chiti 2 Chilingaryan 2 Chilibeck 2 Chile 2 child-resistant 2 Childrens 2 childcare 2 chiefly 2 Chiba-Falek 2 Chiara 2 chi2 2 Cheyne 2 Cherecheanu 2 chemotactic 2 chemosensitive 2 chemokine-mediated 2 chemokine-based 2 chemoembolic 2 chemoattractant 2 chemiluminescent 2 chemically 2 Chelly 2 cheese 2 Chedoke-McMaster 2 checkup 2 checks 2 cheap 2 Chawla 2 Chauvin 2 Chaum 2 Chaudhary 2 Chartoumpekis 2 Charting 2 Charolais 2 Charlson 2 Charles-Luce 2 Charitable 2 characteristically 2 characterise 2 Chappell 2 chaperones 2 chaperone-associated 2 Chaos 2 Chao 2 championships 2 Champagne 2 Chamberlain 2 Chalupa 2 Chaloupka 2 Chakravarthy 2 Chabi 2 C-flumazenil 2 Cesari 2 Certus 2 Ceriotti 2 cerebromicrovascular 2 cereals 2 Ceravolo 2 Ceponiene 2 Centro 2 centrifugal 2 centralnervous 2 cel-miR-39 2 cell-cell 2 cell-by-cell 2 Celik 2 celecoxib 2 Cela 2 CEBM 2 CDX2 2 CDR 2 CDP-choline 2 CDP 2 cDNAs 2 Cdk5 2 CD95 2 CD7- 2 CD59 2 CD4tT 2 CD45-133-146 2 CD27 2 CD25t 2 CD25 2 CD20-targeted 2 CD19 2 CD16 2 CD146 2 CD14 2 CD133 2 CD007146 2 CD006683 2 CD006145 2 CD003106 2 ccf 2 ccd 2 ccace 2 CC49 2 CBTE2A 2 CBS 2 CBb7w 2 CBb5w 2 CBb3-4i 2 CBab2 2 CBa2 2 CB2 2 Cavanagh 2 cautions 2 causesa 2 Cauraugh 2 Caulin 2 Caulfield 2 Caughey 2 Cathcart 2 catenin 2 Catenacci 2 categorizing 2 categorizes 2 categoric 2 catechol-O-methyl 2 catecholamines 2 catecholamine 2 Catchpole 2 Catalunya 2 Catalonia 2 catalases 2 Catalano 2 catabolite 2 Caswell 2 casts 2 Castro 2 Castanho 2 Cassidy 2 Cassetta 2 Cashman 2 casein-free 2 Casco 2 Cascinelli 2 Casali 2 Carver 2 carved 2 Carvalho 2 Cartwright 2 cartridge 2 Carthey 2 Carthew 2 cars 2 Carrel 2 carpal 2 carotenoids 2 carotene 2 Carolyn 2 Carol 2 Carney 2 Carlsson 2 Carlsen 2 Carli 2 Carle 2 Carla 2 carer 2 CAREN-Optotrak 2 caregiving 2 careers 2 cardiovascular-related 2 car-diovascular 2 Cardiothorac 2 cardiorenal 2 cardioprotective 2 cardiometabolic 2 cardiologist 2 cardiac-related 2 carcinogenic 2 carboxy-terminus 2 carboxymethyl 2 carboxyl 2 carboxyethylpyrrole 2 carbamylcholine 2 carba-mylation 2 Carbamoylation 2 Caplan 2 CAPES 2 Capell 2 Capel 2 cantus 2 Can-tril 2 Cantor 2 Cano 2 Cannstatt 2 Cannabinoid 2 Canet 2 cane 2 candy 2 cancerstats 2 cancer-speci 2 cancerimagingarchive 2 cancer-bearing 2 cancels 2 cancel 2 Canc 2 canals 2 Camus 2 Campanini 2 cAMP 2 Camelidae 2 cam 2 Calvo 2 calponin-1 2 calpain-1-and 2 Calne 2 calmodulin-dependent 2 Callister 2 calling 2 Callen 2 Calin 2 Califano 2 Calibrator 2 Calfon 2 Caldwell 2 calcium-binding 2 Calcium-activated 2 Calbiochem 2 calbindin-positive 2 Calaminus 2 Calame-Christe 2 Cain 2 CAG 2 Caenorhabditiselegans 2 Cacna1d 2 Cacna1c 2 CaCl2 2 Cache 2 Cabanlit 2 -Ca2 2 C8 2 C6t6 2 C57Bl6 2 C-30 2 C27 2 -C 2 C- 2 bystanders 2 bystander 2 by-product 2 BY-NC 2 BX 2 BWJ 2 b-value 2 Buvanendran 2 Butalia 2 busy 2 Busuioc 2 Burton 2 Burr 2 Burnout 2 Burmester 2 Burlington 2 Burkett 2 buried 2 Burgoyne 2 Burglin 2 Burgess 2 Burdick 2 burdensome 2 Bunn 2 Bundled 2 Bunce 2 Bulka 2 bulbar 2 Bugiani 2 buffers 2 Budovsky 2 Budd 2 Buchwald 2 Buchholz 2 Bucher 2 Buchel 2 bu 2 BTZ-responsive 2 BTZ-based 2 Brussels 2 Brunzell 2 Brunton 2 Brundin 2 Bruix 2 Bruintjes 2 Brozovich 2 Brox 2 Brownlie 2 Browner 2 Browne 2 brother 2 Brotchie 2 Brosnan 2 Brooklyn 2 bromyalgia 2 Broggi 2 Broekhuyse 2 Broeck 2 Brodie 2 Brockway 2 Brocklehurst 2 Brocker 2 Brochu 2 broadest 2 broadening 2 Brito 2 Briskman 2 brisk 2 Brioschi 2 Brini 2 Bringmann 2 Brill 2 Brihaye 2 bridges 2 Bricker-Katz 2 brevity 2 Brett 2 Breton 2 Bresolin 2 Breivik 2 Breitkreutz 2 Breheny 2 Breen 2 Breedveld 2 Bredeweg 2 Brechbiel 2 breath-hold 2 breast-feeding 2 Breast-cancer 2 breakage 2 breadth 2 BrdU-positive 2 Braunschweig 2 Bratic 2 Brash 2 Brandmayr 2 Brambilla 2 Braithwaite 2 Braitenberg 2 brainwashed 2 brainstems 2 brain-specific 2 Braicu 2 Braga 2 Braeckman 2 bradycardia 2 Brad 2 Braconi 2 Braakhekke 2 Braaf 2 Bra 2 BP180 2 Boycott 2 Boxerman 2 Bowsher 2 Bowers 2 Bover 2 Bours 2 Bourquin 2 bounded 2 Bouchard 2 bottles 2 Bottle 2 Bottaro 2 bothered 2 Bostantjopoulou 2 Bossuyt 2 Borowitz 2 Boroujerdi 2 Bornstein 2 Borinstein 2 borderline 2 Borchers 2 Boovariwala 2 bootstrapping 2 Bootstrap 2 Booth 2 Boonmak 2 boom 2 booklet 2 Bonow 2 Bonne 2 Bonini 2 Bonica 2 Bonferroni-corrected 2 Bonesi 2 bones 2 bone-marrow 2 Bonde 2 Bomin 2 bombers 2 Bombardier 2 Bolwijn 2 Boltz 2 Bollich 2 Bolla 2 Boll 2 bold-face 2 Bokacheva 2 Bohn 2 Bogdanov 2 Bogdan 2 Bogalusa 2 Boers 2 Boellaard 2 Boelke 2 Boehringer 2 Boeckler 2 Boden 2 Boccola 2 Bobryshev 2 Bobbert 2 boat 2 board-approved 2 Boaden 2 Blusse 2 Blumberg 2 Bluestone 2 blueprint 2 bls 2 blotted 2 Bloomington 2 Bloomer 2 Bloom 2 bloodebrain 2 Blood-based 2 Blomgren 2 block-face 2 blister 2 B-lineage 2 Blimp-1 2 Bleys 2 Blender 2 blastocyst-stage 2 Blaner 2 Blanchard 2 Blade 2 Blackman 2 Blackburn-Munro 2 Blackburn 2 Bjorklund 2 Bjelland 2 bivalent 2 bisretinoids 2 bisphosphonate-induced 2 bisphenol 2 Bisgaard 2 bisecting 2 Birzeit 2 birthweights 2 birthing 2 Birmaher 2 Birks 2 Birkenmeier 2 Birk 2 Birgitte 2 bire 2 bi-polar 2 Bioscience 2 bioreactance 2 Bio-Rad 2 Bioptigen 2 Bio-phys 2 biomicroscopy 2 Biomedicine 2 biomedcentral 2 biomechanics 2 bio-markers 2 Biologiques 2 Biologics 2 biographical 2 bioecological 2 biobehavioral 2 bingen 2 bin 2 Billson 2 Billman 2 Bilgic 2 bilayers 2 bilayer 2 Bijvank 2 bifurcations 2 Bifunctional 2 Bielinski 2 Bidulescu 2 Bickel 2 bicinchoninic 2 bicarbonate 2 bibliography 2 Bianco 2 BHSc 2 Bhowmick 2 Bhisitkul 2 Bhattacharyya 2 bham 2 b-galactosidase 2 Bezard 2 Beynon 2 Beyeret 2 Bewley 2 Beverly 2 between-study 2 between-individual 2 between-day 2 be-tween 2 Bettus 2 Beth 2 Betarbet 2 beta-particle 2 beta-human 2 beta-endorphin 2 beta-blocker 2 beta3 2 Bestrophin1 2 Bertozzi 2 Berti 2 Bernhardt 2 Bernadette 2 Bern 2 Berlanga 2 Berker 2 Bergstrom 2 Bergmann 2 Bergh 2 Bergeron 2 Bergen 2 Benyoucef 2 Bennet 2 Benner 2 Benitah 2 bending 2 Ben-David 2 bendamustine 2 benchmarking 2 Benbow 2 Benasich 2 Ben 2 Beltran 2 belonged 2 Bellvitge 2 bell-shaped 2 Bellomo 2 Belli 2 Belin 2 Belgian 2 Bekelman 2 Beith 2 being-in-the 2 Beiling 2 Beilby 2 Beier 2 behaves 2 Behar 2 Beets 2 Beeson 2 bees 2 Beeri 2 Beebe 2 Bee 2 beauty 2 Beaudoin 2 Beauchemin 2 Beatriz 2 BDNF 2 B-containing 2 bbert 2 Bazarbachi 2 Bazan 2 Bausch 2 Baumgartner 2 Baum 2 Batty 2 batteries 2 Batra 2 bath-sonicated 2 Bates 2 batch 2 Bat 2 Basu 2 Bastarrika 2 Basinger 2 basing 2 basics 2 Basically 2 Bashshur 2 Bash 2 basedon 2 Baruch 2 Bartsch 2 Bartolomei 2 Bartke 2 Barthel 2 Barter 2 Bartelds 2 Bart 2 Barron 2 Barraclough 2 Barkley 2 Barin 2 bariatric 2 Bar-Haim 2 Barger 2 Barden 2 Bardelli 2 Barch 2 Barc 2 barbiturates 2 Barber 2 Barbazetto 2 Barbara 2 Barathi 2 Barakat 2 Bannerman 2 Banerjee 2 Bandmann 2 band-limited 2 banding 2 b-amyloid 2 Balsas 2 Balpha 2 balloon-expandable 2 Balk 2 Balistreri 2 Baldwin 2 Baldus 2 Balazs 2 Balaban 2 Bakkman 2 Bakermans-Kranenburg 2 baked 2 Bakall 2 Baird 2 Bairaiti 2 bag-valve-mask 2 Baguley 2 BAG-RECALL 2 Bagger 2 Baekeland 2 Baehren 2 Badminton 2 Bader 2 Baddeley 2 BAC-transgenic 2 Bacskai 2 backward-masked 2 backscattering 2 backscattered 2 backprojected 2 Backman 2 backdrop 2 Baba 2 Baabor 2 B-27 2 B15 2 B12 2 B-100 2 azoxymethane 2 azide 2 Azarbal 2 Azambuja 2 Ayhan 2 Ayala-Grosso 2 AWMF 2 awaited 2 Avon 2 Avogaro 2 avidin 2 avian 2 avenues 2 Avantaggiati 2 autosomaldominant 2 auto-regulated 2 auto-regressive 2 autoregressive 2 Autoradiography 2 automobiles 2 automating 2 AutoDock 2 autodetection 2 autocalibrating 2 Austen 2 ausport 2 auricular 2 Augsten 2 Augenheilkunde 2 audio-recorded 2 Audiology 2 Atzmon 2 Attribution 2 attracting 2 attested 2 attenuate 2 attentuation 2 attentive 2 Attention-deficit 2 attends 2 Attar 2 Attanasio 2 attaining 2 attainable 2 Atta 2 Atsumi 2 atractyloside 2 ATP-dependent 2 ATPases 2 -ATPase 2 atorvastatin 2 atoms 2 atom 2 ATM 2 Atluri 2 ATLANTIS 2 ating 2 Athis 2 Athineos 2 Atherton 2 atherosclerosis-like 2 Athena 2 Athappan 2 Atg5 2 at4 2 asymmetries 2 asymmetrically 2 as-yet 2 astroglial 2 Astrid 2 Astor 2 Aster 2 associa-tion 2 Assistants 2 assessor 2 asserted 2 assent 2 assembling 2 assemblies 2 Asselbergs 2 ASPO-eligible 2 aspirations 2 aspirate 2 aspartate 2 Asp5 2 Asn 2 asks 2 asignificant 2 Asian-Australasian 2 Asi 2 Ashra 2 Ashburner 2 Ash 2 ASCO 2 Asano 2 Arztebl 2 Arzt 2 Arts 2 artner 2 artist 2 artificially 2 Artif 2 articleviewer 2 articleid 2 arthroscopic 2 Arthanari 2 artefacts 2 arsenite-responsive 2 arsenic 2 arresting 2 arrested 2 Aronowski 2 Aron 2 aromatic 2 Arnal 2 Armson 2 Armitage 2 armamentarium 2 Arizona 2 Arispe 2 Arinobu 2 Aribisala 2 Arias 2 arguing 2 argues 2 Arenzana-Seisdedos 2 ArenaR 2 area-level 2 area-based 2 Ardenne 2 arcuate 2 Arctic 2 archived 2 arcades 2 arcade 2 arbitrariness 2 arandomized 2 Araie 2 arachidonic 2 Arabia 2 AQP4-M23 2 apt 2 APR-246 2 approximating 2 approvals 2 approachto 2 Approaching 2 appointed 2 appliquee 2 applicator 2 appi 2 appendicular 2 appendicitis 2 appendectomy 2 Appel 2 appearances 2 Apostoli 2 apoE-containing 2 apoB-MTP 2 apoB-containing 2 apoB-48 2 apoB-100 2 apneas 2 Api 2 Aphasia 2 Apfeld 2 APEX 2 aortography 2 aortocaval 2 aortic-valve 2 Anyway 2 anxiolytics 2 Anu 2 Antwerp 2 Antonsen 2 Antonetti 2 anti-vascular 2 anti-TH 2 antiretroviral-treated 2 antipyrine 2 anti-Pitx3 2 anti-peptide 2 anti-p65 2 anti-p185HER2 2 anti-Otx2 2 anti-nuclear 2 anti-MMP-13 2 antimalarial 2 antihistamine 2 anti-goat 2 antiglaucoma 2 antigen-presenting 2 antiesmooth 2 anti-EGFRvIII 2 antidote 2 antidonor 2 anti-diabetic 2 anti-DCC 2 anti-CH1923-1932P 2 anti-CD25 2 anti-calponin-1 2 antibody-secreting 2 antibody-dependent 2 anti-body 2 anti-BMP-4 2 anthropology 2 Anthropologists 2 Anthony 2 Antebi 2 Antal 2 antagonizing 2 antagonizes 2 Anscher 2 anoressia 2 anonymized 2 anonymity 2 anonymised 2 anomalous 2 Anolik 2 AnL 2 Anker 2 Anisimov 2 anionic 2 animation 2 Anhalt 2 Anglade 2 Angiology 2 angiographies 2 angio-gram 2 Anger 2 Angelantonio 2 aneurism 2 Anestesiol 2 andtherapeutic 2 Andrys 2 androgenic 2 andrisk 2 Andreu 2 Andresen 2 Andreou 2 Andino 2 andHearing 2 andfamilial 2 andAbeta1 2 and7 2 and3 2 anchors 2 anchoring 2 ancestries 2 anatomie 2 Ananth 2 Anand-Apte 2 Analyser 2 AnAge 2 anaesthetized 2 Anaesthetics 2 anae 2 Amy 2 Amsler 2 amputees 2 Amputee 2 amplitudesin 2 amplify 2 amplifier 2 ample 2 amphetamine 2 AMPactivated 2 AMP 2 amoeboid 2 amnesia 2 ammatory 2 amlexanox 2 Amir 2 amino-terminal 2 amide 2 Ameringen 2 Ament 2 amelanotic 2 AMD-relevant 2 Amato 2 Amati 2 amateur 2 Amari 2 Amaratunga 2 Amantea 2 Amantadine-induced 2 ama-assn 2 Alzheimers 2 Alves 2 Alvarez-Fischer 2 Alvar 2 Altogether 2 altitudes 2 Altier 2 alterationsin 2 alteplase 2 Alten 2 Alston 2 Al-Soud 2 Alsina 2 alphawas 2 alpha-synucleinoligomers 2 alpha-synucleinin 2 alpha-subunit 2 alpha-emitting 2 Almog 2 Allsworth 2 alloxan-induced 2 Allowances 2 allowance 2 allostatic 2 allopregnanolone 2 Allocations 2 alley 2 Alleviates 2 Allele-specific 2 Allayee 2 Alkhani 2 aliquotted 2 aliquoted 2 aliquot 2 Alipour 2 alio 2 -Alimera 2 Alieva 2 Alicante 2 Algozzine 2 AlGhatrif 2 Algert 2 Alfred 2 Alexopoulos 2 Alexanian 2 Alexandre 2 Alexa-568 2 Alex 2 Alessio 2 Alers 2 alendronate-associated 2 Alen 2 alemtuzumab 2 Alemi 2 Aldrich 2 Aldo 2 Albright 2 Alavi 2 Alampi 2 Alafuzoff 2 al6 2 al44 2 al36 2 al35 2 al30 2 al3 2 al16 2 AKL 2 Akker 2 Akiyama 2 Akerboom 2 Akabani 2 aka 2 AJOB 2 AIS 2 airflow 2 AIN-93 2 Aimee 2 Aigner 2 Aiello 2 aided 2 AI052748 2 Ah-See 2 Ahonen 2 AHMC 2 Ahles 2 Ahern 2 AhCRE 2 Agus 2 Agurto 2 agreements 2 agreeable 2 Agrawal 2 Agostini 2 aging-cardiovascular 2 aging-associated 2 Agile 2 Agholme 2 aggravation 2 age-progressive 2 age-predicted 2 age-of-onset 2 age-grouping 2 AGB 2 Agapova 2 Afilalo 2 Affiliation 2 AF680 2 Aerpio 2 aerobic-based 2 advocates 2 advocated 2 advisor 2 adviser 2 advisable 2 Advani 2 advanced-stage 2 adult-oriented 2 adult-only 2 adult-centered 2 adrenocorticotropic 2 adrenaline 2 AD-related 2 admissible 2 administrated 2 adjuncts 2 Addona 2 add-on 2 additions 2 addictive 2 Addict 2 Addadi 2 Addad 2 AD-associated 2 adapting 2 Adamczyk 2 Adair 2 ADAI 2 Ada 2 acylcarnitines 2 Acucela 2 actuarial 2 actors 2 activity-induced 2 activity-dependent 2 -actin 2 Acree 2 ACR 2 acoustical 2 ACO 2 Acland 2 Ackland 2 Ackerman 2 Acin-Perez 2 acid-Schiff 2 acid-induced 2 acid-binding 2 achromatic 2 achievers 2 Ach 2 acgmeweb 2 acetic 2 ACEC 2 accusations 2 accrual 2 accord 2 accomplish 2 accompany 2 accidents 2 accepts 2 acceptor 2 accepting 2 acceptably 2 Acatalasemia 2 abundances 2 Abu-Laban 2 Abstinence 2 abscesses 2 abruptly 2 abreast 2 abrasions 2 abolition 2 abolishing 2 A-benzodiazepine 2 Abe 2 Abdullah 2 abduction 2 abdominopelvic 2 Abdi 2 ABC 2 Abate 2 abandon 2 AAV-hSNCA140 2 AAV1 2 AAS 2 aar 2 AAMC 2 Aagaard 2 AABB 2 a50 2 A430 2 A429 2 A2E-induced 2 A29S 2 A182 2 a180 2 A175 2 A174 2 A-1 2 9-fold 2 9e30 2 9-CM 2 99mTc-sulfur 2 99mTc-RGD-Lys- 2 99mTc-CGCG-NDP 2 990 2 988 2 9850 2 973 2 970 2 95th 2 955 2 953 2 947 2 937 2 929 2 923 2 91-100 2 9-10 2 90202 2 90027 2 8-week 2 8-to 2 8MBq 2 8-fold 2 8C 2 8B 2 89Zr-based 2 893 2 892 2 887 2 884 2 878 2 875 2 864 2 86-0 2 8-6 2 85-Plus 2 858 2 857 2 8566 2 855 2 842 2 840-845 2 834 2 825-826 2 822 2 81-90 2 815 2 8-13 2 8-1 2 80-90 2 8059 2 80-23 2 7-year-old 2 7th 2 7T 2 7-syllable 2 7-point 2 7-Month-Old 2 7Bf 2 782 2 7-8 2 779 2 772 2 7703 2 767 2 7656 2 75-cm2 2 75A 2 75-80 2 755 2 746 2 7447 2 7414 2 -74 2 739 2 73-80 2 7369 2 735 2 73-0 2 72-78 2 723-729 2 720 2 719 2 71-80 2 718 2 717-722 2 7-14 2 7-13 2 7-10 2 710 2 7095 2 700-8558 2 6th 2 6-point 2 6-mm 2 6L 2 6E 2 6D 2 698-699 2 697-704 2 69-75 2 6956 2 694 2 693Y700 2 690 2 68Ga-labeled 2 68Ga-D 2 688 2 67Ga 2 677C 2 67-0 2 6616 2 659 2 65-71 2 656 2 65211 2 6500 2 64Cu-NOTA 2 64Cu-CuCl2 2 64Cu-based 2 649-659 2 64-80 2 64-72 2 6469 2 638 2 636 2 6336 2 632 2 630 2 6-3 2 624 2 61-70 2 6-15 2 61-0 2 6-1 2 60th 2 5-to 2 5-tetrazine 2 5-s 2 5or 2 5-m 2 5-lipoxygenase 2 -5D 2 5-cm 2 5-aminolevulinate 2 5alpha-steroid 2 5alpha 2 598 2 597-604 2 5916 2 5907 2 584-592 2 57-63 2 569638 2 5610 2 555-63 2 554 2 551-561 2 5482 2 5449 2 539-47 2 537-544 2 530 2 528-535 2 52-61 2 5230 2 52187 2 5-21 2 5-20 2 51Cr 2 51-60 2 5-15 2 5-13 2 512-GF 2 5124 2 511-530 2 50-foot 2 50822 2 508 2 501-508 2 5010 2 5009-5015 2 50000 2 -500 2 -50 2 -5 2 4-week-old 2 4-week 2 4pns 2 4-month 2 4h 2 4G12 2 4-benzylamino 2 495 2 493-501 2 488-496 2 4828 2 4827 2 47772397 2 476-488 2 47-51 2 4751 2 4696 2 45-88 2 4559 2 4500 2 4436 2 44195 2 440 2 438-44 2 4330 2 43212 2 4237 2 4163 2 415279 2 41-50 2 4-11 2 4072 2 402-408 2 4006 2 -40 2 3xkB 2 3s 2 3-pyridyl 2 3-phosphate 2 3-mm 2 3KXXXK 2 3In 2 3-D 2 3951 2 39-47 2 3941 2 38-55 2 3801 2 379-382 2 376-83 2 3753 2 -374T 2 37-41 2 3-7 2 3542 2 3536 2 3471 2 34-43 2 3293 2 329- 2 3285 2 327-329 2 3270 2 3264 2 3-24 2 3181 2 3152 2 3-15 2 3109 2 3100 2 30s 2 3081 2 3061 2 30-60 2 3060 2 3040 2 303-312 2 2TT 2 2-tailed 2 2mg 2 2ll 2 2J 2 2-helix 2 2FQnetTier2 2 2FPage 2 2-day 2 2Current 2 293T 2 29-36 2 29-32 2 2905 2 -29 2 2-9 2 2896 2 287-332 2 27-hydroxycholesterol 2 2772 2 2764 2 2751 2 2747 2 27448 2 2738 2 2705 2 2702 2 2700 2 27- 2 26S 2 267-76 2 2658 2 2649 2 2643 2 263-bp 2 2637 2 2636 2 2632 2 26-28 2 2628 2 2625 2 2621 2 261-7 2 2606-2617 2 26-0 2 25mg 2 2592 2 2535 2 25-31 2 25-28 2 2510 2 250e 2 2503 2 24S-hydroxylase 2 2498 2 2487 2 248-58 2 2473 2 247-258 2 2466 2 2444 2 24-31 2 2414 2 2407 2 2385 2 2369 2 2361 2 2354 2 23-46 2 2327 2 2303-2308 2 2291 2 225Ac 2 2257 2 22558321 2 2251 2 2242 2 2239 2 22362777 2 223-229 2 2200 2 21-year 2 2-1M 2 21-day 2 2196 2 2194 2 2192 2 2186 2 2165 2 215-223 2 2147 2 2145 2 -214 2 213Bi 2 21-30 2 21-27 2 2125 2 211At-SAGMB 2 2115 2 2105 2 2104 2 2103 2 2100 2 20S 2 20-mL 2 2090 2 2051 2 2050 2 2048 2 2045 2 2024 2 2020 2 2019 2 2013-0750 2 201-217 2 2009-2013 2 2009-2012 2 2008-005388-33 2 2005-2009 2 2005-2006 2 2004c 2 2003b 2 2003a 2 2001-2003 2 2-0 2 20- 2 1-sided 2 1-second 2 1-sample 2 1RM 2 1-Pb-Pk 2 1-or 2 1mg 2 1M 2 1-hour 2 1G 2 1-fold 2 1e0 2 -1-butanol 2 -1b 2 1999b 2 1998b 2 1998a 2 1997b 2 1997a 2 19-9-6 2 1993-2007 2 19-9-3 2 1974b 2 1974a 2 19-73 2 19-67 2 1956 2 1952 2 1951 2 1946 2 1944 2 1937 2 19364974 2 1934 2 1930s 2 1926 2 1925 2 19-23 2 1923 2 1922 2 1918 2 1916 2 1915 2 1910 2 1909 2 1907 2 1902 2 18-yr-olds 2 18-gauge 2 1897-1908 2 1897 2 189-198 2 1887 2 1885 2 1883025 2 1881 2 1875 2 187-194 2 1867 2 1866 2 1862 2 1855 2 1853 2 1847 2 1844 2 1840 2 183-191 2 1828 2 18277-18282 2 18-25 2 1824 2 1819 2 1804 2 1801 2 1800 2 17-to 2 17-item 2 17e19 2 1793 2 1787 2 1779 2 1777 2 17640 2 175Y182 2 1757 2 1747 2 17461391 2 1742 2 1740 2 1730 2 17182988 2 1718 2 171-186 2 171-178 2 1700 2 16-channel 2 169Y174 2 1689 2 1679 2 1672 2 1669 2 1662 2 165-79 2 1655 2 1650 2 1644 2 16316783 2 1630-1633 2 1630 2 1620 2 16187-16198 2 1613 2 1610 2 1608 2 1602 2 1600g 2 15-to 2 15-item 2 1594-1600 2 1593 2 1589 2 1580 2 1579 2 1566 2 155-158 2 1545 2 1537 2 1534 2 15-29 2 15279 2 1526 2 15-25 2 1524 2 1519 2 1517 2 1511 2 1509 2 1508 2 1496 2 1493 2 1491 2 1489 2 1488 2 1486 2 1484-1498 2 1480 2 1479 2 1462 2 1454 2 1453 2 1449 2 1446 2 1440 2 1438 2 1434 2 1427 2 1421 2 1419 2 1417-1436 2 1416 2 141-147 2 1408 2 1405 2 1403 2 1402 2 1401 2 1391 2 1390 2 137Cs 2 1378 2 1369 2 1368-73 2 1367 2 1360 2 135b 2 1359 2 1358 2 1355 2 1352 2 1351 2 1-35 2 1349 2 1348 2 1345 2 1342 2 1338 2 1331 2 1330 2 1328 2 1324 2 1322 2 131I-Nanobody 2 1319 2 1318 2 1317 2 1306 2 1304 2 12-h 2 12-color 2 1299 2 1298 2 1296 2 1295 2 1294 2 1292 2 1291 2 128840 2 1287 2 1283 2 1282 2 1271 2 1268 2 1263 2 125-kDa 2 125I-IBA-Lys11 2 1258 2 1255 2 1252 2 1251 2 1246 2 1244 2 1240 2 1237 2 1236 2 1231 2 1230 2 1227 2 1226 2 1224 2 1222 2 1217 2 1215 2 1212 2 1211 2 120-day 2 1207 2 11th 2 11beta-HSD2 2 11beta-HSD1 2 11beta-HSD 2 1199 2 1193 2 1188 2 1186 2 1184 2 1180 2 1175 2 1170 2 1163 2 1157 2 1155 2 1153 2 1146 2 1145 2 1133 2 113-120 2 1130 2 1125 2 1122 2 1-12 2 111In-DQTA-NDP-MSH 2 111In-DOTA-ReCCMSH 2 111In-DOTA-Re 2 11-123 2 11-12 2 1108-1118 2 1108 2 110-744 2 1102 2 10Y24 2 10T1 2 10min 2 10mg 2 10ll 2 1098-4275 2 1098 2 1096 2 1094 2 1088-1094 2 1086 2 1085 2 1079 2 1056 2 1052216 2 1049 2 1046 2 1045 2 1039 2 1035 2 10288 2 10280 2 1028 2 1022 2 10-15 2 1014 2 1011 2 100ll 2 100-HU 2 100-fold 2 1008 2 10029 2 10016 2 1001-1006 2 1000s 2 10000 2 -100 2 -10 2 -1- 2 0-lag 2 0e8 2 0-cm 2 092 2 090 2 084 2 078 2 076 2 073 2 072 2 071 2 067 2 06-494 2 0630 2 063 2 0-6 2 058 2 0482 2 047 2 0467 2 043 2 038 2 037 2 035 2 034 2 029 2 0243 2 02115 2 020 2 0147 2 01234 2 0053 2 0035 2 0031-4005 2 001-0 2 0007 2 0002 2 0000Y0000 1 zz3c 1 Zywicki 1 Zymosan 1 Zymed 1 Zyloney 1 zygous 1 zygote 1 Zyang 1 Z-Y 1 ZY 1 Zwolle 1 Zwitserlood 1 Zwet 1 Zweier 1 Zweegman 1 Zwarts 1 Zwanzinger 1 Zvaritch 1 Z-VAD 1 Zurawski 1 Zurakowski 1 Zupo 1 Zunder 1 Zumer 1 Zumbrunnen 1 zum 1 Zukin 1 Zuid 1 Zuckerman 1 Zucchi 1 Zuberi 1 Zsurka 1 Zsiros 1 Zr-89-albumin 1 ZR 1 zoxymethane-induced 1 zoster 1 zorumskc 1 Zornosa 1 Zoomeren 1 Zoology 1 Zoolog 1 Zook 1 Zon-Mw 1 Zonderman 1 Zolton 1 zolmitriptan 1 Zoller 1 Zohoori 1 Zoe 1 ZO-1 1 zningl 1 ZM 1 ZL 1 ZivianiE 1 Ziv 1 Zisser 1 Ziros 1 zirconium 1 Zips 1 Zipperlen 1 Zipfel 1 Zinzow 1 Zinner 1 Zinn 1 Zinman 1 Zink 1 Zini 1 zinc-free 1 zinc- 1 Zimmermann 1 Zimmerer 1 ZILOS-tk 1 Zilbering 1 ZIHP 1 zigzags 1 zigzag 1 Zielen 1 Zielasek 1 Ziekenhuiscentrum 1 ziconotide 1 Ziabreva 1 ZhukarevaV 1 Zhukareva 1 Zhouet 1 Zhongdong 1 Zhiyi 1 ZHER2 1 Zhen 1 ZhaoJ 1 Zhaoa 1 Zhang1 1 ZGT 1 zgo 1 ZF 1 zewski 1 Zewinger 1 Zetterstrom 1 Zest 1 Zeroing 1 Zerbini 1 Zerbib 1 Zeon 1 Zenz 1 -Zenteno 1 Zenteno 1 Zent 1 Zemp 1 Zemany 1 Zellforsch 1 Zelkowitz 1 Zelkha 1 Zelenika 1 Zelda 1 Zeitlin 1 ZeissMeditec 1 Zeglis1 1 Zeger 1 Zeegers 1 Zee 1 Zeck 1 Zechlin 1 Zebekakis 1 Zeadna 1 z-direction 1 zDepartment 1 zChild 1 Zbaren 1 Zaza 1 Zawadzki 1 Zaw 1 Zavaleta 1 Zasshi 1 Zaslavsky 1 Zaslansky 1 Zargar-Shoshtari 1 Zareparsi 1 Zareba 1 Zarbo 1 Zaravinos 1 Zarate 1 Zaramba 1 Zarahn 1 Zap-pasodi 1 Zapol 1 Zanzonico2 1 Zanussi 1 Zanon 1 Zanivan 1 Zani 1 Zanetti 1 zAnesthesiology 1 Zandwijk 1 Zandi 1 Zan 1 Zamponi 1 Zamparo 1 Zambian 1 Zambetti 1 Zamami 1 Zalzal 1 Zalutsky1 1 Zaleska 1 Zalesin 1 Zaldivar 1 Zajac-Benitez 1 Zajac 1 Zaidi 1 Zahurak 1 Zahnd 1 Zahida 1 Zagorski 1 Zagorovskaya 1 Zacho 1 Zacharian 1 Zachariae 1 Zaba 1 Zaag-Loonen 1 z70 1 z64 1 z60 1 Z3 1 Z16 1 z120e150 1 z11 1 z10e19 1 z10 1 Yvette 1 Yusuf 1 Yuspa 1 Yusaku 1 Yurgenson 1 Yunus 1 Yuksel 1 Yukihisa 1 Yujing 1 Yuhong 1 Yue 1 Yucel 1 Yubin 1 Yuasa 1 Yttrium-90-labelled 1 Yttrium-86 1 yrinthine 1 yr-1 1 youth-level 1 YOURSELF 1 Youn 1 Yoshizawa 1 Yoshiura 1 Yoshitsugu 1 Yoshimura 1 Yoshida-Moriguchi 1 Yonova-Doing 1 Yong-Kil 1 Yongguang 1 Yonezawa 1 yolk 1 Yokoyama 1 Yokosuka 1 Yokokawa 1 yoga-based 1 YO10 1 ynucleinopathy 1 Yngve 1 YMCA 1 Ymatched 1 YM-244769 1 Ylstra 1 YLDs 1 yLawrence 1 Yla-Herttuala 1 Yki-Jarvinen 1 YK-3-237 1 Y-J 1 Yishai 1 y-intercept 1 Ying 1 Yimtae 1 Yilmazer 1 Yijk 1 YG 1 Yetman 1 yetlargely 1 Yetkin 1 yes-or-no 1 Yesavage 1 Yeo 1 Yendamuri 1 Yen 1 Yelland 1 yeither 1 Yefim 1 YeeD 1 Yebenes 1 Yeates 1 years-long 1 years9 1 years11 1 Yeargin 1 yearcompared 1 Yeah 1 Yeager 1 YCS 1 Y-C 1 ybecause 1 Y-axis 1 yaxis 1 Yavas 1 Yaure 1 Yasumura 1 Yasser 1 Yasha 1 Yarov-Yarovoy 1 Yaron 1 Yarnnold 1 Yarnitsky 1 Yarmenitis 1 yard 1 Yaqub 1 Yapicioglu 1 Yap 1 Yanosky 1 Yannuzi 1 Yanni 1 Yanagawa 1 Yambuku 1 Yamazoe 1 Yamazaki 1 Yamanaka 1 Yamamura 1 Yamakuchi 1 Yamakawa-Kobayashi 1 Yamakawa 1 Yamaji 1 Yamagata 1 Yale-PET 1 Yalcin 1 Yakugaku 1 Yaksh 1 Yahr 1 Yahalom 1 Yaguchi 1 Yagi 1 YaDeau 1 Yachnin 1 Y220C 1 Y21 1 Y2- 1 Y187 1 Y11 1 XZ 1 XXI 1 XX 1 XV 1 XuX 1 Xuri 1 Xuelin 1 Xuanwu 1 Xuan 1 XRS 1 XRCC6 1 XQ 1 Xponent 1 XP 1 X-matrix 1 xMAP 1 XL 1 XJ 1 Xiuli 1 X-inactivation 1 Xilouri 1 XIIIe 1 XIIe 1 Xiao-Guang 1 Xiaofu 1 Xiaofeng 1 Xianqun 1 Xianming 1 Xiang 1 X-F 1 xenogeneic 1 Xenoestrogen-induced 1 xenobiotics 1 xed 1 XE-2100 1 XCT 1 X-chromo-some 1 XC 1 XBP1u-L167I 1 Xbp1-target 1 Xbp1s-Negative 1 Xbp1-binding 1 Xarxa 1 Xanthoudakis 1 xanthophyll 1 xanthomas 1 xable 1 x9 1 X5-1 1 X4 1 x314 1 X3 1 x262 1 x121 1 x101-308 1 x0 1 wzy 1 Wyss-Coray 1 Wyrick 1 Wynshaw-Boris 1 Wyller 1 Wylde 1 Wyczalkowski 1 Wycombe 1 Wybranski 1 WY 1 WX 1 WWY 1 www-users 1 wwwn 1 WWS 1 WWN 1 wvu 1 WV 1 Wuyts 1 Wutrich 1 Wustrow 1 Wurff 1 WuR 1 Wuppertal 1 Wullner 1 WuJ 1 Wuertzer 1 Wuellner 1 Wudy 1 Wu3 1 wtp53 1 WThSNCA140 1 WThSNCA 1 WTBS 1 W-T 1 wsj 1 wrongly 1 wrongdoing 1 Wrobel 1 writings 1 Wright-Paradis 1 WrightMJ 1 Wretlind 1 Wredenberg 1 Wray-Cahen 1 wrap 1 W-R 1 WPM 1 wPain 1 Wozniak 1 wound-healing 1 wouldn 1 Worsley 1 Worsham 1 worsens 1 worrying 1 worries 1 Worp 1 worn 1 Wormald 1 world-wide 1 worlds 1 workstations 1 workspaces 1 Work-shopeOphthalmology-Summary 1 worksheets 1 work-related 1 workout 1 Worklow 1 working-memory 1 work-group 1 workgroup 1 work-equated 1 workdays 1 work19 1 Wordsworth 1 words2 1 word-forms 1 Worden 1 worded 1 word-based 1 word-access 1 Wooten 1 woorden 1 Woolwine 1 Woolston 1 Woolrich 1 Woolliscroft 1 Woolgar 1 wool 1 Wook 1 Woodway 1 Woodson5 1 Woodson 1 Woodrow 1 Woodhouse 1 Woodhall 1 Wood-Dauphinee 1 Woodbury 1 wongw 1 Wonder 1 Womens 1 Womack 1 Woltjer 1 Wolters 1 Wolterink 1 Wolosker 1 Wolman 1 Wollstein 1 Wollmuth 1 Wollack 1 Wolkowicz 1 Wolfkiel 1 Wolfgang 1 Wolferen 1 Wolansky 1 Wokke 1 Wojtowicz 1 Wojcieszek 1 Wojcicki 1 Wohlgemuth 1 Woffindale 1 Woerner 1 Woerden 1 Wntpathway 1 WNT-driven 1 WNT5A 1 WNT3 1 WMS-IIIUK 1 WMS-III 1 WMHecognitive 1 WMH-cognition 1 wmarclab 1 Wlodarczyk 1 WKW 1 WJM 1 WJG 1 Wizard 1 WIU 1 Wityk 1 Witvrouw 1 Wittwer 1 Wittpenn 1 Wittmer 1 witnessing 1 witness 1 withSN 1 withPD 1 withp 1 withoutbeing 1 without6 1 with-out 1 withN 1 withmyocardial 1 withmutated 1 withmiR-181b 1 within-scan 1 Withington 1 withfewer 1 Withers 1 withdrawing 1 withdrawals 1 withBVMD 1 withareas 1 withan 1 withage 1 witha1 1 with5 1 with4 1 Wissel 1 Wisniewska 1 Wisner 1 wishing 1 Wisenbaugh 1 Wirtz 1 Wirostko 1 wireless-based 1 wireless 1 Wirdefeldt 1 Wiqvist 1 WIPO 1 Wipfli 1 Winterthurerstrasse 1 Winters-Stone 1 Wintermark 1 Winterhalter 1 Winterer 1 Winsvold 1 Winston 1 Winstein 1 Winnubst 1 winnings 1 winning 1 Winnick 1 Winneret 1 Winnay 1 Winkelmann 1 Winger-chuk 1 Wingeier 1 Winfried 1 Winearls 1 wine 1 Windt 1 Windsor 1 Windisch 1 Winder-Rhodes 1 Winchester 1 Wiltshire 1 Wilton 1 Wilson-Pauwels 1 WilsonMW 1 Wilshire 1 Wilmore 1 Wilmington 1 Willson 1 Willshaw 1 Willschke 1 Willows 1 Willoughby 1 willing-sensing 1 willingness-to-pay 1 willingly 1 Willige 1 Williford 1 Williamsburg 1 Willi 1 Willett 1 Willerson 1 Willers 1 Willenbucher 1 Willemsen 1 Willems 1 Willeit 1 Willebrand 1 Willberg 1 Wilkes 1 Wilkening 1 Wilke 1 Wilk 1 Wilgen 1 Wilfred 1 Wilfong 1 Wildsmith 1 Wilds 1 Wilcoxon-signed 1 Wilcken 1 Wikler 1 wiki 1 Wikberg 1 Wijshake 1 Wijekoon 1 Wiggs 1 Wigginton 1 wife 1 Wietzorrek 1 Wiesmu 1 Wieser 1 Wiesel 1 Wiesbaden 1 Wierda 1 Wier 1 Wienker 1 Wieman 1 Wieldraaijer 1 Wielaard 1 Wiegel 1 Wiegand 1 Wiederrecht 1 Wiederhold 1 Wiedemann 1 Wieben 1 Wieand 1 Widschwendter 1 widowed 1 wide-type 1 widest 1 widens 1 widen 1 Wickham 1 Wichmann 1 Wichers 1 WI-38fibroblasts 1 WI-38cells 1 WI-38 1 whowas 1 whostutter 1 whoosh 1 whole-system 1 wholemounts 1 Whitworth 1 Whittington 1 Whitson 1 Whitrow 1 whitish 1 Whiting 1 Whither 1 whites 1 Whiteman 1 Whiteley 1 Whitehead 1 Whitehall 1 Whiteford 1 Whitall 1 Whitacre 1 whiskers 1 Whishaw 1 whichis 1 whichhas 1 Whew 1 whetherIkBalpha 1 wherea 1 WhenhnRNPA1 1 Wheble 1 Wheatcroft 1 Whatman 1 WGW 1 WFSBP 1 Weyrich 1 Weyerbrock 1 Wever 1 Wetzlar 1 Wetzels 1 Wethen 1 Wetering 1 Wetenschappelijke 1 Westrich 1 Westmacott 1 Westlund 1 Westin 1 Westfield 1 Westermark 1 Westerlund 1 Westerkamp 1 Westerbacka 1 Wester 1 Westendorp 1 Westenberg 1 Westen 1 Westeind 1 Westchester 1 Westberg 1 Wessman 1 Wessells 1 Wesseling 1 Wesseldijk 1 Wesselborg 1 Weschler 1 Werth 1 Werry 1 Wernerman 1 Werneck 1 Wernbom 1 werecompared 1 Werder 1 Weon-Young 1 Wenxin 1 Wenstrom 1 Wennervirta 1 Wenk 1 Weniger 1 Wendschlag 1 Wendling 1 Wender 1 Wendel 1 Wenandy 1 wemeasured 1 Welzel 1 Welwyn 1 Welt 1 Welsh1 1 well-validated 1 well-suited 1 Wellstein 1 well-regulated 1 well-recognised 1 well-powered 1 well-observed 1 well-meaning 1 well-marked 1 wellknown 1 well-intentioned 1 Wellinger 1 well-functioning 1 well-fixated 1 Welleweerd 1 well-differentiated 1 well-delineated 1 well-connected 1 well-conducted 1 well-annotated 1 Welham 1 Welen 1 Weldon 1 welcomed 1 Welchman 1 Welbourne 1 Wejman 1 Weiz 1 Weitman 1 Weiter 1 Weissmann 1 Weissleder3 1 Weisskoff 1 Weisman 1 Weisel 1 Weinmann 1 Weinheimer 1 Weingeist 1 Weinans 1 Weimar 1 Weill-Cornell 1 Weill- 1 Weil 1 Weihs 1 weight-trained 1 weightlifting 1 weighted-mean-difference 1 weighted-mean 1 -weighted 1 weight-bearing 1 weigh 1 Weidner 1 Weibull 1 Wehenkel 1 Wegrzyniak 1 Wegner 1 Wegiel 1 Weert 1 Weering 1 Weerdt 1 weekend 1 week-1 1 wedge-shaped 1 Wedel 1 Wedderkopp 1 Wechose 1 Webster-Stratton 1 web-sites 1 web-services 1 web-response 1 web-optimized 1 weblinks 1 web-enabled 1 web-compliant 1 Webborn 1 web-applications 1 weaving 1 weather 1 wears 1 Weapons 1 Weanalysed 1 wealthier 1 weakest 1 weakens 1 weaken 1 weak- 1 WD-repeat 1 wdb 1 WD40 1 WCD 1 WC500131815 1 WC500006373 1 WC1N 1 WC1E 1 Wayte 1 Wayne 1 waxes 1 Wavrant-De 1 waviness 1 Wavemetrics 1 wavelets 1 wave-lengths 1 wave-34 1 Waucquier 1 Watzke 1 Watve 1 Watt-Morse 1 Watters 1 Watsona 1 Watkinson 1 Watier 1 Watertown 1 Waterson 1 Waterland 1 watering 1 water-filled 1 watercooled 1 Waterbury 1 water21 1 watching 1 watched 1 watch 1 Watari 1 wasthose 1 wasthe 1 wasted 1 Wassermann 1 Wasko 1 washingtonacep 1 washes 1 Wartschow 1 Wartolowska 1 wars 1 Warr 1 warns 1 Warnke 1 Warnier 1 Warnecke 1 Warne 1 warmth 1 warming 1 warmed 1 Warkentin 1 Wark 1 Warehouse 1 Wardell 1 Warde 1 Wardb 1 Wapnir 1 Wapner 1 wantto 1 Wanrooij 1 Wanner 1 Wank 1 WangY 1 Wanget 1 wanes 1 Wand 1 Wancata 1 wAnaesthesia 1 Wamatu 1 Walzer 1 Walwyn 1 Walther 1 Walterspacher 1 Waltering 1 WalshJ 1 Wallston 1 Wallop 1 Wallner 1 Wallinga 1 Wallin 1 Walley 1 Wallet-Faber 1 Waller 1 Wallen 1 Wallach 1 Wal-lace 1 Wallac 1 Walkup 1 walks 1 walk-ing 1 Walker-Samuel 1 walkability 1 Walier 1 Walid 1 Waleed 1 Waldsich 1 Waldman 1 Waldenberg-er 1 Waldburg-Zeil-Klinik 1 Walcher 1 Wakimoto 1 wake-up 1 Wakelin 1 wakefulness 1 Wakeel 1 Wakamatsuet 1 Wakai 1 Wak-abayashi 1 Wakabayashi 1 Waits 1 waitlisted 1 wait-list 1 waiting-list 1 waited 1 wait-and-scan 1 waistlines 1 WAIS-3 1 Wai 1 Waheed 1 Wahba 1 Waguri 1 Wagner-Schuman 1 Waggoner-Fountain 1 Wagenaar 1 wafers 1 Wadsworth 1 Wadsack 1 Wade-Martins 1 Waddell 1 Wadas 1 Wachhorst 1 W81XWH-12-1-0581 1 W81XWH-09-1-0105 1 W81XWH-0401-0425 1 w80 1 W795 1 W790 1 w7 1 w55 1 w355 1 w3 1 w23 1 w20 1 w15-point 1 w143 1 w13287 1 W1206 1 w1200 1 w120 1 w12 1 Vyvyan 1 Vyver 1 Vythilingam 1 Vysis 1 Vygon 1 Vyas 1 VWR 1 VV 1 Vulpiani 1 vulgaris--incidence 1 Vulakovich 1 Vucetic 1 vtmednet 1 V-slope 1 vScosa 1 VSC 1 vs60 1 V-RQOL 1 Vrije 1 Vrieze 1 Vries-Hospers 1 Vriendt 1 Vrielink 1 Vrie 1 vref 1 Vreeland 1 Vranis 1 VPS35 1 VPM 1 VPL 1 VPH 1 voxel-to-voxel 1 voxel-by-voxel 1 vowels 1 vowel-duration 1 Vousden2 1 Vought 1 Voudouris 1 Voucher 1 votes 1 voted 1 Voss 1 Vosjan 1 Voscopoulos 1 vortexed 1 Voronov 1 Voors 1 Vonofakos 1 Vonk 1 vonDadelszen 1 Voncken 1 vomitus 1 volvulus 1 volumetrics 1 volume-load-equated 1 volume-imaging 1 volume-equated 1 volume2 1 Volterrani 1 voltagegated 1 Volsko 1 Volpicelli-Daley 1 Volpi 1 Vollmer 1 Volley 1 Vollestad 1 Volkov 1 Volkert 1 volitionally 1 Volek 1 Volcker 1 volcanic 1 volatile 1 Vojtesek 1 voices 1 voice-response 1 voice-related 1 voiced 1 voice9 1 Vogtmann 1 Vogtland-Klinikum 1 Vogtareuth 1 Voets 1 Voelzke 1 VMY 1 VMAT2 1 vlkalervo 1 vliezen 1 Vliegenthart 1 Vlassenbroeck 1 Vlahov 1 Vladic 1 VLA-4 1 VKORC1 1 V-Ki-ras2 1 Viz 1 vivomodulation 1 vivisection 1 Vivier 1 Vivian 1 Vives 1 Vivantes 1 Vivacqua 1 vitronectin 1 vitrofertilization 1 vitro21 1 Vitolo 1 Vito 1 Viteri 1 vitelliformlesions 1 vitelliformlesion 1 vitdoc 1 Vita-Salute 1 vitamin-free 1 vita-min 1 vitamers 1 Vitalstatsonline 1 Vita 1 Viswanathan 1 visuals 1 visual-pigment 1 visualised 1 Vist 1 Visser-Vandewalle 1 VisSci 1 Visscher 1 Visone 1 visit-level 1 VisionRes 1 visionis 1 visionfunction 1 vision-associated 1 Visintin 1 visibly 1 Vishwanathan 1 Visco 1 Visakorpi 1 VISA 1 virus-positive 1 virus-mediated 1 virus-infected 1 virtualdub 1 Virtanen 1 Virnig 1 Virik 1 viridissimo 1 Virgulto 1 viremic 1 Virelizier 1 Virchow 1 Virankabutra 1 violet 1 violence-based 1 violate 1 Viola 1 Vinzentius-Kranken-haus 1 Vintzileos 1 VintersHV 1 Vinkers 1 Vining 1 Vingerling 1 Vingerhoets 1 Viney 1 Vine 1 Vind 1 Vinculin 1 Vincitorio 1 Vinci 1 vincere 1 VINCENZO 1 -Vincenz-Hospital 1 Vincenz 1 Vinay 1 Vin 1 Vimpani 1 Villemure 1 Villejuif 1 Villegas 1 Villasmil 1 Villarruel 1 Villani 1 Villamor 1 Villalba 1 Villafranca 1 Villablanca 1 Viljanen 1 Vilarino-Guell 1 Vilar 1 Vila-nova 1 Vilalta 1 Vila-franca 1 Vikhanskaya 1 Vik 1 Vijgen 1 Vijay 1 Vij 1 ViitanenJV 1 Viitanen 1 Viikari 1 viii75 1 VI-H14 1 Vigushin 1 vigour 1 vigorously 1 vigor 1 Vigod 1 Vignos 1 Vignatelli 1 Vigil-De 1 vigilant 1 Viggiano 1 Viganello 1 View-Resource 1 viewof 1 viewarticle 1 Vieusseux 1 Vietsch 1 Vieten 1 Viertel 1 Vienola 1 Vieira-Saecker 1 Vidnovic 1 Videtic 1 Video-fluoroscopy-asp 1 videofluoro-scopy-asp 1 videofluorographic 1 video-cameras 1 videocamera 1 video-analysis 1 vided 1 Victor3 1 victimization 1 victimisation 1 Vicryl 1 VICHI 1 VicenziM 1 Vicencio 1 Vice-Dean 1 Vicaut 1 vibrotactile 1 vibrator 1 VIb 1 Viaud 1 Viana 1 Viaccoz 1 VHS 1 VHL 1 VHA 1 VFQ-25 1 vfq 1 V-F 1 vexed 1 vex 1 Vetrano 1 Vestri 1 vesticles 1 vestibule 1 Vessella 1 vessel-forming 1 Veske 1 vesicularmonoamine 1 vesiclesin 1 Verwoert 1 Vertes 1 verteporfin 1 Verschuuren 1 Verschure 1 versatility 1 Versant 1 Verrey 1 Verreault 1 verolimus-Eluting 1 Vero 1 Verny 1 Vernersson-Lindahl 1 Vermoolen 1 vermilion 1 vermiform 1 Vermeylen 1 Vermeer 1 Vermathen 1 vermal 1 Verma 1 Verlinde 1 Verkaik 1 verity 1 Verissimo 1 Verio 1 Verinaire 1 Verin 1 Verhoef 1 Verhesen 1 Verhaar 1 Vergouw 1 verge 1 Vereniging 1 Vereker 1 Vereeck 1 Verdugo 1 Verducci 1 Verdonck 1 Verdoes 1 Verdin 1 Verdenik 1 Verbunt 1 verbs 1 Verbraak 1 Verbitsky 1 Verbeek 1 verbal-based 1 Verbaan 1 verb 1 Verardi 1 veranderungen 1 Vera 1 Veps 1 venue 1 ventrocaudalis 1 Ventrapragada 1 vention 1 ventilator 1 ventilationto 1 Venkatesan 1 Venkat 1 venipuncture 1 Venecia 1 Vendrov 1 Vendrell 1 vendor-specific 1 vendors 1 vending 1 Venables 1 vena 1 Velzen 1 Velupillai 1 Velozo 1 Velocity-estimation 1 Velloso 1 Velenska 1 Veldkamp 1 Veldhuisen 1 Veldhoven 1 Velde 1 Velavan 1 Velasco-Hernand 1 Vela 1 vel 1 Vekony 1 vejjlocity 1 Veizovic 1 Veinbergs 1 Veikondis 1 Veiga 1 Vehkavaara 1 vehicle-placebo 1 Vegt 1 VEGFR2 1 VEGF-mediated 1 VEGF-A 1 vegeta-bles 1 Vega-Bermudez 1 Veerhuis 1 Veera 1 Veenma 1 Veenema 1 Veen 1 Vederine 1 vector-mediated 1 Vectastain 1 Vecchi 1 -ve 1 vdnBergh 1 VDJ 1 VDFS 1 VDA 1 VBM5 1 Vazquez-Chona 1 Vavrek 1 Vavere 1 Vautier 1 Vaupel 1 Vaud 1 Vatten 1 Vatican 1 Vataja 1 Vasudevan 1 Vassilatis 1 Vasseur 1 VassarR 1 Vassar 1 Vass 1 vasopressin 1 vasoconstrictors 1 vasoconstrictor 1 vasoactivities 1 Vasilyev 1 Vasiliev 1 Vasiliadis 1 Vasilevskis 1 vasculogenesis 1 vasculitides 1 Vasculitic 1 vascula-ture 1 vascularageing 1 VASA-RI 1 Vasan3 1 VAS18 1 varyingfrom24hto1 1 Varney 1 Varnauskas 1 Variyam 1 variously 1 varieties 1 variegata 1 varicosities 1 varicella 1 Varian 1 varia-Growth 1 Vargas-Lopes 1 Varela-Roman 1 Varanasi 1 Varadarajan 1 Vapors 1 vanWalraven 1 Vanti 1 Vannier 1 Vanni 1 Vanneuville 1 Vann 1 Van-Mierlo 1 Vanluchene 1 VanLaar 1 Vanini 1 vanhemelrijck 1 Vanhatalo 1 Vanhaesebroeck 1 Vangkilde 1 Vane 1 Vanduffel 1 Vandin 1 Vandewalle 1 VanderWeele 1 Vandervelden 1 Vandermosten 1 Vandermeersch 1 Vander 1 Vandepitte 1 VanDenKerkhof 1 Vandenbroucke 1 Vandekerckhove 1 Vandebona 1 VanDam-Baggen 1 Vanda 1 Vanbellinghen 1 Vanbelle 1 vanAlmen 1 Vanacore 1 Vamvakas 1 Valverde 1 valve9 1 values17 1 valueof 1 valuations 1 valu 1 Valton 1 Valter 1 Valpuesta 1 Valls-Sole 1 Valli 1 vallecula 1 Valldeoriola 1 Vallabhajosyula 1 Vall 1 valine 1 Valhalla 1 Valero-Cabre 1 Valerie 1 Valentin-Vega 1 Valentini 1 Valentin 1 Valenstein 1 Vale 1 Valdimarsson 1 Valdez 1 Valderas 1 Vald 1 Valckenberg 1 Valbonesi 1 Valberg 1 ValasekT 1 Valades1 1 Valad 1 Vaki-fahmetoglu-Norberg 1 Vakifahme-toglu-Norberg 1 Vaishnavi 1 Vaisanen 1 Vaillant 1 Vaidyanathan1 1 VAhave 1 Vagts 1 vaginally 1 vaginal-anal 1 Vagaries 1 vagalneurons 1 Vadis 1 vacuum-assisted 1 vacuoles 1 vacuolar 1 vacular 1 Vachon-Presseau 1 vaccine 1 Vaccarino 1 Vacas 1 V750 1 V6H 1 V600E 1 V4 1 V2013 1 v20 1 v17 1 V15 1 v1 1 -V 1 uzleuven 1 Uyeki 1 Uwe 1 uvt 1 Uversky 1 uveal 1 UVB 1 UuzMZ 1 Uurbil 1 U-type 1 utu 1 Utts 1 Utting 1 -UTR 1 u-tokyo 1 Utley 1 Utine 1 utilizzo 1 utcome 1 UTBAS 1 Utan 1 Usui 1 usu-ally 1 Ustun 1 Ustinova 1 Ussher 1 Usoskin 1 usingan 1 Ushio-Fukai 1 Usher 1 US-guided 1 USF1 1 useslow 1 user-selected 1 user-friendly 1 user-defined 1 usefulmodel 1 usefulinthe 1 usedto 1 usedthese 1 USCOMbias 1 USCD 1 USB 1 Usal 1 Usage-Over 1 Usadel 1 Usachev 1 USA6Department 1 USA35Department 1 USA11Department 1 Uryu 1 Urwin 1 urticaria 1 Urso 1 Ursell 1 Urschel 1 Uropathology 1 urological 1 urogynecolgists 1 urogenital 1 Urodyn 1 Urines 1 urinalysis 1 Urhausen 1 urging 1 urgency 1 urged 1 urge 1 urethral 1 urea-insoluble 1 ure6C 1 Ure 1 Urbich 1 Uray 1 urate 1 Uras 1 uranyl 1 urane 1 uracil 1 UR 1 Uptidisc 1 Upshur 1 up-regulating 1 up-regulates 1 upper-motor 1 upper-level 1 upper- 1 uploaded 1 upload 1 uphill 1 upgrade 1 up-dated 1 Updat 1 Upchurch 1 upbeating 1 uorescein 1 UO 1 unwrap 1 unwilling 1 unwell 1 unwarranted 1 Unverzagt 1 unverified 1 unveils 1 untoward 1 untold 1 Untied 1 untested 1 Unterhuber 1 untenable 1 Untch 1 untapped 1 untangle 1 UNSW 1 unsupported 1 unsubstantiated 1 unstratified 1 unstimulated 1 unstandardized 1 unspliced 1 unsolved 1 unsilencing 1 Unser 1 unselected 1 unseeded 1 unscaled 1 unsafe 1 Unruh 1 Unresponsiveness 1 unresolved 1 unresectability 1 unrelieved 1 unregulated 1 unravels 1 unraveled 1 unravel 1 unquestionable 1 unprovoked 1 unproven 1 unproductive 1 unprocessed 1 unpredicted 1 unpredictability 1 unpowered 1 unpotentiated 1 Unported 1 unpleasantness 1 unpleasant 1 unphosphorylated 1 unphagocytosed 1 unper-turbed 1 unpaid 1 unorganized 1 U-nonparametric 1 unodc 1 unobserved 1 unnoticed 1 unneeded 1 unmutated 1 unmultimedia 1 unmatched 1 unmasks 1 unmasking 1 unmask 1 unmanageable 1 Unlocking 1 unloaded 1 unlearning 1 Unkila-Kallio 1 Unkel 1 university-wide 1 Universitedu 1 Universitatsmedizin 1 UniversitatKoln 1 Universitaria 1 Universidad 1 universes 1 universe 1 univariately 1 uni-tuebingen 1 uniting 1 unitina 1 Unitas 1 Union-integrated 1 uninterrupted 1 unimagined 1 unilaterally-applied 1 uni-jena 1 unijena 1 unige 1 unifies 1 unidirectional 1 unicef-women-most-affected-ebola-outbreak-in-w-africa 1 unibo 1 uni 1 Ungern-Sternberg 1 unfortunate 1 unfolding 1 unfixed 1 unfit 1 unfilled 1 unfeasibly 1 unfamiliarity 1 unfair 1 uneventfully 1 unevenly 1 uneven 1 unethical 1 Unes 1 unemployed 1 uneasy 1 uneasiness 1 undocumented 1 undocked 1 undiscovered 1 undeveloped 1 undesirably 1 undescribed 1 Underwood 1 undertreatment 1 undersupply 1 understates 1 understands 1 under-stand 1 understaffed 1 underserved 1 Undersea 1 underscores 1 underscored 1 undersampling 1 under-representation 1 underrepresent 1 underreported 1 under-report 1 underpinned 1 under-pin 1 undernutrition 1 undermost 1 undermined 1 undermine 1 under-lying 1 underly 1 underlining 1 underling 1 under-line 1 underidentification 1 undergrounds 1 underexpression 1 under-explored 1 underexplored 1 underestimates 1 underembolization 1 underdosing 1 underdosed 1 undercuts 1 undercut 1 underactivity 1 under-65 1 under-22 1 under-18 1 under-17 1 under- 1 undeniably 1 undefined 1 undderstandably 1 uncurated 1 uncovering 1 uncoupling-protein-mediated 1 uncorrelated 1 uncontrollable 1 uncontaminated 1 unconditioned 1 un-complicated 1 uncommonly 1 unclearif 1 unclassified 1 uncharacteristic 1 uncertainly 1 unc-51 1 unc-30 1 unbound 1 unblinding 1 un-blinded 1 unblinded 1 unbinding 1 unavoidable 1 unattended 1 unattainable 1 unassessed 1 unassessable 1 unaffordability 1 unacknowledged 1 unacceptably 1 Umezawa 1 Umesaki 1 Umeki 1 Umehara 1 Umehana 1 umcg 1 Umbricht 1 umbrellas 1 umbilicius 1 Umakoshi 1 uMAbeta1 1 Ulzheimer 1 Ulusoy 1 Ulugol 1 Uluda 1 ultraviolet-visible 1 ultratrail 1 ultrathin 1 ultrastructures 1 ultrastructurally 1 Ultrastruct 1 ultrasound-trained 1 ultrasono-graphic 1 ultrasonication 1 ultraso- 1 ultrashort-echotime 1 Ultrasensitive 1 Ultrascan 1 ultra-pure 1 ultramicrotomy 1 Ultra-marathons 1 ultramarathons 1 ultralong 1 ultrahistochemical 1 Ultrahigh-speed 1 ultrahighresolution 1 ultra-fast 1 ultrafast 1 ultra-centrifugation 1 ultracentrifugation 1 Ulsan 1 Ullrich 1 Ulloa 1 Uljevic 1 ulcerated 1 ulb 1 UL1RR025747 1 uL 1 uky 1 UKS 1 uknews 1 uk-koeln 1 UKJT 1 UKefunded 1 UK13 1 UJ 1 Uitterdijk 1 uitgevers 1 uiowa 1 uids 1 uhrsen 1 UHPS 1 uhn 1 Uhl 1 Uhde 1 Ugrinowitsch 1 Uggla 1 ugent 1 Uganda 1 U-fibers 1 Ufficio 1 UF 1 UenT 1 Uenishi 1 uences 1 uenced 1 Uemura 1 uel 1 UE-HEALH-F2-2008-201666 1 Udy 1 Udo 1 udis 1 Uden 1 Udaka 1 ucsf 1 ucsc 1 UCP3 1 ucm391465 1 ucm348252 1 UCM334743 1 ucm310870 1 ucm309742 1 UCM230597 1 ucm126486 1 ucjc 1 UCHL1 1 Uchino 1 ucdenver 1 UCD 1 UCB 1 Ubuka 1 ubiquitylation 1 ubiquity 1 ubiquitin-proteasome 1 ubiquitin-immunoreactive 1 Uber 1 Ubeda-Banon 1 Ubeda-Ba 1 Ube3a 1 UAS 1 uams 1 u2-u2 1 U19 1 U133 1 U1045 1 U1042 1 Tzourio-Mazoyer 1 Tzourio 1 Tzoulis 1 Tz-NHS 1 Tzitzilonis 1 Tzischinsky 1 Tzifa 1 Tzekov 1 tze 1 Tzanakakis 1 TZ 1 Tysnes 1 Tyrrell 1 tyrosine-protein 1 Tyring 1 Tyr3 1 Tyr204-E10 1 Tyr2 1 typography 1 typographic 1 typesdepithelial 1 type-I 1 type-dependent 1 type-2 1 type-1A 1 -type 1 Tyne 1 tympanostomy 1 tympanograms 1 Tyler 1 Tyers 1 two-times 1 two-steps 1 two-step 1 two-point 1 two-module 1 two-hit 1 two-faced 1 two-compartmental 1 Two-class 1 two-center 1 Twitter 1 twist 1 Twinspeed 1 twinning 1 Twinklein 1 twich 1 twicea 1 Twenty-seven 1 Twenty-micrometer-thick 1 Twenty-eight 1 tw- 1 TVT 1 TV 1 tuzcue 1 tutorial 1 Tutela 1 tusk 1 Turtles 1 Turski 1 Turrell 1 Turovets 1 Turolla 1 turnovers 1 turmoil 1 Turmaine 1 Turksever 1 Turkkila 1 Turkheimer 1 Turkbey 1 Turkaly 1 Turic 1 Turhan 1 Turchinovich 1 turbinectomy 1 turbinate 1 Turato 1 Turan 1 Turaga 1 Tupling 1 Tupler 1 Tuominen 1 Tuomilehto 1 tunneling 1 Tunkel 1 Tunisien 1 tunings 1 tungsten 1 Tung 1 TUNEL-positive 1 Tuna 1 tumourigen-esis 1 Tumour-educated 1 tumor-to-organ 1 tumor-to-kidney 1 tumorswas 1 tumor-suppressors 1 tumor-seeking 1 tumors2 1 tumors10 1 -tumors 1 tu-mors 1 tumor-induced 1 tumorigenesis-associated 1 tumori- 1 Tumori 1 tumor-free 1 tumorextension 1 tumor-bone 1 tumor-binding 1 Tumonis 1 Tumeurs 1 Tumani 1 Tuma 1 Tulkens 1 Tulbert 1 Tukey-Kramer 1 Tugyi 1 Tufvesson 1 tufts-nemc 1 Tufts 1 Tucson 1 Tucsek 1 TuckereLewis 1 tu-children 1 Tuboplast 1 Tubingen 1 Tubiana-Hulin 1 tubercle 1 tube-like 1 tubefunction 1 Tu 1 TTR 1 T-to-C 1 tte-minimum-dataset 1 TTCTCGTGGTTCACACCCAT 1 Tsutsui 1 Tsutamoto 1 Tsurugizawa 1 Tsunoda 1 Tsuneoka 1 Tsunenari 1 Tsunekawa 1 Tsukasaki 1 Tsukamoto 1 Tsukada 1 Tsujino 1 Tsuda 1 TSPO 1 tspace 1 tsklinik 1 TSK-Gel 1 Tsilchorozidou 1 Tsie 1 Tsetsenis 1 Tschumi 1 Tschopp 1 Tschanz 1 TSB 1 Tsatsakis 1 Tsangaris 1 Tsanaclis 1 Tsaiet 1 TS0669860 1 T-S 1 tryptone 1 trypsinization 1 trypsin-ethylenediamine 1 Tryndyak 1 Tryggvason 1 truvenhealth 1 Truven 1 truths 1 trusts 1 trusting 1 truncations 1 truncating 1 Trumpp 1 Truijen 1 Truglia 1 Trueta 1 True-positive 1 True-negative 1 TrueFISP 1 Truebel 1 Trudel 1 Trudeau 1 TroxelA 1 Troxel 1 trove 1 Trout 1 Troung 1 Troughton 1 troubling 1 Trotts 1 Trottier 1 Trotta 1 Trost 1 Troppan 1 tropism 1 tropic 1 Trope 1 Trop 1 Troosters 1 Trono 1 trometh-amine 1 Tro-janowski 1 Troiano 1 Troendle 1 trocar 1 Trobridge 1 Trneny 1 tRNALys 1 TRM 1 trivially 1 Trivedi 1 Triulzi 1 trituration 1 tritiated 1 Tristan-Vega 1 trismus 1 trisected 1 Trisciuoglio 1 trisbuffered 1 Trip-specific 1 trippingI 1 Trippa 1 triples 1 tripled 1 tripeptide 1 Tripathy 1 trioxide 1 Trio 1 trinucleotide 1 Trinquart 1 Trinquand 1 Trinkmann 1 Trinity 1 tri-n-butyl 1 trimethylation 1 trimethylated 1 tri-mester 1 trillion 1 Trillat 1 trilateral 1 trigonometry 1 Trifunctional 1 trifluoroacetic 1 triethanolamine 1 Trier 1 tricyclic 1 tri-consonant 1 tricarboxylic 1 tribution 1 tribute 1 tribbleshomolog 1 triaxial 1 triathletes 1 triangu-lar 1 triam-cinolone 1 trial-tested 1 trials6 1 trials3 1 trials22 1 trialled 1 Trialists 1 trialed 1 trialcomparing 1 trialby 1 trial27 1 trial19 1 triage 1 triad 1 triacetic 1 TRF2 1 Trezzab 1 Trezeguet 1 Treyer 1 Trevor 1 Trevigen 1 tress 1 Tresham 1 Trepel 1 Trepanowski 1 Trent 1 Trenkwalder 1 trending 1 trended 1 Trend-Data- 1 trenches 1 Tremper 1 tremors 1 trembling 1 Trejo 1 Treitz 1 Trehan 1 Tregellas 1 Treestar 1 Treede 1 treatment-versus-prevention 1 treatment-RMDD 1 treatment-responsive 1 treatment-induced 1 treatment- 1 treating-breast-cancer 1 treat- 1 Treadway 1 treadmilltemporarily 1 Treacher 1 tre 1 TRB-5MS 1 trays 1 Traynelis 1 Traylor 1 tray 1 Traverso 1 traverses 1 traversed 1 traversals 1 traveling 1 traveled 1 Trautwein 1 Traunstein 1 traumatized 1 tration 1 trategies 1 trasfusione 1 trascendenza 1 Trapp 1 trapezius 1 Tranum-Jensen 1 transversional 1 transversely 1 transtubalsteroids 1 transthyretin 1 trans-thoracic 1 Transsynaptic 1 transsulfuration 1 trans-RPE 1 transrectalultrasound-guided 1 transposons 1 transports 1 transporter-immunoreactive 1 trans-port 1 transplants4 1 trans-plantation 1 Transpl 1 transparantie 1 transorally 1 transneuronal 1 transmitting 1 transmitted-light 1 transmitochondrialcybrids 1 transmitochondrial 1 trans-mission 1 transmethylation 1 transluminal 1 translocase 1 Translat 1 Translab- 1 transit-time 1 transitional-aged 1 transi-tion 1 transiting 1 Transience 1 transfusing 1 transfused 1 transfuse 1 transformedby 1 transformative 1 transferring 1 transferrable 1 transference 1 transferability 1 trans-fected 1 Transductions 1 transduce 1 transdiaphragmatic 1 transcyclooctene-modified 1 trans-cyclooctene 1 transcyclooct-4-en-1-yl 1 transcriptions 1 transcriptionist 1 transcriptionaltarget 1 transconductance-capacitance 1 transcendent 1 transcend 1 transcel-lular 1 transcardially 1 transcardial 1 transarticularly 1 transaminases 1 transaldolase 1 trans-activation 1 Transactivation 1 transactivating 1 Transactions 1 Tramontana 1 trameti-nib 1 training-based 1 train-ing 1 trainability 1 trails 1 trail-making 1 TrailD 1 Tragante 1 traffics 1 trafficked 1 traffic 1 tradition 1 tradeoff 1 traded 1 TracyM 1 Tracy 1 tractotomy 1 traction 1 trace-weighted 1 traceof 1 -traceable 1 TR19 1 TQ 1 TPL 1 TPC 1 tPA-related 1 Toz 1 toyprompt 1 Toyoda 1 toyhelp 1 Toye 1 toxicologists 1 toxicological 1 toxicity26 1 toxicant 1 Toxcity 1 Towner 1 Tower 1 Towcester 1 Towbin 1 Tovmasian 1 tovarious 1 Touyz 1 Toutain 1 Toussaint 1 Tournaye 1 tourism 1 Tour 1 touchstone 1 touching 1 touched 1 Totowa 1 Totola 1 toto 1 totem 1 Totaro 1 totality 1 totalitananism 1 Tosun 1 Tosoh 1 Tosiaki 1 Tosetto 1 Toru 1 tortuosity 1 Tortosa 1 tortoises 1 Torsten 1 Torronen 1 Torres-Oviedo 1 Torres-Espallardo 1 Torrents 1 Torrance 1 Tornell 1 Tormey 1 Torgerson 1 Torevell 1 Tordjman 1 Torchiana 1 Toppinen 1 -topped 1 topped 1 topost-trial 1 topologically 1 topologic 1 Topographical 1 Topogr 1 topectomy 1 Topcon 1 TopBP1 1 Tooyoma 1 toother 1 Toosy 1 toolkit 1 tonuclear 1 tonsillar 1 Tononi 1 Tonon 1 tonometry 1 Tonn 1 Tonino 1 Tonerini 1 tone-foot 1 tone-audiometry 1 Tomson 1 Tompkins 1 Tomotaka 1 Tomography-high 1 tomographye 1 tomography-based 1 to-mographs 1 tomodel 1 TOMM40 1 tomitochondrial 1 tomitochondria 1 tomiR-21 1 Tomini 1 Tomidokoro 1 Tomida 1 tomen 1 Tomei 1 Tombini 1 Tomazin 1 tomatoes 1 Tomasi 1 Tomasetti 1 Tomais 1 Tolstonog 1 Tolnay 1 Tolmachev 1 Toli 1 tolerant 1 tolerance-induction 1 Tole 1 Toldo 1 Toksvig-Larsen 1 Tokorozawa 1 Tokomitsu 1 Tokola 1 Toklu 1 Tojo 1 Toitus 1 toincreased 1 toIkBalpha 1 Toi 1 Tohoku 1 toggle 1 togetherwith 1 Togashi 1 Togas 1 Togain 1 tofind 1 toextend 1 toexpandand 1 toes 1 toe 1 Todorovic 1 Todenhofer 1 Todate 1 Tocologie 1 Tochigi-ken 1 Tobis 1 Tobiassen 1 Tobian 1 tobedside 1 toAPOE 1 toanalyze 1 toaddress 1 toad 1 toa 1 TO90317 1 to49 1 to40 1 TNF-alpha 1 TMR 1 TMEM56 1 TMB 1 T-lymphocytes 1 T-lymphocyte 1 Tlsty 1 TLC 1 TKR-related 1 TKDE 1 Tkatch 1 Tkaczyk 1 TJM 1 Tjian 1 Tiziana 1 TiW 1 tive 1 titres 1 Titrate 1 Titianova 1 titers5 1 titans 1 Tita 1 tissueswere 1 tissue-plasminogen 1 tissue-homing 1 tissue-equivalent 1 Tison 1 tischfield 1 Tirumala 1 Tirsi 1 tip-to-tip 1 Tips 1 tionship 1 tions 1 tional 1 Tinmouth 1 tinib 1 Tinetti 1 Tinelli 1 tinea 1 tine 1 Tinat 1 TIMP3 1 Timone 1 Timmons 1 timing-dependent 1 timingand 1 timia 1 timeyso 1 time-sensitive 1 timescales 1 time-scale 1 time-locked 1 timeliness 1 timelines 1 time-independent 1 time-driven 1 Time-de-pendent 1 time-density 1 time-delay 1 time-course 1 time-contribute 1 time-concentration 1 time0 1 -Time 1 Tilyard 1 Tilson 1 Tilma 1 Tilley 1 Tillack 1 Tillaar 1 tileset 1 tilde 1 Tijssen 1 Tiippana 1 tifying 1 Tiffany 1 Tieu 1 Tietjens 1 ties 1 tiering 1 Tiel 1 Tiedemann1 1 Tiede 1 tides 1 Tidefelt 1 Tidball 1 tic-related 1 ticket 1 ticked 1 Tichy 1 Tichopad 1 Tichauer 1 Tibshirani 1 tibiofemoral 1 tibia 1 Tibe 1 Tibbs 1 Tibana 1 thyro-hyoido-pexy 1 thymic 1 thymectomy 1 Thyfault 1 Thy1-inducedWT 1 Thy1-inducedtransgenic 1 Thy1-hSNCA140 1 Thy1-hSNCA 1 thwarts 1 thwarting 1 thwarted 1 Thurzo 1 ThurneysenT 1 Thurneysen 1 Thurman 1 Thung 1 Thulin 1 thrust 1 Thrumurthy 1 Throwing 1 through-space 1 through-out 1 Throop 1 thromboxanes 1 thrombospondin 1 thrombo-embolic 1 thrombin-binding 1 thrich 1 thrice 1 threshold-free 1 Threshold-based 1 -threshold 1 Thresher 1 Threlfell 1 Three-Year 1 three-week 1 three-step 1 three-segment 1 Three-region 1 three-point 1 Three-person 1 three-month 1 Three-lead 1 three-in-one 1 threeindependent 1 three-fourths 1 threefold 1 three-color 1 three-beam 1 three-alternative 1 three- 1 threatens 1 threaten 1 Threat-and 1 Thr246 1 Thr202 1 THP-1 1 Thourani 1 thoughtto 1 thought-provoking 1 Thorstensson 1 thorsell 1 Thorp 1 thoroughness 1 Thoroughbred 1 Thornwood 1 Thornton 1 Thornell 1 Thorn 1 Thormer 1 Thorhauer 1 Thorell 1 Thor-axklinik 1 thoracotomy 1 Thoracoscopic 1 ThompsonLD 1 Thompsonb 1 Thome 1 thomasmore 1 Thomas1 1 Thom 1 Thoeny 1 Thliveris 1 thK 1 Thisted 1 Thissen 1 thisdisease 1 thiscomes 1 Thiruchelvam 1 Thirty-three 1 Thirty-seven 1 Thirty-five 1 Thirty-eight 1 Thirty- 1 third-trimester 1 third-round 1 thirdline 1 third-generation 1 third-degree 1 thiosemi-carbazone 1 thionin-stained 1 thiols 1 thioflavine 1 thinness 1 thinkers 1 Thinard 1 TH-immunoreactive 1 Thilly 1 Thijs 1 Thierry 1 Thieme 1 Thielemans 1 Thiel 1 Thiebaud 1 thicknesses 1 thicker 1 thickens 1 thicken 1 Thibaut 1 thiazolidinediones 1 thiamin 1 theymaybe 1 Thewlis 1 thewhole 1 thevulnerability 1 theVTA 1 TheVE 1 thetoxic 1 theThy1 1 theTCF7L2 1 thesynapses 1 thesubtleties 1 theses 1 theseproteins 1 theseinputs 1 these39 1 Thesaurus 1 Therole 1 thermotolerance 1 Thermo-Scientific 1 thermoregulatory 1 thermocycler 1 Theriot 1 Therewere 1 therein 1 Thereduction 1 Theravance 1 therapy-resistant 1 therapeuticstrategy 1 Theranostics 1 theranostic 1 theproposed 1 theproduction 1 theproduct 1 theposterior 1 thePI3KCA 1 thepatient 1 theP1 1 theory-based 1 theorized 1 theoretically-derived 1 theoretic 1 theorems 1 Theor 1 theOptotrak 1 Theodorou 1 Theodoro 1 Theobald 1 thenative 1 Themulticenter 1 themouse 1 themost 1 themitochondrial 1 the-miR-135b-AMO 1 themice 1 themechanism 1 themajor 1 themacular 1 them39 1 Thelma 1 thelinker 1 Thelen 1 Theisen 1 theirs 1 theinsulin 1 theinner 1 theIkBalpha-binding 1 theIkBalpha 1 theIkappaBgene 1 thehuman 1 theHRRT 1 theHRis 1 TheG209A 1 theFOXO3A 1 theFinnish 1 theeyes 1 the-economics-of-health-care-reform 1 thedopaminergic 1 theDJ-1 1 thedisease 1 theDFS 1 thedegree 1 theDA 1 thecorehis-DNA 1 thecal 1 thebreadth 1 theBelgian 1 Theander 1 theA 1 the6 1 the3- 1 the26S 1 the20th 1 the19th 1 the14 1 the13 1 the1- 1 -the 1 THBS-1 1 thatyit 1 thatused 1 thatsynphilin-1 1 thatsuppress 1 thatBrice 1 thatahostof 1 thapsigargin-induced 1 Thapa 1 Thanos 1 thanked 1 Thancanamootoo 1 Thanassouliset 1 Thanassoulis 1 than3 1 than2 1 Thams 1 Thames 1 Thalmann 1 Thaler 1 thalassaemia 1 thalamotomy 1 thala-motomies 1 thalamologist 1 -thalamic 1 Thakor 1 Thach 1 TH2-mediated 1 Th1-selective 1 TH1-mediated 1 Th128 1 TG-rich 1 TGF-b-induced 1 TGFbeta-OTX2 1 TGFbeta-induced 1 TGFbeta 1 TGF- 1 TGF 1 TG-enriched 1 TGACATTGGGCCAGAAATCC 1 TG- 1 tfD 1 Tfam 1 TFA 1 textures 1 textual 1 texts 1 Tewksbury 1 Tewk 1 Teule 1 Teuissen 1 Tettnang 1 Tett 1 tetsu 1 Tetrud 1 Tetreault 1 Tetrazine-trans-cyclooctene 1 tetrazine-modified 1 tetrazine-based 1 tetraplegia 1 tetramethylrhodamine 1 tetrahydro-metabolites 1 tetrahydro-cortisone 1 tetrahy-drocortisol 1 tetrahydrochloride 1 tetracysteine-tagged 1 tetracycline-suppressive 1 tetracycline-dependent 1 tetrachromatic 1 tetra-acetic 1 tet-off 1 tethers 1 tethered 1 tetanus 1 testsin 1 testof 1 Testis 1 testing-1999 1 testicular 1 tester 1 test-3 1 test26 1 Tesson 1 tessellate 1 Teslovichet 1 Tesler 1 Teschendorf8 1 TerziS 1 Terzic 1 Terwee 1 Tervonen 1 tertile 1 tertiarycare 1 tert-butyl-hydroperoxide 1 tert-butyl 1 -terrorists 1 terrorismosuicida 1 terrorismo 1 Terron-Kwiatkowski 1 Terrin 1 Terrillon 1 terrible 1 Terri 1 Terres-Martos 1 Terrenato 1 Terraz 1 Terrassa 1 TERRAoligonucleotides 1 Terrace 1 Terpos 1 Ter-Pogossian 1 Terp 1 terminations 1 terminating 1 terminates 1 Teresky 1 Tereshchenko 1 Terese 1 Terdiman 1 TERC 1 Teratol 1 teratogens 1 Terasaki 1 Teranishi 1 Terada 1 terabytes 1 terabyte 1 ter 1 Tepper 1 Teplan 1 Teo 1 tenuous 1 tentimes 1 Tenth 1 tensile 1 ten-sentence 1 tense 1 tenotomy 1 tenor 1 Teno 1 Tenhunen 1 tenfold 1 tendrils 1 tendon-loading 1 tendinosis 1 tendino-pathies 1 tendinitis 1 tenderness-funisitis 1 Tendal 1 TEMs 1 Tempst 1 temporo-parieto-occipital 1 temporoparietal 1 temporal-parietal-occipital 1 temporale 1 Temperature-induced 1 Tempelmann 1 temozo-lomide 1 Temno 1 Temkin 1 Temecula 1 Telzer 1 telomericrepeats 1 telomerasein 1 tel-omerase 1 telo-merase 1 telome-rase 1 tells 1 Tellmann 1 Tellez 1 Telford 1 television 1 telerobotic 1 Teleretinal 1 telephoned 1 teleost 1 tele-ophthalmology 1 telemetry 1 Telemedicine-related 1 telemedicine- 1 telemedical 1 Teleki 1 Tele-diabetic 1 telecommunication 1 telangiectasia-affected 1 telangiectasia 1 Teklad 1 Tekce 1 Tejpar 1 Tejpal 1 Tejero 1 Tejerina 1 Tejera 1 Te-jada 1 Teixeira-Carvalho 1 Teive 1 Teipel 1 Teikyo 1 tegmentalarea 1 Tegeder 1 Teflon 1 teeth 1 Teesson 1 tedious 1 Tedford 1 Tedesco 1 Ted 1 Tecmachine 1 TechNotes 1 technology-related 1 technology-dependent 1 Technologists 1 technique10 1 Technion-Israel 1 Technion 1 technetium 1 teborg 1 tearing 1 team-sport 1 TEAE-ocular 1 TEAE 1 TDM 1 TDe 1 TD-CT 1 TCVT 1 TCO-modified 1 Tchkonia 1 tchivileva 1 Tcherke-zian 1 Tcherkezian 1 TCFE 1 TCF7L2SNPs 1 TCF7L2rs7903146 1 TCF7L1 1 TCF7 1 TCF4-LEF1 1 TCF21 1 tCAt-2LV 1 Tc-99m 1 TBRTHP 1 TBRHE 1 tbrc 1 tBOOH-induced 1 TBK1 1 TBIs 1 TBC1D7 1 Tayber 1 Taxotere 1 taxonomic 1 taxed 1 taxation 1 Tawara 1 TAVRs 1 TAVI 1 Taverna 1 Tavassoli 1 Tavana 1 tautly 1 taurine 1 Taubman 1 Taubenheim 1 Taubenberger 1 Tatschner 1 Tatsch 1 Tatro 1 tations 1 Tate 1 tastes 1 Tassin 1 Tassell 1 tasksand 1 TaskForceon 1 tasked 1 task-dependency 1 Taskapili 1 Tashijan 1 Tashani 1 Taschner 1 Tasca 1 Tasang 1 Tartas 1 Tarsitano 1 Tarragona 1 Tarrago 1 Tarpenning 1 Taroni 1 Tarnopolsky 1 Tarnay 1 Tarnawski 1 Tarlatzis 1 Tarkowski 1 Tarkka 1 target-to-background 1 target-tissue 1 target-specific 1 targetome 1 target-lesion 1 targetingof 1 target-capture 1 targetable 1 Targacept 1 tar-elbow 1 Tarcic 1 Tarantino 1 Tarakhovsky 1 Taradach 1 Tarabikin 1 TaqMan-based 1 TaqIB 1 tapping-jumping 1 taping 1 Tapias 1 Taphoorn 1 taped 1 tape 1 tap 1 Tanzi 1 Tanzer 1 Tanuja 1 tantamount 1 Tanoshima 1 Tannock 1 Tannahill 1 Tanida 1 Tania 1 Tanguy 1 TangJ 1 Tangen 1 Tanebe 1 Tandjung 1 Tanderup 1 Tanami 1 tampering 1 Tampellini 1 Tamminga 1 Tamis-LeMonda 1 TamiRCRT 1 Tamim 1 Tamil 1 Tamez 1 TAMethodsGuideUpdated 1 Tamburino 1 Tamayo-Sarver 1 Talwalkar 1 Talos 1 talocrural 1 Tallgren 1 T-allele 1 tall 1 talked 1 tales 1 Talebi 1 Talbert 1 Tal 1 Takuma 1 Takitani 1 Takio 1 Takiguchi 1 takfir 1 Takeuchi 1 taketaka 1 taken-up 1 Takenouchi 1 taken1 1 Takemura 1 Takei 1 Takayesu 1 Takatori 1 Takata 1 Takashina 1 Takashi 1 Takanashi 1 Takamori 1 Takamizawa 1 Takajo 1 Takahiro 1 Takahara 1 tailed 1 Taiet 1 Taichman 1 Tahir 1 Taher 1 Taha 1 tagging 1 tag 1 Tafazzoli 1 Tadic 1 Tadenuma 1 Tacutuet 1 Tacutu 1 tactic 1 Taconic 1 tackling 1 tackled 1 tackle 1 tachypnea 1 tachyphylaxis 1 Tache 1 TACE 1 Taccioli 1 TACACCCAGGGCAACTCATA 1 tabulating 1 Tabtiang 1 tablet 1 TableS8 1 TableS6 1 Table9 1 Table8 1 Table6 1 Table5 1 Table4 1 Table3 1 table22 1 Table1 1 Tabima 1 tabID 1 Tabaee 1 Tabach 1 TA-alpha-melanocyte-stimulating 1 TAA 1 T6-lower 1 T5-lower 1 T5 1 T4-lower 1 T497C 1 t43 1 T4197C 1 t4 1 T3-upper 1 t351 1 T32EY014537 1 T32 1 T3-10 1 t2vref 1 T2-upper 1 T2-shine 1 T2N 1 T2-FLAIR 1 T2928 1 T291D 1 T245G 1 T24 1 T208D 1 T200G 1 t20 1 T1-weight-ed 1 T1-upper 1 T1-DCE 1 T1-and 1 t16 1 T1-10 1 t11 1 T1- 1 Szu-Tu 1 sZowfy 1 Szomolanyi-Tsuda 1 Szlag 1 Szkudelski 1 Szivak 1 Szeto 1 Szeri 1 Szendroedi 1 Szegedi 1 Szedlak 1 Szechinski 1 Szamotulska 1 Szafranek 1 Szabolcs 1 Syverson 1 Syto16bright 1 systolicblood 1 system-related 1 Systemes 1 systemdoes 1 system-based 1 systematized 1 systematic4 1 system-active 1 system3 1 sys-tem 1 Systat 1 Sysmex 1 Sysko 1 Sys 1 Syrrou 1 Syrjala 1 Syracuse 1 -synucleintoxicity 1 synucleinThe 1 synuclein-targeted 1 Synucleins 1 -synucleinproteins 1 synucleinprotein 1 -synuclein-positive 1 synucleinpathy 1 synu-cleinopathy 1 -synuclein-induced 1 synucleininclusions 1 synuclein-immunoreactive 1 -synuclein-dependent 1 synucleinaggregation 1 -synucleinaggregates 1 -synuclein- 1 synthetase 1 synthesised 1 synthesise 1 syntheses 1 synthases 1 syntax 1 synonymous 1 SYNJ1 1 syngeneic 1 synergic 1 synechia 1 Syndromic 1 syndrome-TORS 1 syndrome-associated 1 Syn-drome 1 Syndr 1 syncope 1 synchronize 1 synchronization-induced 1 synchromed-ii 1 synch-ii-final-intrathecal 1 synch 1 synaptotoxic 1 synaptosomal 1 synaptophysinin 1 synap-togenesis 1 synaptic-vesicle 1 synaptically 1 synap-tic 1 syn-apses 1 Synamps 1 Syn211 1 Syn130m 1 Syn130 1 Syn 1 symptom-targeted 1 symptomsofhearing 1 symptomsand 1 symp-toms 1 symptom-driven 1 symptom-based 1 symposiums 1 symphysis 1 sympathize 1 Symmons 1 symbolise 1 symbiosis 1 Sylvie 1 sylvian 1 Sylvain 1 Sylva 1 syllogism 1 Syllable-level 1 Syk 1 Syed 1 Syddall 1 sx 1 Sworczak 1 swollen 1 Swoboda 1 switches 1 Switchback 1 SwissProt 1 Swirski 1 Swinson 1 Swinnen 1 swings 1 Swindle 1 swimmers 1 swere 1 Swenson 1 Sweigard 1 sweeteners 1 sweeten 1 Sweet-Cordero 1 sweep 1 Swedish-American 1 Swedesboro 1 Sweden16 1 Swed 1 Sweat 1 sway 1 Swartz 1 swapping 1 swap 1 Swank 1 SWAN 1 Swamy 1 Swaminathan 1 swallowing-related 1 Swaiman 1 swabs 1 Swaboda 1 SW32 1 SW3 1 SW2d 1 SW17 1 SVZ 1 SVsta 1 Svizzera 1 Sverzellati 1 Svensson 1 Svebak 1 Svarer 1 Svantesson 1 Suzumura 1 Suzuki-Migishima 1 Suzanne 1 Suwanee 1 Suwaki 1 Suwaidi 1 Suvas 1 Sutton-Tyrrell 1 Sutter 1 Sutphin 1 sustaining 1 Sussmann 1 Sussex 1 suspensions 1 Suslow 1 susanne-morton 1 SUSANNA 1 Susana 1 Suryawanshi 1 survivals 1 Survivalof 1 Survival-Forest 1 Survey-based 1 Surratt 1 surprised 1 surplus 1 surpassing 1 surpasses 1 surmised 1 Surguladze 1 surgeryinduced 1 Surgenor 1 surfacebased 1 surface-backscattered 1 surface-and-core 1 Suresh 1 Suraokar 1 sup-sequences 1 Supreme 1 Suprathreshold 1 supra-sternal 1 supramaximally 1 supraconducting 1 suprachiasmatic 1 supra-basal 1 Supprian 1 sup-pressor 1 suppression-induced 1 supp-ression 1 sup-pressed 1 sup-ported 1 suppliers 1 supplier 1 supple-mentation 1 supple-mental 1 supplant 1 suppl1 1 supp 1 supervisor 1 SuperSignal 1 supersession 1 supersensitivity 1 superseded 1 superscript 1 super-repressor 1 superoxidase 1 SuperMix 1 super-markets 1 superluminescent 1 Superjacent 1 Superieur 1 super-haplogroup 1 superhaplogroup 1 Superfrost 1 SuperFreakonomics 1 superficially 1 super-controls 1 supercoiled 1 superb 1 sup 1 Suominenb 1 SunZP 1 Sunyer 1 Sunovion 1 Sunnyside 1 sunny 1 Sunnerhagen 1 SunLS 1 sunlight 1 SUNDROP 1 Sunding 1 Sunder 1 Sunde 1 Sundberg 1 Sundararajan 1 Sundalet 1 sums 1 Sumoy 1 SUMO-1 1 SummNatFindDetTables 1 Summerlin 1 Summerfelt 1 Summer 1 summations 1 summarytables 1 summarization 1 Sumathipala 1 Sumanovski 1 Sumani 1 Suman 1 Suls 1 sulphur 1 sull 1 sulfoxide 1 sulfates 1 Sulfatedsteroids 1 sulfasalazine 1 Sulai 1 Sukoff 1 Sukhdeo 1 Sukgi 1 suits 1 suit 1 Suissa 1 suicides 1 Sui 1 Sugino 1 suggestthat 1 suggestedby 1 sug-gested 1 Sugahara 1 Suga 1 Suffocation 1 sufficiency 1 suffice 1 sufentanil 1 Suetta 1 Suetens 1 Suetani 1 Suekarran 1 Suehiro 1 Sudo 1 Sud-Est 1 sudden-onset 1 suddenly 1 sucrose-induced 1 Suchowersky 1 Sucher 1 Sucharew 1 succumbs 1 succinimidyl 1 successfulness 1 sub-zero 1 sub-wave 1 sub-volume 1 subtyping 1 subtype-specific 1 subtotal 1 subtly 1 subtitled 1 subtitle 1 subthreshold-depression 1 sub-threshold 1 subthalamic 1 subtelomeric 1 subsume 1 sub-study 1 substrate-2 1 substituent 1 Substit 1 substasis 1 substantivally 1 substantiation 1 substantiating 1 substantiates 1 substantiate 1 sub-staging 1 sub-stage 1 subspecialists 1 subspace 1 subsignatures 1 subsidy 1 subsidized 1 subsidiary 1 subsided 1 subserves 1 sub-sequent 1 subsection 1 subsample 1 subsalicylate 1 sub-Saharan 1 subreti-nal 1 subreti- 1 sub-population 1 sub-pixel 1 Subpart 1 sub-nuclear 1 subnormal 1 subneurosensory 1 subnetwork 1 subnational 1 sub-modalities 1 submits 1 Sub-millimeter 1 submi-crogram 1 Submersion 1 subman-dibular 1 subluxation 1 subline-specific 1 SUBLIMA 1 sublicenses 1 sub-lexical 1 Subler 1 sub-layers 1 sublayers 1 sublaminae 1 subjectswith 1 subjects32 1 subjectiveprocess 1 subject-by-stimulus-condition 1 subjacent 1 Subirana 1 subhuman 1 sub-grouping 1 subgroup-dependent 1 subgraphs 1 subgraph 1 subglottic 1 sub-genual 1 subfields 1 subfertile 1 sub-family 1 sub-endothelial 1 Subendothelial 1 subduing 1 subdivision 1 subdividing 1 subdistribution 1 subdissociative 1 subcorticalnuclei 1 subcortical-cortical 1 subcorneal 1 subconscious 1 Subconjunctival 1 subcompetencies 1 Subcloning 1 subclones 1 subcloned 1 sub-clinical 1 subclassify 1 subclassifiers 1 sub-classes 1 subclass 1 subcertification 1 sub-cellular 1 subcategory 1 subcallosal 1 subbins 1 Subbiah 1 Sub-anesthetic 1 SU11248 1 styloid 1 stylized 1 Stylianos 1 STXBP1 1 Stutzig 1 stutterQUESTIONS1 1 stutteris 1 stutteringand 1 stutterered 1 Stuss 1 Stupack 1 Stundner 1 Stumpp 1 Stummer 1 Stum 1 Studzinski 1 studyof 1 StudyGroup 1 study5 1 study38 1 study20 1 study19 1 study13 1 study11 1 Studley 1 studiesof 1 studies-obsgyn 1 studies4 1 studies30 1 Studi 1 Studdert 1 stud- 1 Stuchi 1 Stubbing 1 Stu 1 sttest 1 ST-segment 1 Struys 1 Strutzer 1 Struhl 1 struggling 1 structure-selective 1 Structure-function-rescue 1 Structure-activity 1 struc-ture 1 structurally 1 Stroupe 1 Stroup 1 Stroppolo 1 Stroobants 1 stromelysins 1 Stromberg 1 stromaldin 1 stromal-derived 1 stroke-worksheets 1 stroke46 1 stroke1 1 Strohmeyer 1 Stroh 1 Stroemer 1 Stritesky 1 striped 1 striosome 1 strikes 1 stride 1 strictures 1 stricture 1 stricter 1 Strickland 1 striatumof 1 striate 1 striatal-projecting 1 stretch-type 1 stretch-shortening 1 stretch-sensitive 1 stress-stimulated 1 stress-sensitive 1 stress-rest 1 stress-resis-tance 1 stressortostates 1 stressor-and 1 stresso 1 stress-associated 1 stress38 1 streptozotocin-treated 1 streptomycin 1 streptococci 1 streptavidin-sepharose 1 Streptavidin-R-Phycoerythrin 1 streptavidin-based 1 streptavidin 1 Strepper 1 Strenzke 1 strength-trained 1 strength-to-weight 1 strength-endurance 1 strength37 1 Stremmel 1 Streit 1 Streiner 1 Streil-ein 1 streets 1 Streb 1 streams 1 streamlines 1 streamline 1 streak 1 Straus 1 straub 1 Strati 1 Stratford 1 strategically 1 strategica 1 Strate 1 Strasse 1 Strasbourg 1 Strasak 1 strap 1 S-transferases 1 S-transferase 1 strangulation 1 Stramer 1 Strakowski 1 strained 1 Straiko 1 straightforwardly 1 Strafrecht 1 Strach 1 strabismus 1 Straathof 1 STRA6 1 STR 1 Stowell 1 StoutNL 1 Stougaard 1 Storz 1 storyId54783324 1 Storniolo 1 storm 1 Storheim 1 Storch 1 Storandt 1 stopping 1 Stoppelkamp 1 Stoppa-Lyonnet 1 STOPPAIN 1 Stopkova 1 stop-gap 1 Stool 1 Stonerock 1 Stoner 1 Stone2 1 stomatogastic 1 stomatitis 1 stoma 1 Stolzmann 1 Stolze 1 Stolyar 1 stolen 1 stoichiometrically 1 Stohr 1 Stoessl 1 Stoep 1 Stoeckli 1 Stodtmeister 1 Stockport 1 Stockmeier 1 Stockh 1 sTNFR2 1 STM 1 Stjernholm 1 stitched 1 Stisen 1 Stirling 1 stir 1 stipulated 1 stipend 1 Stinnett 1 Stimuplex 1 stimulus-evoked 1 stimulator-guided 1 stimulant 1 stillborn 1 stillbirth 1 Stiles 1 stigmatization 1 stigmatisation 1 stig-masterol 1 Stierstorfer 1 Stiegmann 1 Stiegler 1 sticky 1 Stickland 1 Sticker 1 stick 1 Stichtenoth 1 Stichel 1 stich 1 stewardship 1 Steward 1 steve 1 Steur 1 stethoscopes 1 Stessel 1 sterol-metabolizing 1 sterol-accelerated 1 steroid-treated 1 steroid-releasing 1 steroid-related 1 steroidogenic 1 steroidal 1 Sternfeld 1 Sterne 1 sternal 1 Sterlicchio 1 sterilized 1 sterilization 1 Steriade 1 stereotypes 1 stereotactically 1 stereo-tactic 1 Stereotact 1 stereospecific 1 stereologically 1 step-wise 1 Steptoe 1 stepped-wedge 1 StepOnePlus 1 Stepnowski 1 steplengths 1 Stephenson 1 Stephanou 1 Stephanie 1 Stepanova 1 Stensrud 1 Stenseth 1 Stenroos 1 stenoses 1 Stenning 1 Stennett 1 Stengerd 1 Stengaerd 1 Stendardo 1 Stemline 1 Stemi 1 stem-cell 1 Stelzmann 1 Stelzer 1 Stekler 1 Stek 1 Steirteghem 1 Steinwachs 1 Steinmetz 1 Steinke 1 Steinhauer 1 Steinert 1 Steinbrook 1 Steigerwald 1 Steiger 1 Steglind 1 Stefurak 1 Steffen 1 Steffelbauer 1 Stefansson 1 Stefanie 1 Stefanick 1 Stefania 1 Stefani 1 Stefaan 1 steers 1 steered 1 steel-sanding 1 Steegers 1 Steeds 1 Steckler 1 Steckel 1 Stecco 1 Stebbins 1 stealthy 1 stayafter 1 Stavrides 1 STAVAS 1 Stauffer 1 Staudinger 1 Staud 1 statutes 1 statute 1 statusoforgan 1 statusdecline 1 statusand 1 sta-tus 1 StatSoft 1 Stats 1 statistics--2010 1 Sta-tistics 1 statistician 1 Statistical-Issues-in-Assessing-Hospital-Performance 1 stationed 1 stationary 1 stationarity 1 statinson 1 Statile 1 Static-Pages 1 statically 1 State-specific 1 statelines 1 stateid 1 state-based 1 STAT6 1 stasisand 1 Stasch 1 Stars 1 Staron 1 Starega-Roslan 1 Starace 1 star 1 stapled 1 Staphylococcus 1 Stanojevic 1 Stannard 1 Stanislaus 1 Stangos 1 Stangerup 1 Stanek 1 standstill 1 Standort 1 Standley 1 Standish 1 standard-stimulus 1 Standard-sound 1 standard-of-care 1 standardizable 1 standardise 1 standard-dose 1 standalone 1 Standaert 1 stamps 1 Stampfli 1 Stamford 1 Stamer 1 Stam-bolsky 1 Stamatoyannopoulos 1 Stalpers 1 stalls 1 Stalker 1 stakes 1 stake-holders 1 stakeholders 1 stakeholder 1 stair-stepping 1 staircase 1 stair 1 stainings 1 Staiger 1 Stahli 1 Stago 1 stageof 1 stageing 1 stageIIIc 1 stage-dependent 1 stage-based 1 Stafne 1 staffs 1 Stafford 1 staffed 1 Staedtisches 1 Stadtmauer 1 Stadtkrankenhaus 1 Stadt 1 Stadlan 1 stadium 1 stacked 1 Stachon 1 stably 1 Stabler 1 Stabin 1 stabilizes 1 stabilizers 1 stability-based 1 Stabilini 1 SSRI 1 sslein-Volhard 1 SSK 1 SSECRETT 1 SSBs 1 SSA790 1 Srisailapathy 1 Srikumari 1 Sridhar 1 SREBF-1 1 SRD5A2 1 SRD5A1 1 SRC-transformed 1 SRC-induced 1 SR-BII-mediated 1 SRB-II 1 SR-A 1 squirrel 1 Squibb 1 squeezing 1 squatting 1 squash 1 squamous-cell 1 squamouscell 1 Sputtek 1 Spurney 1 spuriously 1 spun 1 Spry 1 Spruijt 1 Sprooten 1 Sprivulis 1 Spritzler 1 Springer-Verlag 1 Spreux 1 Sprengelmeyer 1 spread-ability 1 spray 1 sprain 1 spotted 1 spotlight 1 spot075-services-affordability-2013 1 sports-specific 1 sports-related 1 Sportsmed 1 sport-related 1 Sportmed 1 SPORTDiscus 1 Sporis 1 SPORE 1 Spooren 1 sponsorship 1 Sponsor-investigators 1 Spong 1 spondylotic 1 Spolski 1 SPOKES 1 SpO2 1 SPM8 1 splitter 1 splitless 1 Split-gesture 1 split-course 1 splitbelt 1 splint 1 splice-site 1 splices 1 splicedvariants 1 splenium 1 splenic 1 Spizzo 1 Spitz 1 Spitali 1 spirito 1 Spirio 1 Spiridonov 1 Spires-Jones 1 Spi-ProX 1 spinous 1 Spinner 1 Spinnato 1 Spinelli 1 spinecho 1 spina 1 spill-over 1 Spillers 1 Spillare 1 spike-in 1 Spijkervet 1 Spigelman 1 Spielberger 1 Spiegel 1 spicule 1 sphygmomanometer 1 Sphs 1 sphingomyelins 1 sphingolipids 1 sphincter-preserving 1 sphere 1 Sphase 1 Speyer 1 Spettell 1 Sperry 1 sperimentazione 1 spento 1 Spender 1 Spencer-Dene 1 Spelberg 1 Spek 1 speific 1 Speer 1 speeding 1 speeded 1 speech-syllables 1 speechness 1 speech-motor 1 speech-based 1 spediatrician 1 speculations 1 speculation 1 speculating 1 spectroreflectometry 1 spectrophotometrically 1 spectrometric 1 spectrometers 1 spectrometer-based 1 Spectrom 1 spectre 1 SpectralOCT 1 Spectralis 1 spectral-density 1 Spectr 1 speckles 1 Speck 1 specimen-specific 1 specifies 1 specifictoboth 1 specificsomatic 1 species-and 1 Specically 1 Specian 1 specialty-trained 1 specialty-specific 1 specializing 1 specializes 1 speciality 1 speci 1 Speare2 1 SPD 1 SPCG-47 1 SPC 1 spawned 1 spautin 1 spatula 1 spatio-temporal 1 spatially-distributed 1 SPATA19 1 Spasovska 1 spasm 1 sparsity 1 sparsities 1 sparseness 1 Sparling 1 sparked 1 Spark 1 Spariotemporal 1 spare 1 Spanswick 1 spans 1 Spanier36 1 Spanier 1 Spanaki 1 Spalton 1 Spallone 1 SPAligation 1 Spalek 1 Spain38 1 Spahn 1 Spagrud 1 Spafford 1 spacing 1 spacer 1 Spacapan 1 SP7 1 SP-1 1 Sp1 1 Sozzani 1 soybeans 1 soybean 1 soya 1 Sowniski 1 Sowers 1 Sowell 1 Souvatzoglou 1 Southwick 1 Southport 1 Southampton 1 sourceforge 1 Sourbron 1 soundly 1 sound-feature 1 sounded 1 Soundblaster 1 Soumerai 1 Soulen 1 Sougnez 1 Soucy 1 Sottoriva 1 Sosnowska 1 Sosinsky 1 Sosabowski 1 Sosa 1 sorter 1 Sorsa 1 Sorrenti 1 Sorrell 1 SORP 1 Soroui 1 Soros 1 Sorm 1 Sorkin 1 Sorinnes 1 Soriguer 1 sores 1 Sorenson 1 sorely 1 Sorbero 1 Soraya 1 Soragni 1 Sopsin 1 Sopori 1 Sophien-und 1 sooner 1 Soonawalla 1 Sonobe 1 Sonneveld 1 Sonja 1 Sonis 1 sonication 1 Songygard 1 so-net 1 Sondel 1 Somogyi 1 Sommerfeld 1 Somfai 1 some-what 1 Somer 1 somehow 1 sombrero 1 somatotype 1 somatotroph 1 somatotopographically 1 somatotopical 1 somatostatin-based 1 somatostatin-analogue 1 somatosensation 1 Somatosens 1 somatomotor 1 SOMATOM 1 somatoform 1 somatically 1 Somasundaram 1 somas 1 Somalia 1 solves 1 Solvent 1 solve 1 Solow-Cordero 1 Solon 1 Solomons 1 Solo-mon 1 Solodiuk 1 Solnordal 1 sollievo 1 Solis 1 solid-space 1 solidify 1 solidified 1 Solida 1 solicits 1 solicitation 1 Solhkhah 1 Soleck 1 Soldani 1 Solaris 1 Solari 1 solar 1 Solanky 1 Sola 1 SokolowS 1 Soki 1 Sokal-Arnon 1 Sohrmann 1 Sohel 1 soggettivita 1 Sogaard 1 softwarea 1 software24 1 SOFTWARE0001 1 Sofroni 1 soffices 1 sofferenza 1 Sofat 1 Soest35 1 Soejima 1 SODs 1 sodiumconductances 1 sodium-calcium 1 Soderstrom 1 Soddu 1 sod-3p 1 Sockol 1 Sockalingum 1 sociological 1 Socioeconomics 1 socioeconomically 1 Sociodynamic 1 socio-demographics 1 socio-demographic 1 societalburden 1 socialphobics 1 socialization 1 Socialist 1 socialfears 1 social-evaluative 1 social-emotional 1 social-cognitive 1 social-class 1 Soares 1 SOAP 1 Soane 1 soaked 1 SOA 1 Snyderman 1 SNwhich 1 Snutch 1 snu 1 SNthe 1 SNP-dependent 1 Snouwaert 1 snoRNA 1 Snoezelen 1 Snoeck 1 SNneurogenesis 1 Snidvongs 1 SNF1 1 Snellen-refracted 1 Snell 1 Snead 1 Sndb 1 SNCA-related 1 Sncaknockout 1 Sncagene 1 Sncadeleted 1 SNCA-based 1 SNCA-associated 1 SNCA-112splicing 1 SNARE-complex 1 snap-shot 1 snap-frozen 1 snap 1 snakes 1 snake 1 Smythe 1 Smyth 1 Smucker 1 SMR 1 Smoyer 1 smoothness 1 smoothing 1 smoothed 1 smoldering 1 Smoky 1 smoking-induced 1 smoking-discordant 1 smoking-dependent 1 SMOC 1 SmithR 1 smile 1 Smilde 1 smidas 1 Smeyne 1 Smet 1 smell 1 Smejkal 1 Smeeth 1 SMD0 1 smart-tots 1 S-maps 1 small-worldness 1 Smallwood 1 small-to 1 small-mole-cule 1 Smallish 1 small-interfering 1 small-incision 1 Small-dose 1 small-caliber 1 Smad 1 smacular 1 smacks 1 SM22 1 SM2 1 Sluis 1 S-LT 1 slow-speed 1 slowly-varying 1 slow-growing 1 sloughing 1 Slotman 1 Slota 1 slopeless 1 Sloniger 1 SLOMP 1 Slominsky 1 SLO-based 1 SLL 1 slisonkova 1 slipper 1 Slim 1 Slikker 1 slid 1 slicing 1 slicer 1 SLHS 1 slept 1 Sleijfer 1 sleeve 1 Sleep-related 1 sleepier 1 sledge 1 Sledd 1 Sleath 1 SLE 1 SLC19A1 1 Slawek 1 Slavova 1 Slavin 1 Slamon 1 Slaets 1 SLAcc 1 SLAaa 1 S-L 1 Skytthe 1 Skuster 1 Skurnick 1 SKS 1 Skorpen 1 Skoll 1 Skogstrand 1 Skoczylas 1 SKN-1-only 1 SKN-1-binding 1 SKN-1b 1 SKN-1a 1 Skjaerven 1 Skj 1 skirting 1 skipping 1 skillsdeficits 1 Skillings 1 skiers 1 Skidmore 1 Skibinski 1 skews 1 sketch-plan 1 sketched 1 Skelton 1 skeletons 1 Skejoe 1 Skeel 1 SKBR3 1 skating 1 skaters 1 Skaper 1 sjweh 1 SJP 1 Sjostrom 1 sjaisson 1 sizing 1 size-weighted 1 sizemeth 1 -sized 1 sizeable 1 six-year 1 Sixty-day 1 sixgroups 1 six-colour 1 Sivitz 1 Sivits 1 Sivenius 1 sive 1 Sivarajan 1 Sivan 1 Sivagnanavel 1 Sivagnanasundaram 1 Siu 1 situin 1 Sittard 1 site-selective 1 site-directed 1 SITA 1 Sistema 1 Sist 1 Sisk 1 SIs 1 Sirvi 1 sirtuinsand 1 sirtuin-dependent 1 Sirtuin1 1 SIRT7 1 SIRT3 1 SIRT2 1 SirpalS 1 Sirota 1 Sironi 1 siR-NAs 1 siRNAs 1 Sirinyan 1 Sirabella 1 Sir 1 Siqueira 1 Sippola 1 SIPMB 1 Sipio 1 Sipila 1 Sipe 1 Sioux 1 sion 1 Sinzinger 1 sinuses 1 Sintchak 1 sinograms 1 sinoatrial 1 Sinnarajah 1 Sinn 1 Sinks 1 sinking 1 Sinigaglia 1 Sini 1 singlicate 1 Single-vs 1 singletom 1 singlet 1 single-syringe 1 Single-synapse 1 single-subject 1 single-spot 1 single-site 1 singlesession 1 single-scan 1 single-phase 1 Single-pass 1 single-mother 1 single-joint 1 single-institution 1 singleembryo 1 single-domain 1 single-chamber 1 single-centre 1 single-case 1 single-blinded 1 singleblind 1 single-axon 1 single- 1 Singhal 1 singe 1 sincerely 1 -since 1 Sinatra 1 Sinaiko 1 SIN3A 1 Simsek 1 Simplifying 1 simplification 1 simpli 1 Simonson 1 Simonsick 1 Simons 1 Simon-Assmann 1 Simms 1 Simkin 1 Similowski 1 simiar 1 simian 1 Simhan 1 Simel 1 Simcox 1 Simari 1 Simard-Emond 1 Simard 1 Siman 1 Sima 1 Silvola 1 Silvestri 1 Silvennoinen 1 silos 1 Sills 1 Silliman 1 Siliciano 1 Silginer 1 silence 1 sildenafilis 1 Silbersweig 1 Silagy 1 Sijbers 1 Sihvola 1 sigtermans 1 sign-outs 1 Signoroni 1 signifiwas 1 signif-icant 1 signifiantly 1 signifficant 1 signiffcantly 1 signifcantly 1 signifcant 1 signficant 1 signed-ranks 1 signedrank 1 signaturedb 1 signalling2 1 signaling-dependent 1 Signal-dependent 1 SigmaStat 1 sight-threatening 1 sight-impaired 1 sight 1 SigDB 1 Sigal 1 SiFuentes 1 Siflinger-Birnboim 1 Siewers 1 Sieving 1 Sietsema 1 Siesky 1 Siemann 1 Sieh 1 Siegle 1 Sieg-fried 1 Siegfried 1 Siegelaub 1 SIEDHOFF 1 Siebert 1 Sieberer 1 Siebenmann 1 sidewalks 1 sidewalk 1 Siderowf 1 sideroblastic 1 Sidergren 1 side-chain 1 Sicree 1 sickness-like 1 sickest 1 Sicker 1 Siciliancentenarians 1 Sica 1 sibling 1 Sibley 1 Sibbald 1 SIB 1 SIAM 1 Siafarikas 1 shyness 1 shXBP1-treated 1 shXBP1 1 shuttling 1 shuttle-mode 1 Shure 1 Shupert 1 shunts 1 Shults 1 Shuler 1 Shukla 1 Shubayev 1 Shuang 1 SH-SY5Y 1 SHRs 1 Shrout 1 shRNA-resistant 1 shRNA- 1 shrinking 1 Shridharani 1 Shrestha 1 Shresta 1 Shrader 1 shownin 1 shownby 1 shown7 1 shout 1 shousing 1 shouldn 1 shoulders 1 shoulder-elbow 1 shouldbe 1 shoul 1 Shoucri 1 Shotwell 1 Shoturma 1 Shotgun 1 Shotaro 1 short-stay 1 short-standing 1 short-ranged 1 short-prognosis 1 shortness 1 short-latency 1 short-hairpin 1 short-falls 1 shorter-lived 1 shorter-acting 1 shortens 1 Shortell 1 shortcuts 1 shortcut 1 Shortcommunication 1 short-comings 1 shortcoming 1 shortbevel 1 short-axis 1 short-ages 1 shortages 1 shop 1 Sholomskas 1 Shojania 1 Shogoin 1 Shoemaker 1 Shoeb 1 Shneker 1 Shmerling 1 Shlipak 1 Shizuoka 1 Shiyanova 1 Shiwach 1 Shiroma 1 Shirokanedai 1 Shirley 1 Shirihai 1 shIRE1-treated 1 Shire 1 Shirato 1 Shirasawa 1 Shirakura 1 Shiraki 1 Shiraishi 1 Shipping 1 Shipman 1 Shiozawa 1 Shin-sky 1 Shinozuka 1 Shinohara 1 Shinkeigaku 1 Shinkawa 1 shingles 1 Shingara 1 shine-through 1 Shinawi 1 Shinagawa 1 Shimony 1 Shimell 1 Shimazu 1 Shimanovich 1 Shils 1 Shiloh-Malawsky 1 Shilkrut 1 Shila 1 Shikama 1 Shiiba 1 Shih-Chiao 1 Shigeta 1 Shigenobu 1 Shigemoto 1 Shigeki 1 shift-change 1 Shiffman 1 Shiff 1 Shiels 1 Shiell 1 shielded 1 Shiekhattar 1 Shibayagi 1 Shibaike 1 Shetzer 1 Shestakova 1 Shepardson 1 Shepard 1 Shenoy 1 Shenefelt 1 shelved 1 Shelly 1 Shellhaas 1 Sheldrick 1 Shekelle 1 Shehata 1 She-hadeh 1 Sheffield-Moore 1 -sheet 1 Sheerin 1 Sheen 1 Sheedy 1 sheds 1 Shechtman 1 Sheard 1 Shaykh 1 Shawnee 1 Shawa 1 Shavers 1 Shaver 1 Shats 1 Sharrock 1 Sharrett 1 sharper 1 Sharp1 1 Sharon 1 Sharma2 1 Sharif 1 Sharda 1 Sharawyet 1 Sharawy 1 Shara 1 Shapiro-Wilk-test 1 Shapiro-Wilk 1 Shapiro-Feinberg 1 shaped-based 1 Shany 1 Shanmugam 1 Shanken 1 Shank 1 Shander 1 Shanahan 1 Shanafelt 1 Shamsa 1 shame 1 Shamburek 1 sham-and 1 shallower 1 Shakib 1 shaken 1 Shake-it-up 1 Shairer 1 ShaikhS 1 Shaikh 1 Shahryari 1 Shahinian41 1 Shahinian 1 shaft 1 Shaffner 1 Shadrina 1 Shadrick 1 shaded 1 sgs 1 SGR23 1 Sgouros 1 Sgobio 1 SGD 1 sGC 1 Sgaragli 1 SGAI 1 Sgado 1 sfvrsn 1 SFOP 1 SFAR 1 SF-12 1 sexually 1 Sex-and 1 sex- 1 Sewry 1 Seward 1 Sew 1 Sevik 1 severonance 1 severities 1 severeneuronal 1 Seventy-two 1 Seventy-seven 1 Seventy-one 1 Seventy-nine 1 Seventyfive 1 seventh-and 1 Seven-micrometer-thick 1 seven-helix 1 seven-fold 1 Sevak1 1 setups 1 setter 1 Seto 1 Setnik 1 Sethuraman 1 Sethi 1 Seth 1 set32 1 Sesto 1 S-es-timator 1 S-esti 1 sessment 1 Sesaki 1 servoir 1 servocontrolled 1 Servio 1 Servicezrs 1 Serviceof 1 server 1 serum-blocking 1 Sersen 1 Serrien 1 Serrat 1 Serrana 1 serotype 1 serotonin2A 1 Serotonin-1A 1 Serotec 1 seropositive 1 serologically 1 sernyl 1 Sernaet 1 SER-like 1 seriousness 1 serine-threonine 1 serine-615 1 seriesof 1 serial-section 1 serially-collected 1 Sergios 1 SERGIO 1 Sergei 1 serendipity 1 Seregni 1 SERCA2a 1 Serbest 1 Ser473 1 Ser447Ter 1 sequestering 1 sequesteredencephalocele 1 sequestered 1 Sequert 1 sequencer 1 Sepu-kar 1 September7 1 Sephardic 1 Sep- 1 Seow 1 Seol 1 Seock-Ah 1 Seoane-Blanco 1 Senyei 1 sentiment 1 sentient 1 Senthil 1 sented 1 sensus 1 sensoreffector 1 sensitizes 1 sensitized 1 sensitize 1 sensitivity-dependent 1 sensitively 1 sensitised 1 sensitisation 1 sensingsignaling 1 Sensinger 1 sensible 1 SenieRT 1 Sen-ichi 1 Senices 1 Seng-Yue 1 Sengodan 1 Senger 1 Senese 1 senescencent 1 senes-cence 1 Senes 1 SENECA 1 sends 1 sending 1 Senderek 1 send 1 Sen 1 SEMs 1 Semple 1 Semont 1 semi-solid 1 semirecumbent 1 semi-professional 1 seminars 1 semiautonomous 1 semi 1 Semenza 1 Semedo 1 semaphorin 1 Selzer 1 Selye 1 selves 1 Selvaraj 1 Selvaggi 1 Seltzer 1 Selter 1 Seltenhammer 1 Selman 1 Sellke 1 Selley 1 Sellergren 1 Seller 1 Selleck 1 sell 1 Selina 1 Selimyan 1 Seliger 1 Selig 1 selfsuggested 1 self-sufficiency 1 self-shielding 1 self-selection 1 self-restricted 1 self-resolving 1 self-renewal 1 self-regulation 1 self-registration 1 self-referential 1 self-recognition 1 self-protective 1 self-propagating 1 Self-poisoning 1 self-perceptions 1 self-perception 1 Self-pacing 1 self-pace 1 self-movements 1 self-management 1 self-maintenance 1 self-maintaining 1 self-linking 1 self-limiting 1 self-image 1 self-focus 1 self-expanding 1 self-expandable 1 Selfe 1 self-digestion 1 self-determination 1 self-corrects 1 self-concept 1 self-chosen 1 self-associations 1 self-assessments 1 Self-assessed 1 self-assess 1 self-assembling 1 Self-antigen 1 self-aggregation 1 self-agency 1 self-administration 1 self-administered 1 Selesnick 1 Selenite 1 selects 1 selectiveness 1 selections 1 seldomly 1 Sela 1 sel 1 Sekulic 1 Seino 1 Seim 1 Seikaly 1 Seifert 1 Seidler 1 Seidenwurm 1 Seidenspinner 1 Seiden 1 Seidell 1 Seidel 1 Seibyl 1 Seguridad 1 segregating 1 segregates 1 segmentations 1 segmentation- 1 Segev 1 Segerba 1 Seger 1 Segalen 1 seeywhere 1 seeTable 1 SEER 1 seenwith 1 seeming 1 Seelig 1 Seelen 1 seeks 1 seeker 1 seeding 1 Seeck 1 Seeburg 1 Sedlmair 1 sedimented 1 Sedghizadeh 1 Sedensky 1 sedations 1 securely 1 secured 1 Sects 1 sectionally 1 secre-tory 1 secretionand 1 -secreting 1 Secretary 1 Secretariaat 1 secret 1 second-year 1 second-trimester 1 SecondSight 1 second-round 1 second-place 1 Secondo 1 second-in-class 1 secondhand 1 second-degree 1 second-bolus 1 secondaries 1 sec-ond 1 Secnik 1 Secher 1 Sebestra 1 Sebastien 1 Sebastian 1 seattlechildrens 1 seat 1 seasons 1 seasoned 1 Searles 1 searing 1 searchtext 1 Sean 1 Seals 1 seagents 1 Seabrook 1 SE58AF 1 SE5 1 SE1 1 SDS-containing 1 SDP 1 SDH 1 SDF1-dependent 1 sdeeks 1 SDDs 1 SDCS 1 SDC1 1 Sczepan 1 Scylla 1 scurrently 1 Scurr 1 sculptures 1 Scuffham 1 scuba 1 scrutinizes 1 scrutinise 1 scrotal 1 Scrocchi 1 scripts 1 script 1 Scripps 1 scribd 1 screw-cap 1 Scremin 1 Screen-PFT 1 screener 1 screen-detected 1 screams 1 screaming 1 scratching 1 Scrapie 1 scraped 1 scrambled-oligonucleotides 1 scrambled-AMO-treated 1 scram-bled-AMO 1 Scramble-AMO 1 scouts 1 Scoumanne 1 Scottsdale 1 scotopicemesopic 1 scotoma 1 Scotcher 1 Scorziello 1 Scorrano 1 scoredeach 1 Score27 1 SCORE22 1 score21 1 Score2 1 scoping 1 sconsideration 1 Scone 1 SCN-DFO 1 SCNA 1 SCN8A 1 SCN2A3 1 SCN1A 1 sclerosis-like 1 scleros-ing 1 Sclerosing 1 Sciurba 1 scissors 1 Scinopsis 1 Scienze 1 Scientifico 1 Scientifica 1 SciELO 1 SCID-1 1 SCID 1 SciBX 1 sciatica 1 sciam 1 Schwind 1 Schwiers 1 Schweser 1 Schwender 1 schweinhardt 1 Schwarzkopf 1 Schwartzberg 1 Schwann 1 Schvartzman 1 Schuutze 1 Schuurhuis 1 Schuur 1 Schutze 1 Schutter 1 Schurman 1 schung 1 Schumann 1 Schumacher 1 Schulz-Schaeffer 1 Schulzer 1 Schulze-Koops 1 Schultze 1 Schulthess 1 Schultheis 1 Schuler 1 Schulenberg 1 Schule 1 Schuhmacher 1 Schuff-Werner 1 SchuckT 1 Schucht 1 Schuchat 1 Schubiger 1 Schubert 1 Schrump 1 Schruder 1 Schrott-Fischer 1 Schroth 1 Schroff 1 Schroers 1 Schrock 1 Schriger 1 Schrger 1 Schreiter-Gasser 1 Schreier 1 Schreckenberg 1 Schramm 1 Schraml 1 Schrading 1 Schornagel 1 Schor 1 Schoolwerth 1 schoolgirls 1 Schoofs 1 Schoning 1 Schonig 1 Scholz 1 Scholer 1 ScholarsProgram 1 scholarships 1 Schol 1 Schofield1 1 Schofer 1 Schoepfer 1 Schoepf 1 Schoeny 1 Schoenwald 1 Schoenleber 1 Schoenheimer 1 Schoenes 1 Schoenen 1 Schoell 1 Schoeftnerand 1 Schoeftner 1 Schock 1 Schnyder 1 Schnur 1 Schnizler 1 Schnizlein-Bick 1 Schnitzlein 1 Schnieder 1 Schnider 1 Schneieret 1 Schnapauff 1 Schnaider 1 Schmutzler 1 Schmutz 1 SchmitzKH 1 Schmitz-H 1 Schmitz- 1 Schmithorst 1 Schmidt-Kittler 1 Schmid-Ott 1 Schmidbauer 1 Schmelzer 1 Schmeidler 1 Schmechel 1 Schmajuk 1 Schmainda 1 Schluter 1 Schlumpf 1 Schluger 1 Schlaudraff 1 Schlack 1 Schjerling 1 schizo-phrenomimetic 1 Schizophrenie 1 schizophrenia-like 1 Schistad 1 Schirmacher 1 Schippers 1 Schipper 1 Schinzel 1 Schinke 1 Schindzielorz 1 Schimmer 1 Schimmel 1 Schiltenwolf 1 Schillings 1 Schiller-Universitat 1 Schilder 1 Schijtz 1 Schieve 1 Schier1 1 schier 1 Schiepers 1 Schiappacassi 1 Schey 1 Scheumburg 1 schett 1 Scherzinger 1 Scherr 1 Schermer 1 Scheppach 1 Schep-er-Hughues 1 Schenkman 1 Schenke 1 Schendzielorz 1 schematics 1 Schellings 1 Scheller 1 Schell 1 Scheler 1 Schein 1 Scheijen 1 Scheffner 1 Scheffer 1 Scheffel 1 Scheele 1 scheduling 1 schedule-dependency 1 Schauwecker 1 Schaumburg 1 Schaudinn 1 Schatteman 1 Schats 1 Schart 1 Scharff 1 Scharf 1 Scharcanski 1 Schantz 1 Schandler 1 Schanda 1 SchalkwijkCG 1 Schalinske 1 Schakal 1 Schaijk 1 Schaick 1 Schafleitner 1 Schaffer 1 Schady 1 Schadendorf 1 Schachtzabel 1 Schacht 1 Schachat 1 Schaar 1 Schaal 1 Schaaf 1 Sch9in 1 SCH529074 1 SCH29074 1 scFv 1 Scearce 1 SCD-1 1 Scd1 1 SCCM 1 scavengers 1 scavenger-assisted 1 scav-enger 1 Scatena 1 Scassellati-Sforzolini 1 scars 1 Scarpazza 1 Scarpace 1 Scarmeas 1 Scarborough 1 scapula 1 scanning-based 1 scan-negative 1 Scanlan 1 ScanBrit 1 scalp-recorded 1 scalplocations 1 Scale-Revised 1 Scalera 1 Scalea 1 Scalar 1 scahqgive 1 Scaglione 1 scaffolds 1 scaffold 1 sc-40 1 sc-371G 1 sc-371 1 sc-1643 1 SBFSEM 1 SB-4640 1 SB10001424127887324478304578173342657044604 1 Sazawal 1 Sayre 1 Sayana 1 Sayan 1 Saxer 1 saxena 1 Sawaki 1 Sawabe 1 Sawa 1 Savonenko 1 Savoldelli 1 Savi-nova 1 Saville 1 Savenka 1 Savedra 1 Savard 1 Savageau 1 sautophagic 1 Saulino 1 Saul 1 Sauerland 1 Saueressig 1 Saucier 1 Saucedo-Cardenas 1 Saubert 1 Sau 1 saturation-recovery 1 Satterlee 1 Sattar 1 satisfactorily 1 satiety 1 Sathyan 1 Satar 1 Sasso 1 Sasongko 1 Saslow 1 Saskatchewan 1 sasis001 1 Sasazuki 1 SAS-5100 1 Sarzi-Puttini 1 Sarveswaran 1 Sartorelli 1 Sartore 1 sarton 1 Sarret 1 Sarras 1 Sarnaik 1 Sarna 1 Saris 1 Sargeant 1 Sareen 1 sarcovesicles 1 sarcomatoid 1 sarcolemmal 1 sarcoendoplasmic 1 Saraceno 1 Sapru 1 Saponara 1 SAPIEN 1 Saouli 1 Sao 1 Sanwa 1 Santos-Reboucas 1 Santorelli 1 Santini 1 Santinami 1 Santiago-MuP 1 Santiago 1 Santes 1 Santana 1 Santacroce 1 Sansores 1 Sansing 1 Sansbury 1 Sanofi-Aventis 1 Sanofi 1 Sankala 1 sanitary 1 Sanitarias 1 Sanitaria-Instituto 1 Sanita 1 sangue 1 Sanghvi 1 Sangdevini 1 Sang 1 SanFranciscoand 1 SanFrancisco 1 Sane 1 sandwich 1 Sandro 1 Sandri 1 Sandoval-Restrepo 1 Sandmueller 1 Sandmann-Keil 1 Sandler 1 Sandimmune 1 Sandilands 1 Sandiego1 1 Sandiego 1 Sandhu 1 Sanderson 1 Sander 1 Sandeman 1 Sandeep 1 Sandebring 1 Sande 1 Sandaltzopoulos 1 Sanda 1 Sancho 1 Sanchis 1 Sanchez-Sinencio 1 Sanchez-Ramos 1 Sanchez-Padilla 1 Sanacora 1 Sana 1 Samus 1 Samukawa 1 Samuel 1 Samsa 1 samplest-tests 1 samplesizes 1 sampler 1 sample-by-sample 1 Samowitz 1 Samnegard 1 Sammour 1 Sammet 1 Sammel 1 Samjoo 1 Samiric 1 sameretinal 1 Samer 1 same-ethnicity 1 Samarina 1 Sama-ranch 1 Samaranch 1 SamantaK 1 Samady 1 Salzwedel 1 Salvo 1 Salvesen 1 Salvajoli 1 Salvadore 1 Salute- 1 Salunga 1 Salucci 1 salted 1 Salsa 1 SAL-RNA2 1 salpingo-oophorectomy 1 salpingooophorectomy 1 salphingo-oophorectomy 1 Salpetriere 1 Salonen 1 Salomons 1 Salojin 1 Salman 1 Salm 1 Sallis 1 Salkeld 1 Salinero2 1 Salinari 1 saliency 1 Salib 1 Salgarello 1 Saleem 1 Salcedo 1 Salazar 1 Salas 1 salary 1 Salami 1 Salaffi 1 Sakurai 1 Sakura 1 Sakuma 1 Sakkeus 1 Sakanaka 1 Sajjad 1 Sajda 1 Sajan 1 Saiz-Sanchez 1 Saiz 1 Saitou 1 Saiseikai 1 Saint-Quentin 1 Saint-Louis 1 Saintigny 1 Saint-Hilaire 1 Saint-Etienne 1 Saido 1 Saidin 1 SAIC-Fred-erick 1 Saia 1 Sahbaie 1 Sahakian 1 SAH 1 Sagovsky 1 Sagiv-Bar 1 sagittally 1 Sagherian 1 sagepub 1 Sagen 1 Sagara 1 saga 1 Saffrich 1 safetyo 1 safest 1 Safar 1 saem2014amprogram 1 saem 1 Saeed 1 Sadurn 1 Sadun 1 sadness 1 Sadler 1 Sadilek 1 Sadamori 1 sacs 1 sacral 1 Sackett 1 Sacilotto 1 saccade 1 Sabharwal 1 Sabers 1 Sabel 1 Sabbioni 1 Sabbah 1 Sabater 1 Sabanayagam 1 Saban 1 Sabah 1 Saastamoinen 1 Saarow 1 Saarma 1 Saarland 1 Saarinen 1 Saarijarvi 1 Saar 1 saake 1 saagerl 1 Saade 1 Saad 1 SA50 1 SA- 1 S98-S103 1 S92 1 S8C 1 S8B 1 S8A 1 S87-S91 1 S87E 1 S87AhSNCA140 1 S-866 1 S86 1 S85 1 S80-8 1 S7D 1 S7C 1 S77-S86 1 S755 1 S70 1 S6-S14 1 S6D 1 S69 1 S67-S116 1 S67 1 S66 1 S65-S70 1 S64 1 S5K 1 S5J 1 S5H 1 S5G 1 S5F 1 S550-S566 1 S4showed 1 S4H 1 S4G 1 S41-S55 1 S41 1 S3H 1 S39 1 S387 1 S381 1 S373eS382 1 S36 1 S34-S41 1 S34 1 S334ter-4 1 S32-36A 1 S3023 1 S2H 1 S2G 1 S2F 1 S29-43 1 S28664 1 S28 1 S27 1 S24 1 S233 1 S228 1 S225-239 1 S219 1 S213-S218 1 S213-20 1 S208 1 S1H 1 S1G 1 S1Aavailable 1 S19 1 S186 1 S18 1 S171 1 S169 1 S168-71 1 S167 1 S15-S27 1 S159 1 S1470-2045 1 S142 1 S135 1 S133 1 S131 1 S129Amutant 1 S129AhSNCA140-induced 1 S129Aand 1 S129 1 S128 1 S127 1 S123 1 S121-S125 1 s11764-011-0208-4 1 s11764-011-0203-9 1 s11739-014-1118-z 1 S-1144 1 S-1127 1 S-1120 1 S112 1 s10549-012-1964-1 1 s10549-009-0550-7 1 s10549-007-9638-0 1 s10549-007-9602-z 1 s10549-004-2045-x 1 s10434-013-3380-0 1 s10434-010-1352-1 1 S104 1 S102-7 1 S100A7 1 S100 1 S10 1 S0939-4753 1 S06 1 S0531-5565 1 S0161-6420 1 S01406736 1 s00520-0137-2067-1 1 s00192-014-2369-y 1 S- 1 Rytting 1 Rytokoski 1 Rythmic 1 Ryseck 1 Rymer 1 Rygh 1 Ryegate 1 Rydmark 1 Ryden 1 Rydel 1 Ryde 1 Ryazantsev 1 Ryall 1 rxbrief 1 rx 1 RVA 1 Ruzsics 1 Ruutu 1 Ruusuvirta 1 Rutten 1 Rutt 1 Rutschmann 1 Rutherford 1 Rutgers 1 Rutenberg 1 Rustighi 1 Rustgi 1 Russon 1 Russian 1 Russek 1 Rushmer 1 Rush 1 Rusen 1 Rusconi 1 Rusckowski 1 Ruscheinsky 1 rural-based 1 Rupprecht 1 Ruppert 1 Ruopeng 1 Runx2 1 Runtz 1 run-to-run 1 runs 1 run-in 1 Rungger-Brandle 1 Runge 1 Rundo 1 Rumstadt 1 Rumsfeld 1 rumours 1 Rummelt 1 rumination 1 ruminating 1 ruminate 1 Rumbold 1 rum 1 ruling 1 Rules2013-EN 1 Rulands 1 Rukstalis 1 Ruiz-Velasco 1 Ruit 1 Ruiperez 1 Ruijter 1 Rui 1 Ruhe 1 Rugge 1 Rufat 1 Ruf 1 Rueter 1 Rudy 1 Rudner 1 rudimentary 1 Rudenski 1 Rudel 1 Ruddy 1 Rud 1 Ruckdeschel 1 rubric 1 Rubio-Agusti 1 Rubinszteinet 1 Rubinsztein 1 Ru-bin 1 Ruberg 1 Rubenovitch 1 Rubboli 1 Ruata 1 Ruangma 1 Rual 1 RTOG-ASTRO 1 RTKs 1 RTICCS 1 rtes 1 rsoy 1 RSNA 1 RSN6 1 RSN5 1 RSN4 1 RSN3 1 RSN2 1 RSN1 1 rsks-1 1 RsaI 1 rs8887 1 rs8007267 1 rs7903146-TCF7L2 1 rs7684318of 1 rs7684318 1 rs734784 1 rs7301328 1 rs72294371 1 rs6746030 1 rs6269 1 rs563649 1 rs4818 1 rs4680 1 rs4633 1 rs3783641 1 rs3764261 1 rs356165and 1 rs2943641 1 Rs2736990located 1 rs2619364and 1 rs2619363 1 rs220599 1 rs2075650 1 rs181489 1 rs1805247 1 rs1799971 1 rs12325817 1 rs10483639 1 rs1019385 1 RRESPECTIVE 1 RR025746 1 RR024139 1 RR016511 1 RR000051 1 RqE60G 1 RPTOR 1 RPSS28 1 rproject 1 RPP-1 1 RPLT-Plus 1 R-Phycoerythrin 1 RPEto 1 RPE-directed 1 RPE-derived 1 rpe65-deficient 1 RPE65 1 RPE2 1 RPE12-15 1 RPE1 1 rpart 1 Rozkalne 1 Rozenek 1 Rozen 1 Roze 1 Rozas 1 Rozalski 1 Royzen 1 Roytt 1 Royston 1 Roysam 1 RoyS 1 royalty 1 ROXTM 1 Roxburgh 1 rows 1 Rovira 1 Rovio 1 roving 1 Rovina 1 Rovere 1 Rouzioux 1 Rouziere 1 Roux-Villet 1 router 1 Roussy 1 Rousset 1 Rousseau 1 rounder 1 Roumier 1 Rouke 1 Roujeau 1 Rouhi 1 Rottiers 1 Rottal-Inn 1 rotor 1 Rotondo 1 Rothmond 1 Rothmanet 1 Rothfield 1 Rothaug 1 rotatory 1 rotary 1 Rota 1 Rot 1 Roszkowski 1 RosWJG 1 Rosvallet 1 Rosvall 1 rostrolateral 1 Rostom 1 Rostock 1 rosters 1 Rostasy 1 Rossoshek 1 Rossor 1 Rosso 1 Rossner 1 Rossin 1 Rossetti 1 Ross-Degnan 1 Rossant 1 Rossanese 1 Rosmus 1 Roskam 1 Rosin 1 Rosik 1 ros-generating 1 Rosette 1 Roses 1 Rosero 1 Roser 1 Rosenstiel 1 RosenPP 1 Rosenman 1 Rosenkrantz 1 Rosengren 1 Rosenblum 1 Rosenbek 1 Rosenbach 1 Rosemary 1 Roselli 1 Rose-John 1 Rose-Gottron 1 Roscoe 1 Rosa-Prieto 1 Rosalind 1 Rosado 1 rorgans 1 Ropele 1 ROP 1 Rooyackers 1 Roovers 1 roots 1 rooted 1 Roosmalen 1 Roos-Engstrand 1 Roop 1 Rooijet 1 Rooijen 1 Rooden 1 Roobol 1 Roo 1 Ronnestad 1 Ronner 1 Ronn 1 Ronis 1 Rondina 1 Roncarolo 1 Rommel 1 Rominger 1 Romestaing 1 Romero-Ramos 1 Romero-Ramirez 1 Romero-Gallo 1 Romeo 1 Romaya 1 Romaniuk 1 Romani 1 Romana 1 Roman 1 Romagnoli 1 Romagno 1 Romagna 1 rolling 1 rollers 1 rolled 1 roll 1 Rolf-Dieter 1 roleof 1 rolein 1 rolandic 1 Rokhlin 1 Rojo-Martinez 1 Rojo 1 Roitman 1 Roiser 1 Roikjaer 1 Roider 1 Rohlfing 1 Rohde 1 RohdahlK 1 Rohani 1 Roguin 1 Rogowski 1 Roglic 1 RogersGF 1 rogens 1 Rogalla 1 Roeske 1 Roesch 1 Roels 1 Roelofs 1 Roel 1 Roecker 1 Roebel 1 Roe 1 Rodriquez-Galindo 1 Rodriguez-Paz 1 Rodriguez-Muela 1 Rodriguez-Justo 1 Rodriguez-Galindo 1 Rodriguez-Capote 1 Rodri-guez-Barrueco 1 Rodowski 1 rod-like 1 Rodino-Janeiro 1 Rodin 1 Rodilla 1 Rodicio 1 Roder 1 Rodeo 1 rodentmodels 1 Rodenkirch 1 Roden 1 Rocky 1 Rockland 1 Rockey 1 Rochtchina 1 Rochette 1 Rochelle 1 Rochat 1 Roch 1 Rocco 1 Roby-Brami 1 robustmarkers 1 robustin 1 Robson 1 robot-virtual 1 robots 1 Robles 1 Robledo-Colonia 1 Robinson-Whelen 1 Robida-Stubbs 1 Robertsson 1 Robertsb 1 Robert-Moreno 1 Robergs 1 Roberge 1 Robbie 1 Robards 1 Roback 1 ROB 1 Roato 1 roads 1 RO1NS077851 1 rner 1 RNases 1 RNAseOUT 1 RNAse-free 1 RNAi-treated 1 RNAi-induced 1 RNAi-defective-1 1 RNAhaboring 1 RNAcommunication 1 RNA-binding 1 RNA-based 1 RNAbased 1 RNA17 1 RN6G 1 RMS 1 RMM 1 RM-De 1 RMD 1 rmatory 1 RLb00 1 RKW 1 RKO 1 rklund 1 rkbey 1 Rizzuto 1 Rizzu 1 Rizzatti 1 Rizou 1 Rizki 1 Rizk 1 Rix 1 Rivlin 1 Rivka 1 Rivituso 1 Rivista 1 Rivilla 1 Rivierenland 1 Rivierduinen 1 river7774 1 rival 1 Rius 1 rituximab-related 1 rituals 1 ritual 1 Rittgen 1 Ritter 1 Ritgen 1 Rita 1 Ristic 1 Risperidone-induced 1 risksetROC 1 risk-related 1 risk-motor-stall 1 risk-lymphoedema 1 riskfor 1 risk-benefitratios 1 rish 1 risen 1 Risch 1 Risberg 1 ripple 1 Rippert 1 Ripamonti 1 Rios 1 rinsing 1 Rinsho 1 Rini 1 Ringvej 1 ringing 1 rinen 1 Rinaldo 1 Rimm 1 Rimbert 1 rilevanza 1 Rijssen 1 Rijkers 1 Rihal 1 Rigshospitalet 1 Rigot 1 rigorously 1 rigor 1 Rigl 1 rigidus 1 right-skewed 1 right-most 1 right-angle 1 Riggenbach 1 Riff 1 rife 1 Riera 1 Riemersma 1 Riemenschneider 1 Riekkinen 1 Riek 1 Rieger 1 Riefe 1 Rief 1 Riedel6 1 Ridings 1 ridge 1 Ridet 1 Ricordi 1 Rickman 1 Ricklis 1 Rickert 1 Rickard 1 Richters 1 richness 1 Richfieldet 1 Richfield 1 Riches 1 richer 1 Rich-Club 1 RichardsonS 1 Ricciardi 1 Ricci 1 Ricca 1 Ricard-Blum 1 Rican 1 Rica 1 ribosome 1 ribosomal 1 riboside 1 ribose 1 ribonucleoprotein 1 ribonuclease 1 ribo 1 Ribeiro-Dasilva 1 ribbon-free 1 Ribatti 1 Riad 1 ria 1 Rhythmology 1 rhythmic 1 Rhun 1 Rhona 1 Rhoades 1 Rhinologic 1 Rhiner 1 rheology 1 rhenium-cyclized 1 rhenium-complexed 1 Rheinbay 1 Rheaume 1 rhabdomyosarcoma 1 rhabdo-myolysis 1 rhabdomy-olysis 1 RGD-mimetic 1 RGD-conjugated 1 RGB 1 RFVT2 1 RFP2-mediated 1 RFeieT 1 RFC9 1 Rezvani 1 Reznick 1 Reznich 1 Rezak 1 Rezaei-Ghaleh 1 rez 1 Reynoso 1 Reyners 1 Reynaud 1 reykjavik 1 Reyes-Gibby 1 Reyesa 1 Rey 1 rewrote 1 re-writing 1 rewiring 1 Rewers 1 reward-related 1 revophth 1 revolve 1 revolutionising 1 revoked 1 revival 1 re-visualized 1 Re-visiting 1 revisitedepiecing 1 Revision32 1 -Revised 1 reviews18 1 reviewof 1 reviewa 1 review7 1 Revicki 1 Revets2 1 Revets 1 Reves 1 reverted 1 reversibly 1 reverse-worded 1 reverse-transcribed 1 reverse-phase 1 reverberates 1 Revenson 1 revelation 1 revealsthat 1 revealsa 1 revascularisation 1 Revalving 1 revaluated 1 Reuter 1 Rettig 1 Retrovirology 1 retroviral 1 retrotransposons 1 retrospect 1 RETROscript 1 retropubic 1 retroperitoneal 1 retro-mode 1 retrogradely 1 retrobulbar 1 retrieving 1 retrieve 1 retrespectively 1 re-traverse 1 RETRA-induced 1 retrain 1 retraction 1 retracted 1 Reto 1 retinopathy-related 1 Retinol 1 retinoid-binding 1 retinitispigmentosa 1 retinaldisorders 1 retinal-blood 1 retinaechoroid 1 reticulum-mitochondrial 1 reticulum-glycogenolytic 1 reticulum-bound 1 reticulum-associated 1 reticulocytes 1 reticulate 1 -reticular 1 Rethorst 1 rethinking 1 rethink 1 retesting 1 re-tested 1 retching 1 retards 1 retardation20 1 retaining 1 retail 1 resuspension 1 resurgences 1 resurface 1 resumption 1 Resultsof 1 Results-Medicare 1 resultsevenindfferent 1 restrictive 1 restrictionwhich 1 restriction-like 1 restric-tion 1 restricting 1 -restricted 1 restreported 1 restrainer 1 restrained 1 Restor 1 Reston 1 Restle 1 restitution 1 Rest-interval 1 restarting 1 Ress 1 Resqueti 1 responsibilityfor 1 responsein 1 responseelement 1 responds 1 respondent 1 respirometry 1 respiro-metric 1 respiratory-protective 1 respiratory-chain-deficient 1 respiratorychain-deficient 1 resource-intensive 1 resource-constrained 1 resorting 1 resort 1 resolves 1 resolubilised 1 resliced 1 resists 1 resistence 1 resisted 1 resid-ual 1 resides 1 residency-trained 1 resided 1 resID 1 Resham 1 resfective 1 reservoirs 1 reservoir-modifying 1 resequencing 1 resensitize 1 resensitization 1 resen 1 resembled 1 re-section 1 resectability 1 resect 1 ResearchWare 1 research-only 1 Researchin 1 research-funding 1 researche 1 ResClin 1 rescinded 1 reschedule 1 rescent 1 re-reviews 1 re-referenced 1 rereferenced 1 rereconstructed 1 re-ran 1 requisite 1 Requena 1 Requejo 1 Requardt 1 reputation 1 reptiles 1 re-programming 1 reproduc-tivehealth 1 reproduces 1 reprised 1 repressors 1 repression-activation 1 repressing 1 represents1 1 rep-resented 1 Representativeness 1 representa 1 repositionable 1 reposition 1 reports21 1 reporters 1 reporter-reference 1 repopulation 1 repopulating 1 replications 1 replicating 1 repletes 1 replenishment 1 replenished 1 replacements 1 repetitivete 1 repercussions 1 re-peats 1 repeated-effort 1 repeatbiopsies 1 repeal 1 repairs 1 repairing 1 repaired 1 Rep1and 1 reoxygenation-induced 1 reorganize 1 Reorganizational 1 re-operative 1 re-opens 1 Renzo 1 Rentz 1 Renstrom 1 Rensselaer 1 Rennick 1 Renner 1 renin 1 renewed 1 renewal 1 renew 1 render 1 Renaux-Petel 1 Remy 1 Remus 1 remuneration 1 REMS 1 Rempf 1 Remortel 1 Remondelli 1 remodeling18 1 remodeler 1 remnant 1 Remmen 1 remix 1 remits 1 reminding 1 reminders 1 reminder 1 remind 1 remifentanil 1 Remeseiro 1 Remes 1 remembering 1 remedy 1 remedies 1 Remediable 1 REMDD 1 Rembrandt 1 Rembert 1 remarriage 1 remark 1 remapping 1 remapped 1 Remaley 1 remainsvirtually 1 remains20 1 relocated 1 relocate 1 reloaded 1 relive 1 Relig 1 Relieving-Pain-in-America-A-Blueprint-for-Transforming-Prevention-Care-Education-Research 1 reliever 1 reliability34 1 relevantto 1 relents 1 relearning 1 relearn 1 relays 1 relaynucleus 1 relay 1 relaxometry 1 relaxin 1 relaxes 1 relaxation-related 1 relaxa-tion 1 relax 1 relationneed 1 relation- 1 relatioinship 1 related-urls 1 relatedphenotypes 1 related1 1 re-lapsed 1 rejections 1 Reitsamer 1 Reiter 1 Reitb 1 Reist 1 Reiss-Zimmermann 1 Reisner 1 reirradiation 1 reintubation 1 reintroduction 1 reinterpret 1 Reintegration 1 reinstituted 1 Reinkensmeyer 1 re-injury 1 reinjury 1 Re-injuries 1 Reinholz 1 Reingold 1 reinforcing 1 reinforcers 1 Reinert 1 Reiner1 1 Reiner 1 Reine 1 re-induction 1 re-induced 1 Reinblatt 1 reimbursements 1 reimburse 1 Reimann 1 Reiman 1 reimaging 1 Reijntjes 1 Reijneveld 1 Reijke 1 Reig 1 Reidel 1 Reichmann 1 Reichman 1 Reichhart 1 Reichert 1 Reichelt 1 Reichart 1 Rei 1 rehydration 1 rehydrated 1 rehospitalizations 1 Rehnberg 1 Rehman 1 Rehm 1 Rehg 1 rehearsal 1 rehabilitative 1 rehabilitation-specific 1 rehabilita-tion 1 Rehab 1 regurgitant 1 Regulus 1 regulted 1 regulatoryromoter 1 RegulatoryInformation 1 regulation-related 1 Regula-tion 1 regulatevarious 1 regulatelife 1 regularities 1 Regulacio 1 regrowthof 1 regrowth 1 regrown 1 regrouped 1 regressive 1 regressing 1 regress 1 regres 1 re-grade 1 Regnaux 1 Registryof 1 registrations 1 registratie 1 reg-ister 1 Regis 1 regions32 1 regionh 1 region-growing 1 Regine 1 Regina 1 regimenshowedsimilar 1 Regier 1 REGgamma-protea-some 1 regenotyping 1 Regenfuss 1 regenerated 1 Regen 1 Regehr 1 regardingthe 1 regardedasthe 1 Regalia 1 Regal 1 regaining 1 regained 1 refutation 1 refurbished 1 refugee 1 refuge 1 Refsnes 1 REFrye 1 refrigerated 1 refreshing 1 refreshed 1 reformulating 1 reformatting 1 reform 1 refocused 1 ref-list-1 1 reflexive 1 reflexes 1 reflectivityon 1 refills 1 Referenzzentrum 1 reference-independent 1 referenced 1 referees 1 Refereeing-Rules 1 refects 1 re-extracted 1 reexpression 1 reexpressed 1 re-exposed 1 re-examines 1 reexamined 1 Re-estimating 1 re-estimated 1 re-establishment 1 re-establishing 1 re-established 1 reestablish 1 reengineer 1 re-elaborated 1 Reece 1 redux 1 redundantly 1 redundancies 1 reductive 1 reduc-tion 1 Reducibility 1 reducedin 1 redosing 1 Redonet 1 Redondo 1 redness 1 redistributes 1 redistributed 1 redirected 1 redirect 1 red-heads 1 red-green 1 red-free 1 redesigns 1 redefining 1 redefine 1 Reddi 1 Red-conjugated 1 redbars 1 red-and-white 1 Reda 1 RECUSE 1 recurs 1 recurrently 1 recumbent 1 Recueil 1 rectifying 1 rectifies 1 rectified 1 rec-tal 1 recruits 1 Recreat 1 recourse 1 reconstructive 1 reconstituted 1 reconstitute 1 Reconsidering 1 reconsideration 1 reconfirms 1 reconfigured 1 recommendable 1 Recomm 1 recombinase-associated 1 recoil 1 Recognit 1 recognises 1 reclustering 1 reclassify 1 Reclassifications 1 reclassi 1 Recktt 1 Recklinghausen 1 recision 1 reciprocally 1 recipient-matched 1 recipe 1 Rechtsphilosophie 1 Recht 1 recheck 1 Rech 1 Recercai 1 receptor-targeting 1 receptor-specific 1 receptor-sensitive 1 receptor-regulated 1 receptormediated 1 receptorinte 1 receptor-gamma 1 receptor-binding 1 receptor-beta 1 receptor-b 1 Receptor-avid 1 receptor-associated 1 receptoragonists 1 receptor-2 1 receptor2 1 re-ceptor 1 receptor- 1 receptions 1 receiv-ing 1 receivers 1 receiver-operating-characteristics 1 receiver-operating-characteristic 1 receive-only 1 receded 1 Recasens 1 recalled 1 recalibrating 1 recalibrated 1 rebutted 1 rebuttal 1 rebuilding 1 reboxetine 1 rebounding 1 rebound 1 rebleed 1 Rebar 1 reauthorizing 1 Reassuringly 1 reasonCPX 1 reasonableness 1 Reas 1 rearranges 1 reapproximated 1 reappraisal 1 re-appears 1 reappearance 1 Reanim 1 re-analyzed 1 reanalyzed 1 Re-analysis 1 realm 1 realizes 1 realizations 1 realizable 1 realities 1 realised 1 realisations 1 realisation 1 realignment 1 realigned 1 real- 1 reafirmed 1 reaffirms 1 Read-through 1 reads 1 read-out 1 reading-impaired 1 reader-training 1 readaptation 1 Reactor 1 reactivities 1 reactivates 1 reactivated 1 reactants 1 reachable 1 reach50 1 reabsorption 1 reabsorbed 1 re- 1 RDH5 1 rdh 1 rderungsgesellschaft 1 rderung 1 RDE-1 1 RD12 1 RD06 1 R-D 1 RCT24 1 RCS 1 rcophth 1 RCM 1 R-class 1 RCL-2 1 rCBVwe 1 rCB-VCER 1 rCBF 1 RCB 1 RC2 1 R-BII 1 rber 1 RBC-associated 1 RbAp48 1 Razzaq 1 Rayborn 1 Raya 1 Rawstron 1 Rawal 1 Ravona-Springer 1 Ravindranath 1 Ravina 1 Ravelli 1 Ravasi 1 Ravaldi 1 Rautakorpi 1 Raut 1 Rauh 1 Raue 1 Raubenheimer 1 Raub 1 Rattus 1 ratTH 1 Ratnam 1 Ratnaike 1 ratlentiviral-based 1 Ratkovits 1 rationalized 1 ration 1 Ratinov 1 ratification 1 Rathnayake 1 ratevariability 1 rates12 1 rat-derived 1 Rat-cliffe 1 Ratcliffe 1 ras-transformed 1 Rastogi 1 Rastinejad 1 RASTARGET 1 RASS 1 Raspaud 1 Rasooly 1 RAS-mediated 1 Raslawski 1 Raskin 1 Rasi-Hakala 1 Rashiq 1 Rashad 1 Rascol 1 Rasch 1 rarest 1 rarer 1 RAR 1 Raquel 1 rapport 1 Rappoli 1 RAPPER 1 Raposeiras-Roubin 1 Rapoport 1 rapm 1 rapist 1 Rapid-response 1 Ranta-Knuuttila 1 Ranta 1 Ransmayr 1 Ransdell 1 RANO 1 Rannikko 1 RANKL 1 Rankin 1 Ranibizumad 1 ranibizumab-treated 1 ranibizu-mab 1 range8 1 range39 1 Ranganathan 1 Rang 1 Randy 1 randomizing 1 RandomizedRole 1 Randomise 1 randomi-sation 1 Randburg 1 Randall 1 Rancati 1 Ranasinghe 1 Ramsden 1 Ramsay 1 Rampon 1 ramping 1 Ramos-Duran 1 Ramonda 1 Ramnemark 1 Rammes 1 Ramko 1 Ramjaun 1 Ramiro 1 Ramirez-Velez 1 Ramirez-Schrempp 1 ramipril 1 r-amino 1 Ramina 1 ramifications 1 RAMI 1 Ramfrez-Venegas 1 Ramesh 1 RamdialPK 1 Ramat 1 Ramani 1 Ramanathan 1 Raman 1 Ramamurthy 1 Ramamoorthy 1 Ramamohanarao 1 Ramage 1 Ramachan-dran 1 Ramachandra 1 Ram 1 raltegravir 1 rally 1 rallies 1 RAL-guanine 1 RAL-GEFs 1 Raksakietisak 1 Rakel 1 Raju 1 Rajputet 1 Rajnish 1 Rajn 1 Rajlawat 1 Rajeev 1 raiseHDL 1 Rais 1 Rainville 1 Rainer 1 rain 1 Railo 1 rail 1 Raijmakers 1 Raija 1 RAIII 1 RAII 1 Raiguel 1 Raichle1 1 Rahmim 1 Rahman 1 Rahemtulla 1 Raha-Chowdhury 1 Raha 1 Rago 1 Raghunandan 1 Ragheb 1 Raghavendran 1 Raghavan 1 Raghavakaimal 1 Rafnsson 1 Raffeld 1 Raffard 1 Raffaele 1 Rafat7 1 Rafat 1 Rafaela 1 Rafael 1 Rafa 1 Raevuori 1 Radzicki 1 radverse 1 Radulovic 1 Radua 1 Radouco-Thomas 1 Radlingerb 1 Radlinger 1 radiotracers 1 radiotherapy-temozolomide 1 radiotherapy-related 1 Radio-therapeutic 1 radio-surgery 1 Radioreceptor 1 radiopharmaceuticalsin 1 radiopeptides 1 Radionecrosis 1 radiometals 1 radiometallation 1 radiometalated 1 radiologic-pathologic 1 Radiologica 1 radiolabels 1 radiolabelled 1 radiolabeleing 1 radiolabel 1 radioisotope 1 radio-iodine 1 radioiodine 1 radio-iodinated 1 radioiodide 1 radio-immunotherapy 1 radioimmunoconjugate 1 radioimmunoassay 1 radiohalogen 1 Radioguided 1 radiogram 1 Radiogenomic 1 Radio-frequency 1 radiodiagnostics 1 radiodiagnostic 1 radioactively 1 radii 1 Radicis 1 radically 1 radical-caused 1 radiations 1 radiation-induced 1 radiant 1 Radford 1 Rader 1 Rademacher 1 Radcliffe 1 Radboud 1 Radaelli 1 ractions 1 racks 1 Racine 1 Raccah 1 Rabins 1 Rabinovitz 1 Rabinovich 1 Raber 1 Rabena 1 rab5a-dependent 1 rAAV-based 1 Raat 1 RA329 1 Ra-224 1 R90 1 R874-883 1 R771PfsX33 1 R752 1 R75 1 R741 1 R714-R724 1 R59 1 R57 1 R5 1 R48-55 1 R480 1 R48 1 R474 1 R44HL104885 1 R42-CA85106 1 R40 1 R394-340 1 R280T 1 R273H 1 R270H 1 R264Y72 1 R249S 1 R21 1 R2012a 1 R19 1 R172H 1 R13 1 R126 1 R123 1 R1100-10 1 R1078Y87 1 R0278 1 R01NS058360 1 R01EY017607 1 R01DK085226-03 1 R0186 1 QW 1 Qvist 1 Quyyumi 1 Qureshy 1 Qureshi 1 Quraan 1 quotes 1 quotas 1 Quon 1 Quodlibet 1 Quo 1 quixotic 1 quitting 1 Quistorff 1 Quiroz 1 Quiros 1 quips-projekt 1 Quintana-Hau 1 quinnt 1 Quinn1 1 Quinlinan 1 quinine 1 Quincy 1 quickness 1 Qui 1 questionsin 1 Questionnaire-revised 1 questionnaire-based 1 questionably 1 Querol 1 quercetin 1 quenching 1 Quellec 1 Quehenberger 1 Quebeceal 1 Que 1 Quattro 1 quasi-experimental 1 quasi 1 quarter-year 1 Quarry 1 Quarles 1 Quark 1 Quaresma 1 Quarantelli 1 Quanto 1 quantization 1 quantitates 1 quantitated 1 quantisation 1 quantiles 1 quantile 1 quanti 1 Quanta3D 1 Quanta 1 Quanjer 1 Quang 1 Quan 1 qualitymeasures 1 qualityinitiativesgeninfo 1 QualityInitiatives 1 qualifying 1 qualifies 1 qualifications 1 Quagliato 1 Quaestio 1 Quad 1 QT 1 QSTs 1 qScript 1 qr 1 Q-Q 1 qntlite 1 QM 1 QiaShredder 1 Qiao 1 QH 1 QEH 1 Qatar 1 Qasem 1 qa-experimental-treatments 1 Qaddoumi 1 Q95th 1 Q65 1 Q36 1 Q3 1 Q2000 1 Q2 1 pz-99mTc 1 Pyykk 1 pyrimidines 1 pyriform 1 pyridoxamine-like 1 pyrazolyl-a-melanocyte 1 pyramidale 1 Pyorala 1 PX-171-003-A1 1 PWS 1 pWPIs1 1 PWH 1 pw10806 1 PVDF 1 pvalues 1 Puzzles 1 puz-zle 1 puzzle 1 Puvan 1 PUVA 1 putting 1 Pushing 1 Pusenjak 1 Puschmannet 1 purview 1 Purushotham 1 purulent 1 pursuits 1 pursuant 1 Pursnani 1 purposefully 1 purpose-built 1 purportedly 1 purple 1 puromycin 1 Purkinjie 1 Purkinjecells 1 purinergic 1 purging 1 Purdy 1 Purdom 1 Purdie 1 Puranik 1 Puppa 1 Pupi 1 Puolivali 1 Puntschart 1 Punitive 1 Punglia 1 puncturing 1 punctuated 1 punctata 1 Punch 1 Pulst 1 pulsations 1 pulsation 1 Pulmonol 1 pulmonale 1 Pulmon 1 Pulm 1 pulls 1 Pulliafito 1 pulley 1 Pullela 1 pulled 1 pull-down 1 Pujia 1 Pugnaghi 1 Puget 1 Pugely 1 PUFA-treated 1 Puerto 1 puerperium 1 puerperal 1 Puente 1 Puddu 1 puddings 1 puckered 1 Pucci 1 publications18 1 Publ 1 Ptx3 1 ptosis 1 PTMDPs 1 Ptito 1 PTFE 1 PTB1B 1 Ptasznik 1 Ptak 1 pT4a 1 pt1 1 Psyrogiannis 1 p-synthase 1 Psyhological 1 Psychophysiol 1 Psychophysics 1 psychopathologies 1 psychopathic 1 Psychoneuroendocrinology 1 Psychometrics 1 PsychologicalAssessment 1 Psychologica 1 Psycholinguistics 1 Psychoge-riatr 1 psychogenic 1 Psychobiology 1 psychoacoustics 1 psychic 1 Psychiatryand 1 Psy-chiatry 1 psychiatricmedications 1 Pst1 1 psoriasis-like 1 psoriasin 1 PS-OCT 1 psoas 1 Psiquiatr 1 Psiouri 1 psichiatria 1 pseudo-type 1 pseudotumors 1 pseudoprogression 1 pseudo-primary 1 pseudophakias 1 pseudophakia 1 pseudomeningoceles 1 pseudo-IVIM 1 pseudohypopyon 1 pseudogenes 1 pseudogene-encoded 1 pseudo-CT 1 pseudo-color 1 PSA-tested 1 Psaras 1 PS1 1 Przed-borski 1 Przedborski 1 Prystay 1 Pruszynski1 1 Pruszynski 1 Pruss 1 pruritus-in 1 Prunier 1 prune 1 PrP-induced 1 proximally 1 provocate 1 provisions 1 provisional 1 proviruses 1 providespecialist 1 provider-patient 1 Provenzale 1 provably 1 protrusion 1 prototypes 1 Protopopova 1 Proto-oncogene 1 protons 1 protocol-based 1 prothrombotic 1 prothrombin 1 prothoracic 1 proteostasis 1 proteosomal 1 proteinuria 1 protein-rich 1 protein-protein 1 protein-mediated 1 proteinmay 1 protein-glycogen 1 Protein-Free 1 proteinen 1 protein-deficient 1 protein-corrected 1 protein-binding 1 proteinalpha-synuclein 1 proteinaceous 1 protein-7-induced 1 protein-5 1 protein-4 1 protein-3 1 protein-10 1 pro-tein 1 protector 1 protectively 1 proteasomes 1 Proteasome-based 1 proteasome-assisted 1 pro-teasomal 1 protease-free 1 prote-ase 1 Prost-Squarcioni 1 prostitutes 1 Prosthet 1 prosthesis 1 Prosperini 1 Prosperi 1 pro-spective 1 prosodic 1 prosocially 1 ProsnitzR 1 Pros-ensa 1 prosecutors 1 prosecution 1 prosectors 1 pros 1 propulsive 1 pro-proliferative 1 proprioceptive 1 proprietary 1 propria 1 Propper 1 propped 1 proposition 1 proposing 1 proposalfor 1 proportionately 1 proportionate 1 pro-portion 1 propofolbased 1 propionate 1 propertiescause 1 propensity-score 1 propensities 1 propelled 1 propa-gates 1 propagates 1 propagate 1 pro-oxidative 1 prooxidant 1 pro-opiomelanocortin 1 proopiomelanocortin 1 pro-oncogenic 1 pronuclei 1 pronuclear 1 pronouncedacoustic 1 proneural 1 pronated 1 PROMUSE 1 PROMUS 1 promulgate 1 promotor 1 pro-motion 1 promotilities 1 pro-motes 1 promoterhad 1 PromoterChip 1 pro-mote 1 promontory 1 prometheus 1 PROMETEO 1 Promega 1 prolongs 1 prolonged-speech 1 prolongation 1 Prolla 1 prolific 1 proliferator 1 proliferationin 1 prolactin 1 Prokopakis 1 Prokocimer 1 Prokisch 1 Pro-ject 1 proinvasive 1 proinflammatorycytokines 1 proin-flammatory 1 Proietto 1 pro-have 1 Prohaska 1 ProHance 1 progression-related 1 programsthat 1 programsin 1 programsare 1 programs3 1 pro-grams 1 ProgramPages 1 Programme7grant 1 programif 1 programfor 1 program33 1 Progr 1 prognosticator 1 prog-nostic 1 progestins 1 Progestin 1 progeroid 1 Progeria 1 pro-genitors 1 progenitorcells 1 progenitorcell 1 Progenesis 1 profoundly 1 proflin 1 profits 1 Profiler 1 profilactin 1 proficient 1 profibrinolytic 1 profi 1 PROFESSIONALISM 1 Profession-al 1 ProEnergetics 1 ProductsPubs 1 product-moment 1 production-linked 1 production-led 1 production-based 1 production17-19 1 -producing 1 producers 1 prodromal 1 Prodimed 1 Prodi 1 prod 1 Procon 1 procoagulant 1 ProcNatl 1 Prochaska 1 processs 1 processingopened 1 processes15 1 process3 1 procedure-related 1 procedural-based 1 pro-caspase-3 1 Probstel 1 problemysomeone 1 problem-based 1 probiotics 1 Prober 1 probant-parents 1 pro-atherosclerotic 1 proatherosclerotic 1 pro-apoptotic 1 pro-aging 1 proageing 1 Pro789 1 PRM-SI2 1 PRMSI2 1 PRMSI0 1 PRMs 1 PRKCA 1 prize 1 privileging 1 privatized 1 pri-vateschoolreview 1 prisms 1 Prism5software 1 PRIS 1 priority-setting 1 prioritizes 1 prioritisation 1 prions 1 prion-associated 1 Prion7 1 Printz 1 print-out 1 printer 1 principal-component 1 Principalamong 1 Princeton 1 Primrose 1 primitive 1 primiparity 1 priming 1 Primignani 1 PRIMAVERA 1 Primatologie 1 primarysurgery 1 primaryradio 1 pri-mary 1 PRIMA-met 1 Primak 1 Prigione 1 Prigent-Tessier 1 Pride 1 Prida 1 Pribble 1 PRIAS 1 Prialt 1 Preziosi 1 previtelliform 1 previously25 1 prevention-based 1 pre-vention 1 pre-validate 1 prevalencetables 1 prevalenceof 1 Preuss 1 pre-UPPP 1 pre-to 1 Pre-time-trial 1 pretherapy 1 pretesting 1 pre-test 1 pretending 1 pre-targeted 1 presynapticvesicular 1 pre-synaptic 1 presumptive 1 presume 1 pre-stroke 1 pre-stimulus 1 prestimulus 1 Prestes 1 Prestel 1 Pressurized 1 pressure-lowering 1 press-release 1 Pressman 1 Presser 1 pressed 1 Presse 1 PressAnnouncements 1 pressannoun 1 President-Kennedy 1 preset 1 preserving 1 preservative-free 1 preservative 1 presentmainly 1 presenter 1 pre-sent 1 presenilin1 1 presences 1 presenceof 1 pre-select 1 prescribes 1 pre-screening 1 preschools 1 preschool-age 1 pre-RER 1 preregistration 1 prerecorded 1 pre-radiosurgery 1 pre-race 1 prepubertal 1 preps 1 preprocedure 1 preprocedural 1 prepregnancy 1 prepped 1 preponderance 1 preplasmablast 1 pre-plasma 1 pre-planned 1 preplaced 1 Preparedness 1 Preparationof 1 preoperational 1 Pre-Olympic 1 prenylation 1 Prendes 1 Prenat 1 pre-mRNA 1 pre-motor 1 pre-moral 1 premises 1 pre-miR-135b 1 premedications 1 prematureaging 1 premalignant 1 prelude 1 pre-logical 1 pre-loaded 1 pre-load 1 preload 1 preliminaryin 1 pre-LB 1 pre-labour 1 preinvasive 1 pre-induction 1 Preincubation 1 preincubated 1 Prehosptial 1 prehospital 1 Prehosp 1 Prehistory 1 prehepatic 1 prehension 1 pregnanolone 1 pregnancy-induced 1 pregnancy-associated 1 pregnancies-with 1 pregestational 1 pregenual 1 Pregabalin-associated 1 preg 1 pre-frontal 1 prefractionation 1 Pre-fibrillaralpha-synuclein 1 preferring 1 preferredpracticepatternsguideline 1 pre-fatiguing 1 preface 1 Pre-enucleation 1 preenucleation 1 pre-eminent 1 predominates 1 predominated 1 predominate 1 predisposes 1 predischarge 1 predilections 1 predilection 1 predictorofan 1 prediction-oriented 1 predestined 1 predesigned 1 prede 1 predator 1 pre-dated 1 pre-cursor 1 precontrast 1 preconditioning 1 pre-condition 1 pre-competition 1 precludes 1 Preckel 1 precipitation-centrifugation 1 precipitable 1 prechemoembolization 1 precerebral 1 precarious 1 pre-BLinD 1 pre-biopsy 1 Pre-B 1 preauricular 1 prearrest 1 Pre-and 1 preanaesthetic 1 pre-adapt 1 Pre1 1 PRDM1 1 PRC-mediated 1 prchallal 1 PRC 1 PRBB 1 Prayson 1 pray 1 praxis 1 Pravin 1 Prattala 1 Prats 1 Pratkanis 1 Prather 1 Prater 1 Praschak-Rieder 1 Prasanth 1 PRAMS 1 Prampero 1 Prakriya 1 Prakash 1 praise 1 pragmatically 1 praetermittendo 1 Pradon 1 practising 1 practice-specific 1 practice-dependent 1 practice-based 1 practicality 1 practicalities 1 Prac 1 Prabhu 1 Prabhakaran 1 pr70 1 PR07 1 pqr 1 PPVT-III 1 PPROM-related 1 PPROMEXIL-trial 1 PPROM-EXIL 1 p-PRAS40 1 ppr 1 p-particle 1 PPARGC1Agene 1 PPARG 1 PPARalpha-mediated 1 PPAR-alpha-dependent 1 PPAR-alpha 1 PPARA-L162V 1 PP1G 1 Pozzilli 1 Pozos 1 Pozniak 1 Pozna 1 Poysky 1 poxvirus 1 p-oxidation 1 pox 1 powermicroscope 1 powerless 1 Powerchart 1 powerata1-sided 1 Powe 1 poverty-obesity 1 Pourazar 1 PouracleA 1 pour 1 Poupon 1 pound 1 Poulin 1 Pouladi 1 Poudyal 1 Potulska-Chromik 1 Pottenger 1 Potocki 1 Potgieter 1 Potes 1 potentinal 1 potentiating 1 potentialto 1 potentialfor 1 potentialbio 1 Potchefstroom 1 potato 1 postweaning 1 post-UPPP 1 postulates 1 post-TT 1 posttrans-plant 1 posttranslationally 1 posttranslation 1 post-transcriptional 1 post-training 1 Post-time-trial 1 posttest 1 postterm 1 post-TAVR 1 post-synaptic 1 post-stimulus 1 post-staining 1 post-spike 1 Postspike 1 post-secondary 1 Postrepression 1 post-remission 1 post-receptoral 1 post-radiotherapy 1 Postprocessing 1 Postprocessed 1 post-procedural 1 postprandial 1 postpones 1 post-phacoemulsification 1 post-partum 1 postoperation 1 postop 1 post-natal 1 post-nadir 1 postmyocardial-infarction 1 postmitotic 1 postmeasurements 1 postmastectomy 1 post-marketing 1 postmarket 1 Postlmayr 1 Postlethwait 1 postlesion 1 post-ischemic 1 post-irradiation 1 postinjury 1 Postings 1 postinfusion 1 post-industrial 1 post-implementation 1 postimmuno-precipitation 1 post-hysterectomy 1 postherpetic 1 Post-exposure 1 Post-experiment 1 post-expansion 1 post-exertion 1 posteriori 1 postembryonic 1 postdates 1 post-contrast 1 post-consolidation 1 postconditioning 1 post-cisternal 1 post-cistern 1 post-chemo-therapy 1 postcentral 1 Post-cataract 1 postcataract 1 Post-call 1 Postbus 1 post-baseline 1 Postauricular 1 post-analytical 1 post-anaesthesia 1 postamputation 1 postal-based 1 postage-paid 1 post-acute 1 postacute 1 Post2 1 post1stpost1st 1 possessions 1 Pospisilova 1 Pospichal 1 positum 1 -positron-emission 1 positron-emission 1 positronemission 1 pos-itron 1 posi-tivity 1 position-related 1 Posenenske 1 Posencheg 1 PorzigH 1 portraying 1 Port-man 1 Portillo 1 Porteous 1 portal-venous 1 Portale 1 Porta 1 Porru 1 Porras 1 porphyrinogenic 1 porphyrin 1 porphobilinogen 1 Poromaa 1 Porkka 1 pork 1 pore 1 Porcu 1 porcine 1 PopulationSciences 1 population7 1 pop-ulation 1 Popu-lation 1 populates 1 popularly 1 popularised 1 pops 1 Popper 1 Poppel 1 Popay 1 Popa-Cherecheanu 1 Pooter 1 poor-quality 1 Poon 1 Poomvanicha 1 Pooled-Rotterdam-Milano-Toulouse 1 pooledanalysis 1 Poole 1 Pooja 1 Pontypridd 1 Pontificia 1 Pontical 1 Ponte 1 Ponsot 1 Pons 1 Ponomarenko 1 ponderously 1 Ponader 1 pon 1 Pomorzev 1 Pomes 1 Pomerantz 1 Pomeraniec 1 POMC 1 polyvinylpyrrolidone 1 polyvinylidene 1 poly-unsaturated 1 polytherapies 1 polytene 1 polyps 1 polyploidy 1 polyphenols 1 polyphenol 1 polypharmacy 1 polyneuropathies 1 polymor-phisms 1 polymorphismand 1 polymethyl 1 Polymesam 1 polymeric 1 polymerbiolimus-eluting 1 poly-merase 1 polyg-onal 1 polygonal 1 pol-yglutamine 1 poly-glutamine 1 polyethylene-glycol 1 polyene 1 polycarbonate 1 polybrene 1 polyarthritis 1 polyangiitis 1 polyacryl-amide 1 Poltronieri 1 Polspoel 1 Polotskaia 1 Polo 1 pollution 1 Pollok-Kopp 1 Polli 1 Polley 1 polled 1 Polle 1 Pollak 1 poll 1 Politzer 1 Polity 1 Polito 1 politics 1 politically 1 Politi 1 PolinskiJM 1 Polinder 1 polido-canol 1 policymakers 1 policy-and-research 1 Policlinico 1 polices 1 Poldrack 1 Poldermans 1 Polderman 1 Polatin 1 polarographically 1 polarisation 1 Polaner 1 Poland 1 Pokinko 1 poker 1 POISE 1 pointspread 1 point-of-sale 1 point-of-care-ultrasound 1 Poikkeus 1 Pogribny 1 Pogosova-Agadjanyan 1 Poels 1 Podstawa 1 PodsiadloD 1 PODs 1 Podoll 1 Podoleanu 1 Podokinetic 1 Podlutsky 1 podium 1 Podio 1 Podd 1 podcast 1 pockets 1 POB 1 PO2mit 1 PO1 1 Po0 1 PNS 1 PNPs 1 p-nitrophenyl 1 pneumothoraces 1 pneumonitis 1 pneumonic 1 pneumonectomy 1 Pneumol 1 pneumocytes 1 pneumococcus 1 pneumococcal 1 PNB 1 PMV 1 P-MRS 1 PMID 1 pmed 1 PMB 1 PM-7050-054-C02011 1 pm292 1 Plusa 1 pluripotential 1 plurality 1 Plural 1 plunged 1 Plume 1 plumbing 1 plugin 1 PLTP 1 PLs 1 Ploughman 1 Plon 1 Plomp 1 Ploegh 1 PLIN4 1 plica 1 Pleyer 1 plexuses 1 plexopathy 1 plexi 1 Pleurocath 1 pleuritic 1 Pletnikova 1 Pletnikov 1 Plessis 1 Plenum 1 plentiful 1 PL-enriched 1 Pleister 1 pleasing 1 pleased 1 pleasantness 1 plea 1 PLB1 1 Plazzi 1 Plaza 1 playtime 1 playsis 1 playsa 1 playing-position 1 players--a 1 Plauen 1 Plath 1 Platelet-poor 1 plateaued 1 Plata-Salaman 1 Plastimed 1 Plassman 1 Plassa 1 plasminogen-activator 1 Plasmino-gen 1 plasmapheresis 1 plasma-LDL-driven 1 plasmaLDL 1 plasmahomocysteine 1 plasmacytoid 1 plas-mablasts 1 planum 1 Plante 1 plant-derived 1 Plano 1 Plange 1 Planeta-Wilson 1 Planell-Saquer 1 Planella 1 planarity 1 Plaitakis 1 plaintiff 1 plainly 1 Plaines 1 Plaghki 1 Plager 1 placenta-and 1 Placements 1 placebos 1 placebo-control 1 placebo- 1 Plaat 1 PLA2G4A 1 PK-resist-ant 1 PKC 1 PKBalpha 1 PK7088 1 PK-6100 1 PJB 1 Pizzo 1 pixel-by-pixel 1 pixel-based 1 Piwi-interacting 1 Pivik 1 Pitzul 1 pity 1 Pitx3-transfected 1 Pitx3-deficient 1 Pitts 1 Pittock 1 pitmarked 1 Pitkanen 1 Pitie 1 pitch 1 Pistrang 1 Pisters 1 p-isothiocyanatobenzyl-desferrioxamine 1 Pisana 1 Pisa 1 Piron 1 Pirola 1 Pirna 1 Pirl 1 Pirkis 1 piritramide 1 piriform 1 Pirie 1 PI-resistant 1 piracetam-like 1 piracetam 1 piqued 1 pipetted 1 Piperopoulos 1 pipelines 1 Piontkivska 1 pioneers 1 Pintelaan 1 pinprick 1 pinpointing 1 pinpoint 1 pinned 1 Pinkus 1 Pinker 1 Pink1forms 1 Pink 1 Pini 1 ping 1 Pineda 1 pinching 1 pinch 1 Pinals 1 Pin1 1 pin 1 Pimentel 1 Pima 1 piloted 1 Pilon 1 pilocarpine-induced 1 Pillsbury 1 Pillarisetti 1 pillar 1 Pillai 1 pill 1 Pileczki 1 Pilch 1 Pilar 1 P-IKK 1 Pikarsky 1 Pijpe 1 Pijnen-burg 1 Pijnenborg 1 Pijls 1 PI-insensitive 1 Pihlajamaki 1 pigtail 1 Pignatelli 1 Pietrzyk 1 Pietro 1 Pierro 1 Pierre-Olivier 1 Pierotti 1 Pierluigi 1 Pieri 1 Pierelli 1 piercing 1 Pieramici 1 Pierallini 1 Piepoli 1 Piepenbrock 1 Pienta 1 Piehlmeier 1 Piehl 1 Pieczenik 1 pictured 1 pictorial 1 Picton 1 picomolar 1 picoliter 1 picogram 1 Pickut 1 Pickrellet 1 picking 1 Pickett 1 picked 1 Pickar 1 pick 1 Picinich 1 Picillo 1 Pichlmeier 1 Pichlmaier 1 Pichiorri 1 Piccoli 1 Piccin 1 Picciano 1 Picci 1 PICARDI 1 Pi-by-no 1 PI-based 1 Piazza 1 PiantaMJ 1 piano 1 Piacentino 1 Piacentini 1 Pia 1 PI3-kinse 1 PI3-kinaseina 1 PI3Kinase 1 PI3K-and 1 PI3-K 1 PI041890 1 Phytother 1 phytohemagglutinin 1 Physitemp 1 physiotherapist 1 physio-pathological 1 physiopathological 1 physiologists 1 physician-toxicologists 1 physician-to-physician 1 physicians-in-training 1 physicians-in-practice 1 physician-resources 1 physician-rated 1 physician-quality-reporting-system 1 physician-level 1 physician-generated 1 physician-fee-schedule 1 physician-approved 1 physicality 1 phy-logenies 1 phyllodes 1 Phyllis 1 p-hydroxyacyl 1 Phycoerythrin-conjugated 1 phyco-erythrin 1 Phung 1 Phua 1 phrasing 1 photothrombotic 1 photostress 1 photoreceptorsin 1 photoreceptor-pigment 1 photoreceptor-derived 1 photoreceptordegeneration 1 photo-oxidation 1 photooxidation 1 photomicrography 1 Photometrics 1 photofilled 1 photoelectric 1 Photodamage 1 photocopied 1 Pho-tochem 1 Photochem 1 photoceptor 1 photic 1 PhosSTOP 1 phospho-synuclein 1 phospho-SUMO-IkBalpha 1 phosphorymodificationlated 1 phosphorylethanolamine 1 phosphorylcholine 1 phosphorylation-dependent 1 phosphor-ylation 1 phosphoryl-ation 1 phosphorylating 1 phosphorylates 1 phosphor-ylase 1 phosphorus 1 phosphorothioated 1 phosphorothioate 1 phosphorodiamidate 1 phosphor-imaging 1 phosphopeptide 1 phos-pholipases 1 phosphokinase 1 phosphoinositide-3-OH 1 phosphoino-sitide 1 phospho-histone 1 phospho-ERK 1 phosphatidylinsositol 1 phosphatidylinositol-3-OH 1 phosphatidylinositol-3 1 phosphatidylinositol 1 phosphatidylethanolamine-N-methyltransferase 1 phosphates 1 phosphatases 1 Phosphagens 1 Phonotactics 1 phonology 1 Phoniatr 1 Phonetics 1 phonetic 1 phones 1 phonemically 1 phonemes 1 phonation 1 phobics 1 phobic 1 phobiapatients 1 phlebothrombosis 1 phlebitis 1 Philp 1 philosophically 1 Philosophica 1 philosophe 1 Phillipson 1 Phillips-Bute 1 Philippi 1 Philibert 1 Philbin 1 Philadephia 1 Phil 1 PhiKan083 1 Phielix 1 PHF 1 Phesse 1 pheromones 1 phenyl-methylsulfonyl 1 phenylmethanesulfonylfluoride 1 phenylmethanesulfonyl 1 pheno-typing 1 Phenotypicvariation 1 phenotypeto 1 pheno-types 1 phenotypeincluding 1 phenomenons 1 phenomenological-metaphysical 1 phenomene 1 Phenome 1 phenocopies 1 phenelzine 1 Phelps 1 Phe-Arg-Trp 1 PhDz 1 PhDT 1 PhDk 1 phase-variance 1 phase-space 1 phase-dependent 1 phased-array 1 pharynx 1 pharyngealpumping 1 Pharmingen 1 pharmacotherapeutic 1 Phar-macother 1 pharmacopsychiatry 1 pharmacophore 1 pharmacologically 1 phar-macological 1 Pharmaco-kinetics 1 pharmacokinetic-response 1 pharmacoki-netically 1 pharma-cokinetic 1 pharmaco-kinetic 1 pharmacogenetically 1 pharmacogenetic 1 pharmacist-delivered 1 pharmacies 1 pharmaceutically 1 Pharma-cal 1 Pharma- 1 Phantomglied 1 phantom-based 1 Phang 1 Phaneuf 1 phale 1 phagocytosis-induced 1 phage 1 phacoemulsification-lens 1 PGY-1 1 P-gp 1 P-glyco 1 PGL3-miR-135b-P2 1 pGL3 1 PGC-1a 1 PGC-1 1 PGC1 1 Pfutze 1 Pfund 1 Pfullingen 1 Pfizer 1 Pfister 1 Pfefferbaum 1 PFB 1 Pfannenstiel 1 Pfankuch 1 Pfaff 1 Pfaender 1 Pezzoli 1 Pezziniet 1 pez-Bigas 1 pez-Arribillaga 1 Pezard 1 Peyre 1 pewinternet 1 Pew 1 Peurala 1 Petzl 1 Pettker 1 Pettersen 1 Petrucci 1 Petrovic 1 Petros 1 Petroff 1 Petriv 1 Petrie 1 PetrekJA 1 Petrasch-Parwez 1 Petracca 1 Petra 1 Peto 1 Petitta 1 PetersM 1 Peterhoff 1 pesticides 1 Pesta 1 Pessoal 1 peso 1 Peskett 1 pesents 1 PE-SAL-RNAs 1 perweek 1 Pervin 1 pervade 1 Peruvian 1 pertained 1 persuaded 1 Persson 1 person-to-person 1 Personnes 1 person-level 1 Persica 1 Pershad 1 Perrino 1 Perret 1 Perquin 1 perpetuating 1 perpetuates 1 perpetuate 1 perpendicularly 1 per-patient 1 peroxidized 1 peroxidizable 1 peroxidative 1 peroxidase-labeled 1 peroxidase-conjugated 1 peroxi- 1 Peroni 1 peroneal 1 perometry 1 Pernow 1 pernicious 1 Pernazza 1 permutation-based 1 Permount 1 permissive 1 permeate 1 permeant 1 -permeable 1 permeable 1 Permeabilization 1 Permanente 1 Perman 1 Perm 1 perlo 1 Perlina 1 Perlas 1 Perk-responsive 1 Perkinton 1 Perkin-Elmer 1 Perkin 1 Perkell 1 perivascular 1 Peritonitis 1 peritoneum 1 Peritoneal 1 periprocedural 1 peripapillary 1 Periodon-tol 1 periodicity 1 Periodicals 1 Periodical 1 perinuclear 1 perineural 1 Perinatology 1 Perinat 1 perinasal 1 Perilipin 1 peri-fovea 1 perifovea 1 Periconceptional 1 pericellular 1 pericarditis 1 pericardial 1 Periasamy 1 periapical 1 perhapsthe 1 Pergamon 1 perfusionists 1 perfusion-insensitive 1 perfumed 1 performingBayesian 1 Performing-a-1-N-Case-Control-Match-on-Propensity-Score 1 performanceofSA 1 performance-correlation 1 perforation 1 perforated 1 Perfetti 1 Perez-Villalba 1 Perez-Valero 1 Perez-Tur 1 Perez-Reyes 1 Perez-Revuelta 1 Perez-Martinez 1 Perez-Mart 1 Perez-Lopez1 1 Perez-Lopez 1 Perez-Gonzalez 1 Perez-Galan 1 Perez-Branguli 1 Perente 1 Perelman 1 Perdomo 1 per-diem 1 Percy 1 percussion 1 PerCP-Cy5 1 Perco 1 Perchet 1 perceptually 1 perceptional 1 percent-specific 1 percentiles 1 perceiving 1 perB-scan 1 Pepys 1 peptide-receptor 1 peptide-induced 1 peptidein 1 pep-tide 1 peptidase 1 peptastin 1 Pept 1 pepstatin 1 pepsin 1 Peperstraete 1 Penzes 1 Penzel 1 Penzberg 1 Penuelas 1 Pentz 1 pentilaminar 1 Pentikis 1 pentazocine 1 Pentagon 1 pentaacetate 1 Penny 1 Penn-sylvania 1 Pennells 1 Pengo 1 Penget 1 Penfield 1 penetration-aspiration 1 penetrates 1 penetrant 1 penehyclidine 1 Penedo 1 Penedes 1 Penede 1 Pendleton 1 Pencina14 1 pencil-and-paper 1 penalized 1 penalize 1 Pena 1 Pemtrl 1 PEMTgene 1 p-emitter 1 Pelusio 1 Peltonen 1 Peltom 1 Pelleymounter 1 Pellenberg 1 Pellen 1 Pellekaan 1 Pellegrini 1 Pellegrin 1 Peli 1 Pel-Freez 1 Peled 1 Pelaez 1 Pekar 1 Peixoto 1 Peipert 1 Peifer 1 Pei 1 Pegoraro 1 Pegaptanib 1 Peeters 1 peer-review 1 Peelen 1 Peel 1 Pedrini 1 Pedrelli 1 Pedrazzini 1 Pedram 1 pedigreed 1 pedicles 1 pediatricurology 1 pediatric-specialty 1 pediatricorthopedics 1 pediatrician-performed 1 pediatric-centered 1 Pedersenet 1 pedalling 1 pedalled 1 Pedagogy 1 peculiarities 1 Peck 1 pecific 1 Pecek 1 peas 1 Pearlson 1 peak-to 1 peaking 1 Peacock 1 PEA3 1 pe45 1 PDwith 1 PD-related 1 Pdr1 1 PDMPs 1 pdmpexcellence 1 PDlike 1 PDGRFA 1 PDG 1 pdfs-online 1 PDcompared 1 PDAC 1 PD-10 1 PCRs 1 PCR-inhibitory 1 Pc-positive 1 PCP 1 PCNA 1 Pcinduced 1 PCI-33380 1 PCI 1 p-chain 1 PCH 1 PCFT 1 Pc3 1 PC-220 1 pbd 1 Pb-212 1 Pazin 1 Pazen 1 Pazahr 1 Paz 1 PaysseEA 1 pays 1 payoff 1 Paynter 1 paynea 1 Paylor 1 payload 1 Paxinosa 1 Paxian 1 Pavlovian 1 Pavlou 1 Pavliv 1 Pavla 1 Pavillon 1 Pavia 1 Pavey 1 Pavese 1 Pavei 1 Pavanni 1 Pavan 1 Paus 1 Pauole 1 Pauly 1 Paulus-Hock 1 Paulsen 1 Paulozzi 1 Paulinen 1 Paulin 1 Pauli 1 Paule 1 Paula 1 Paukkunen 1 Paugh 1 Pauciulo 1 Pauca 1 Pau 1 Patzelt 1 Patz 1 Patvardhan 1 Pattinson 1 patternsof 1 patterned 1 pat-tern 1 Pattengale 1 Patten 1 Patsalides 1 Patriti 1 patriotic 1 Patrinos 1 Patrikiou 1 Patrignani 1 Patra 1 Patout 1 patologia 1 Patka 1 patientswho 1 patient-specific 1 patientsfrom 1 patients8 1 pa-tients 1 patient-related 1 patient-provider 1 Patientidentity 1 patient-health 1 patient-friendly 1 patient-controlled 1 patient-associated 1 Patient-assessed 1 patience 1 pathwayrelated 1 pathwayfor 1 Pathway-based 1 patho-physiology 1 pathophysiologies 1 patho-physiological 1 pathologyby 1 pathologizes 1 pathologiststo 1 pathogen-specific 1 pathogenicmutation 1 patho-genic 1 pathogen-free 1 pathogen-and 1 pathogen 1 pathoconnectomics 1 pathoaetiology 1 patho-35 1 pathlenght 1 Pathak 1 pat-gen 1 Pateromichelakis 1 Pateras 1 Patents 1 patented 1 Pate 1 Patanwala 1 Paszkiewicz 1 PASW 1 Pasupuletti 1 Pastori 1 Pastor-Barriuso 1 Pasternak 1 passwords 1 pass-through 1 Passmore 1 passively 1 passion 1 Passik 1 passenger 1 Passarotti 1 passaged 1 passable 1 Pasqualetti 1 Pasqua 1 Paskos 1 Paskevich 1 Pasinetti 1 Pasik 1 PASH 1 Pasdois 1 Pascuale 1 Pascoli 1 Pascoe 1 Pascal 1 parwith 1 parvocellular 1 Parvanta 1 parvalbumin-positive 1 parval-bumin-immunoreactive 1 parvalbu-min-immunoreactive 1 Parvalbumin-immunoreactive 1 parvalbumin 1 Party 1 parturient 1 part-time 1 partnerships 1 partnership 1 Partner-guided 1 parting 1 parties 1 particle-emitters 1 partial-onset 1 Partanen 1 Parssinen 1 Parslow 1 Parsippany 1 PARS-III 1 parsed 1 Parrish 1 Parramo 1 Parpura 1 PARP1 1 PAROLE 1 Parnes 1 Parmet 1 Parmar 1 Parlar 1 parks 1 Parkinson-like 1 parkinsonismdue 1 Parkinsondisease 1 Parkin-son 1 parkinproteins 1 Parkin-independent 1 Parkinexpression 1 ParkinD 1 PARKgenes 1 PARK6 1 PARK3 1 PARK16-18 1 Parisiadou 1 Parini 1 Parikh 1 parietotemporal 1 parieto-occipital 1 parieto-frontal 1 parieto 1 parietally 1 Parides 1 Pariante 1 Parhar 1 Parham 1 Parfitt 1 paresthetic 1 parestesie 1 paresis 1 Parere 1 parent-reported 1 parent-report 1 parent-of-origin 1 parent-offspring 1 Parent-child 1 Parens 1 parcellation 1 parcellate 1 parcdesalutmar 1 Parc 1 Parazzini 1 paraxanthine 1 Parat 1 parasympathetic 1 parasternal 1 paraspinal 1 para-plegic 1 paraplegic 1 parapatellar 1 paraparesis 1 Parant 1 paraneural 1 Parana 1 parametrized 1 parametrically 1 parameterized 1 parameterize 1 parameterization 1 Parameswara 1 paramesonephric 1 para-medics 1 paramedian 1 paralytic 1 parallel-treatment 1 parallelism 1 Paralleling 1 parallax 1 Para-inflammation 1 parahip-pocampal 1 parafovealt 1 parafovealring 1 paraffin-embedding 1 paradigm-issuesand 1 paradigmin 1 paradigmatic 1 Parade 1 Parada 1 paracetamol 1 paracentral 1 para-bolic 1 parabolic 1 par 1 Papworth 1 Pappert 1 Pappat 1 paperwork 1 papers36 1 paper-and-pencil 1 Pape 1 Papavassiliu 1 Papathanassiou 1 Papas 1 Papapanagiotou 1 Papantoniou 1 Papakonstantinou 1 Papaioannou 1 papain 1 Papadopulos 1 Papachatzopoulou 1 Paone 1 Paoli 1 Panzer 1 Pantuck 1 Pantoni 1 panthothenic 1 Pant 1 pansinusitis 1 Panov 1 panoramic 1 panneuronally 1 panneural 1 Pannetier 1 Pannaccione 1 Panksepp 1 Pankratzet 1 Pankiw-Trost 1 Panizzutti 1 Paniagua 1 Pani 1 pan-HDAC 1 Pangrsic 1 Panettieri 1 Panepinto 1 Pandraud 1 Pandi-Taskar 1 Pandey 1 Panda 1 pancreatectomy 1 Panahinia 1 pamine 1 Pamela 1 PAM 1 Palumbo 1 Paltiel 1 Palsied 1 Pa-lop 1 Palop 1 Palomaki 1 Palmisano 1 pallor 1 Pallini 1 Pal-liative 1 Pallia-tive 1 palliate 1 Paller 1 Pall 1 Palinski 1 Palileo 1 palilalia 1 Pali 1 Palestinian 1 Palanichamy 1 Palanca 1 Palaeolithic 1 Palacios 1 p-AKT 1 pAKT 1 Paknejad 1 Pakistanis 1 Pakistan 1 Pajunk 1 Pajntar 1 Pajala 1 Paisan-Ruiz 1 painyin 1 paintings 1 pain-review 1 painrelated 1 painquilt 1 pain-preventive 1 pain-monitoring 1 pain-management 1 pain-free 1 pain-evoking 1 Paine 1 pain-drug 1 pain-associated 1 pain32 1 Paillerets 1 paients 1 PAI-1 1 Pai 1 Pahwa 1 Pahor 1 Pahapilland 1 Pahapill 1 Pagnoni 1 Pagliaro 1 Pagliarini 1 Paget 1 paged 1 pag 1 Paffen 1 Paez 1 Paeng 1 Padua 1 pads 1 Padoa-Schioppa 1 Padmaja 1 Padidam 1 Padfield 1 Padera 1 Paden 1 Padala 1 PACU 1 Pacora 1 PaCO2 1 packings 1 packets 1 Packard 1 packaged 1 Paciorek 1 Pacific 1 Pachter 1 Pacheco 1 pacemakers 1 Pacella 1 Pablo 1 Paavo 1 Paasche-Orlow 1 Paakkonen 1 pA29S 1 p97 1 P9416 1 P8038 1 P800 1 P-77 1 p752 1 P74 1 p73-dependent 1 p738 1 p53-targeting 1 p53-target 1 p53siRNA 1 p53-related 1 p53R273H-specific 1 p53R273H 1 p53-R175H 1 p53-null 1 p53-induced 1 p53-independent 1 p53-dependent 1 p53-bearing 1 P50-CA103130 1 P5 1 P4P 1 P4691 1 P450s 1 P-450-dependent 1 P450c27 1 P40101-0 1 P3925 1 P33 1 P30EY001931 1 P30DK092926 1 p27kip1 1 p27KIP 1 p21-mediated 1 P21570FW 1 P21406FW 1 P20RR016480 1 P20 1 P1-N2-N4 1 P1-N1b-P2-N2 1 p16Ink4a-positive 1 p110g 1 p110d 1 p110 1 p105 1 p100 1 P035 1 P034 1 P032 1 Ozzo 1 Ozturker 1 Ozturk 1 Ozsahin 1 Ozols 1 OzolekJA 1 Ozmen 1 Ozkahya 1 Ozgunen 1 Ozelius 1 Ozawa 1 Oyen 1 Oyaizu 1 oxytocics 1 oxyorthosilicate 1 oxymorphone 1 oxyhemoglobin 1 oxygraphic 1 oxygen-15 1 Oxnard 1 oxLDL 1 OXIS 1 oxidoreductase 1 oxidize 1 oxidised 1 oxideYbased 1 oxide-based 1 oxidative-stress-response 1 oxidatives 1 oxida-tive 1 oxidant-containing 1 oxidant- 1 oxidant 1 Oxid 1 Oxfordshire 1 Oxenham 1 OX3 1 OX1 1 owners 1 owes 1 Owens 1 Owenby 1 Owala 1 Ovrebo 1 overworked 1 overwhelmingly 1 overwhelm 1 overt-synuclein 1 over-treatment 1 Overtreatment 1 overtreated 1 overtraining 1 overstated 1 over-simplified 1 over-simplification 1 overseas 1 over-sampling 1 oversampled 1 oversample 1 overrunning 1 overrides 1 overrepresentations 1 over-reporting 1 over-reading 1 overreaching 1 overrate 1 over-production 1 overproduced 1 overpowered 1 over-optimistic 1 over-night 1 Overmeyer 1 overlooking 1 overlays 1 overlaying 1 Overkleeft 1 overinterpretation 1 over-infusion 1 Overholser 1 overexpressinghSNCA140 1 over-estimation 1 Overduin 1 overdosing 1 OverdosePrevention 1 overdosage 1 over-detect 1 overcrowding 1 over-come 1 overcame 1 overburdened 1 overallywhich 1 overa78 1 over5 1 Ovens 1 oven 1 ovary 1 ovariectomy 1 ovalbumin 1 Ovaa 1 Ouzounian 1 Ouwerkerk 1 outweighed 1 out-the-world 1 Outsourcing 1 outsource 1 outs 1 outreach 1 outperforms 1 outpaced 1 out-of-state 1 out-of-network 1 out-of-body 1 outliming 1 outlet 1 out-group 1 outerretinal 1 outermost 1 Outeiro 1 out-comes 1 outcome-based 1 outcomeat12 1 outcom 1 outbred 1 Ousati 1 ous 1 oursubjects 1 ourselves 1 ourin 1 ourfindings 1 ourdata 1 ounces 1 Oukrif 1 Ouillon 1 ouhsc 1 Oue 1 Oudkerk 1 Ouderaa 1 Oudenaarden 1 Ouden 1 Oude 1 Ouchi 1 Oucher 1 Otx2-immunoreactive 1 Otx2-immunopositive 1 Otto-von-Guericke 1 Ottomano 1 Ottman 1 otter 1 Otsuru 1 Otsubo 1 otospongiosis 1 Otorinolaryngology 1 Otorinolaringologia 1 Oto-rhinolaryngology 1 Otorhinolaryngologists 1 otorhinolar-yngologic 1 Otorhino-laryngol 1 Otorhinolaryngo 1 otoplasty 1 otologic 1 otolithic 1 Otolaryngologists 1 Othman 1 otherythey 1 other-resources 1 otherness 1 Otero 1 otation 1 Otalgia 1 Otago 1 Oswego 1 osumc 1 Ostry 1 Ostrowski 1 Ostroff 1 OSTRC 1 Ostrander 1 ostia 1 Osterman 1 Ostermaier 1 Osterloh 1 Ostergaard 1 osteoto-mies 1 osteoprotegerin 1 osteoprogenitor 1 os-teoporotic 1 Osteopat 1 osteonecro-sis 1 osteonecroses 1 osteomimicry 1 osteolytic 1 osteolysis 1 osteoclastic 1 osteo-blast 1 Ostend 1 Ostelo 1 Ostbye 1 Ostaszewski 1 Ostall-gau-Kaufbeuren 1 Osta 1 OS-specific 1 Ossovskaya 1 Ossola 1 ossification 1 Ossenkoppele 1 OSs 1 Ospina 1 Ospedaliera 1 Osoba 1 OSMSE-R 1 Oslo 1 Oskamp 1 osirix-viewer 1 Osin 1 Oshima 1 Oshawa 1 Osgood-Schlatter 1 OSER-like 1 -OSEM 1 OS-derived 1 oscillators 1 oscillated 1 Oscar 1 Osborn 1 OSAHS 1 Osada 1 orytry 1 Ory 1 Orug 1 Orton 1 Ortmann 1 orthovanadate 1 orthostatic 1 orthosis 1 Orthopedics 1 orthonormal 1 orthologues 1 ortholog 1 orthogonally 1 Orthod 1 Ortenberg 1 Ortega-Azorin 1 ortechnical 1 orTCF7L2 1 orTcells16 1 Orsucci 1 Orso 1 Orringer 1 orretention 1 orresponding 1 Orrego 1 Orphanet 1 oropharynx 1 oro-pharyngeal 1 ornot 1 Ornberg 1 ornaments 1 Ornament 1 Ormond 1 Orme 1 Orlova 1 Orlock 1 Orlandi 1 OrjuelaM 1 Orit 1 origi- 1 OriGene 1 Orig 1 orients 1 Orientamenti 1 orient 1 orheterozygous 1 or-gans 1 organpathology 1 organomegaly 1 organizes 1 organizers 1 organismal 1 organised 1 Organisatie 1 organelle 1 OrganBehavHum 1 oret 1 Ordovasand 1 Ordov 1 ordinem 1 Ordinarily 1 ordinality 1 orderungsfonds 1 orderung 1 orderly 1 orderliness 1 ordered-subset 1 orchestrating 1 orchestrates 1 orchestrated 1 Orchard 1 Orbus 1 orbitomedial 1 orbitofrontal-amygdala 1 Orbis 1 Orav 1 orat 1 Optos 1 Optojump 1 optoelectronic 1 optimistically 1 Optimising 1 optimisation 1 opticsmay 1 optically 1 opsonization 1 opsin 1 OPS-301 1 OPS 1 opposition 1 opposingly 1 opposes 1 opponents 1 Oppermann 1 OP-OSEM 1 Opolczynski 1 OPKO 1 opioid-use 1 opioidsparing 1 opioid-seeking 1 opioid-related 1 opioid-prescribing 1 Opioid-mediated 1 opioid-dependent 1 Opio 1 Ophthitech 1 ophthalmoscopic 1 Ophthalmologicum 1 ophthalmological 1 Oph-thalmologica 1 ophthalmologic 1 OphthalmolClin 1 ophtha 1 ophtalmologie 1 Ophtalmique 1 Ophof 1 OPG-Fc 1 Opeskin 1 Opercolo-insular 1 operatively 1 operationalization 1 operationalisation 1 operated-side 1 operantly 1 operant 1 open-source 1 open-mouthed 1 openings 1 Opazo 1 opaque 1 opacification 1 OP50 1 oozing 1 Oos-tra 1 Oostra 1 Oosting 1 Ookhtens 1 Ooi 1 ONTT 1 ontology 1 on-site 1 onsite 1 onsetor 1 on-off 1 Onoe 1 Onodera 1 Onoa 1 onmiR-146a 1 only2 1 only10 1 only1 1 onlifespan 1 on-label 1 onions 1 onhomocysteine 1 Ongchin 1 ONF 1 one-tenth 1 oneself 1 One-sample 1 One-pill 1 onePik3caWT 1 One-phase 1 one-fourth 1 one-centimeter 1 ONE6 1 one16 1 one- 1 onderzoek 1 Onderka 1 ondcp 1 on-court 1 Oncotreat 1 Oncosynergy 1 oncoproteins 1 oncoprotein 1 oncoming 1 oncologicagents 1 On-col 1 oncogenicity 1 onco-genic 1 once-daily 1 once-a-day 1 onaging 1 on9November 1 on7February2013 1 Omron 1 Omrani 1 Omotehara 1 Omori 1 OmniPod 1 ominous 1 OMEGASTAR 1 Omaswa 1 O-mannosylation 1 oma 1 Olvet 1 Olujohungbe 1 Oltmanns 1 Olthof 1 Olsson 1 Olsavsky 1 Olot 1 ological 1 OlneyC 1 Olmsted 1 Ollinger 1 Olivier 1 Oliveri 1 Olivera 1 Olivennes 1 Olivedale 1 Olinger 1 oliguria 1 oligonucle-otides 1 oligomericAbeta 1 oligo-meric 1 oligomer 1 Oligodendrogliomas 1 oli-godendrocyte 1 oligoclonal 1 olignucleotides 1 OLIG3 1 Olgiati 1 Olga 1 Olejniczak 1 oleic 1 Olefsky 1 Oldmeadow 1 Oldham 1 olderwomen 1 Oldervoll 1 olderpeople 1 Oldenburg 1 Olde 1 oldage 1 oldadults 1 Olcese 1 Olausson 1 olanzapine 1 Olaizola 1 Okware 1 Okuda 1 Okubo 1 Oksman 1 Oksala 1 Okochi 1 Okkenhaug 1 Okinawa 1 Okie 1 Oken 1 Okano 1 Okamura 1 Okabe 1 Oka 1 ok1957 1 Oien 1 OI 1 Ohtsuki 1 Ohtsuka 1 Ohtahara 1 Ohta 1 Ohshima 1 Ohrdruf 1 Ohno-Matsui 1 Ohnishi 1 Ohlsson 1 Ohlfest 1 Ohizumi 1 OhiraT 1 Ohi 1 Ohba 1 Ohashi 1 Ohara 1 ogy 1 Oguru 1 Ogurtsov 1 Ogston 1 ography 1 Ogoshi 1 ognuno 1 Ogihara 1 Ogborn 1 Ogawara 1 Ogawa 1 OG 1 ofythe 1 ofthis 1 ofthese 1 OFTERRORISM 1 often-vague 1 often-mentioned 1 oftelomeric 1 oftberger 1 ofsubnormal 1 ofSIR2 1 ofseverity 1 ofRT 1 ofretinoblastoma 1 ofprinciple 1 ofplasma 1 ofpink1 1 ofPD 1 ofpatients 1 ofOPA1 1 ofnigral 1 ofNegative 1 ofmiR-34a 1 ofmiR-181a 1 ofmicroRNA-80 1 ofMedical 1 ofmany 1 ofmacular 1 oflife 1 -of-interest 1 ofHenle 1 ofheadache 1 ofgrowth 1 ofglycogen 1 offsprings 1 offsite 1 offsets 1 off-service 1 off-pump 1 Offner 1 offload 1 offices 1 Officers 1 offibrutinib 1 offensive 1 OFF-beta 1 OFF-alpha 1 Ofengeim 1 ofearlier 1 ofdyspnea 1 ofDNA 1 ofDJ-1 1 ofDisease 1 ofConsulting 1 ofClinical 1 ofCa2 1 ofboth 1 ofbeta-amyloid 1 ofbench 1 ofB 1 ofautophagy 1 ofAnxiety 1 ofAlzheimer 1 ofageing 1 ofAdolf 1 ofAbnormal 1 ofAb1 1 ofAAV2 1 of35 1 of279 1 of140 1 of0to 1 Oevelen 1 Oestereich 1 oesophagectomy 1 Oellers 1 Oellerichand 1 Oellerich 1 Oelde 1 Oeckinghaus 1 OE 1 ODS-100 1 Odouli 1 Odin 1 Odendaal 1 oddsratio 1 Oddie 1 Oddi 1 oddchain 1 oddball 1 OD010440 1 Ocul 1 octreotate 1 OCT-based 1 octave-wide 1 OCN 1 Ockene 1 Ock 1 Ochoa 1 ocfs 1 ocep 1 occurduring 1 occupy 1 occupies 1 occupations 1 occupation-related 1 occluding 1 Obwandner 1 Obuchowski 1 Obuchi 1 Obstetrie 1 obstetrician-level 1 obstetrician-dense 1 obstetrical 1 obsterical 1 obsolete 1 observer-based 1 Observatory-related 1 observatories 1 observative 1 Observaion 1 obscures 1 Obregon 1 Obreg 1 obliged 1 oblige 1 obligated 1 objections 1 objecti 1 Obi 1 OBGYN 1 OBFC1 1 obesity-related 1 Oberthulba 1 Oberoi 1 Obermeyer 1 Obermair 1 Obermaier 1 Oberley 1 Oberkochen 1 Oberholtzer 1 Oberdorf 1 Obenauer 1 Obama 1 oating 1 Oakland 1 Oaf1p 1 Oaf1 1 O-6-methylguanine-DNA 1 O6 1 O2are 1 o0 1 nyumc 1 Nyui 1 NYU 1 nytimes 1 Nystrup 1 NYS 1 NYR 1 Nyirenda 1 nyi 1 Nyholm 1 NYHA 1 Nygren 1 Nyberg 1 NXA931 1 NWO 1 nvog-documenten 1 NVOG 1 n-variate 1 Nva1 1 Nuyts 1 Nuvilab 1 Nutritionals 1 NUTRIM 1 Nutrigenomics 1 Nutrigenom 1 Nutrigenetics 1 Nutrigenetic 1 Nutrigenet 1 nutrient-sensitive 1 nutrient-dependent 1 nut 1 Nussenzweig 1 Nussenblatt 1 Nusbaum 1 nurturance 1 nursery 1 nurse-like 1 nurselike 1 Nuria 1 Nupponen 1 NuPAGE 1 Nunez-Santana 1 Nunc 1 Nunan 1 Numer 1 numbness 1 number-needed-to-treat 1 Numaga 1 Nulman 1 nullmice 1 nuisance 1 Nugroho 1 Nudmamud 1 nucleo-tide 1 nucleosomes 1 nucleoplasm 1 nucleoli 1 nucleolar 1 nucleo-cytoplasmic 1 nucleated 1 nuclear-retained 1 Nu-Chek 1 Nuberet 1 Nu 1 Ntrivalas 1 ntraneural 1 N-termni 1 NT-3 1 -NT 1 N-succinimidyl-3-iodobenzoate 1 nski 1 nska-Myga 1 NSDUHresults2012 1 NSDUHresults2011 1 NSCLC 1 nscl 1 NSC31926 1 NSAID-treated 1 NS082597 1 NS067189 1 NRSw 1 nroos 1 NRMSD 1 NR-ML-05 1 NR-MI-05 1 Nrf 1 NR4A2 1 NR3 1 NR2B-transfected 1 NR2B-NMDA 1 nr2041 1 NQF-endorsed 1 NPs 1 npr 1 NPM-ALK-driven 1 npeu 1 NPC1-containing 1 NPC1a 1 Npc1- 1 NP-40 1 Noy 1 Noxa 1 now-outdated 1 Nowitz 1 Nowicky 1 now-famous 1 Nowacki 1 nowaccredited 1 Novy 1 Novocastra 1 Novoa 1 novita 1 Novi 1 Novetsky 1 Novem 1 Novella 1 Noveck 1 Novagali 1 Novaes 1 Nova 1 Noureddin 1 Nouraei 1 Nougaret 1 notyet 1 Notter 1 notions 1 not-infrequent 1 notified 1 noticing 1 notices 1 noti 1 nothing-per-os 1 notexin-induced 1 notexin 1 notated 1 Notarbartolo 1 nosological 1 nosocomial 1 nosis 1 nose-ear 1 nosebleeds 1 NOS-3 1 norvegicus 1 North-western 1 north-south 1 Northridge 1 North-Face 1 Normosang 1 normolipidemic 1 Normanno 1 Normand 1 normalYbody 1 normal-tension 1 normal-size 1 normal-like 1 normalizes 1 normalities 1 normalises 1 normalIS 1 normal-dis 1 Normalcy 1 normal-appearing 1 normal23 1 norma 1 Norkus 1 Noriyoshi 1 Norito 1 Norelli 1 noredness 1 Nordstraom 1 Nordstr 1 Nordre 1 Nordio 1 NordicImagingLab 1 NordicICE 1 Nordenstrom 1 Nordenbo 1 Nordby 1 Nordal 1 Norcross 1 Norcini 1 Norbury 1 Nopoulos 1 Nooteboom 1 Noorollahi-Moghaddam 1 non-zero 1 Nonwordtype 1 nonvital 1 non-vision-related 1 nonviable 1 non-vascular 1 nonvarying 1 nonvalidating 1 non-validated 1 non-use 1 non-uric 1 non-truncated 1 nontruncated 1 non-trivial 1 Non-traumatic 1 nontraumatic 1 nontransformed 1 nontranscriptional 1 nonteaching 1 nontargets 1 nontargeted 1 non-target 1 non-systematic 1 non-synaptic 1 nonsumoylated 1 nonstutterers 1 Nonstudy 1 nonstochastic 1 non-steady 1 nonstatistically 1 non-spinal 1 nonspeech 1 non-specifically 1 nonspatial 1 non-soluble 1 nonsmall 1 nonserious 1 nonsequence-specific 1 non-selective 1 non-secretory 1 nonsarcopenic 1 non-SAEs 1 non-rigid 1 nonresponsive 1 nonresponse 1 nonregulatory 1 non-regenerating 1 nonrefractive 1 nonrecreational 1 Non-randomized 1 non-randomisedtrials 1 nonradiolabeled 1 non-radical 1 non-public 1 non-psychotic 1 non-protective 1 nonproliferative 1 nonprogres- 1 nonproductive 1 non-procedure-based 1 non-physiological 1 non-phosphorylatable 1 nonphase-space 1 non-pharmacological 1 Nonpharmacological 1 nonphar 1 non-perfusion 1 Non-perfused 1 nonpenetrating 1 non-peer-reviewed 1 nonpayment 1 non-patients 1 non-pathologic 1 non-partners 1 nonparticipation 1 non-paraneoplastic 1 nonparametrically 1 non-paramedics 1 nonpainful 1 non-pain 1 nonpain 1 nonpaid 1 non-oxidative 1 non-OR 1 non-opioid 1 Nonogi 1 non-obscene 1 non-obese 1 nonobese 1 nonnucleoside 1 nonnormality 1 non-normal 1 non-NHS 1 non-neurotoxic 1 non-neuronal 1 non-neural 1 nonneovascular 1 non-negligible 1 non-negative 1 nonnatural 1 non-native 1 Nonn 1 non-mydriatic 1 non-muscle 1 nonmineralized 1 non-metastatic 1 nonmembrane 1 non-melanomatous 1 non-melanoma 1 Nonmedicinal 1 nonmedical-pain-reliever-use-2013 1 non-Medicaid 1 nonmass-like 1 Nonlysosomal 1 non-localised 1 nonlinearly 1 non-linearity 1 nonlinearities 1 non-labouring 1 non-KIX-domain 1 non-jumping 1 nonjudgmental 1 non-ionizing 1 nonionic 1 non-invasiveness 1 non-internalizing 1 non-injured 1 noninjected 1 non-inferiority 1 non-inferior 1 non-inferential 1 noninduced 1 Non-Indexed 1 nonindependence 1 non-incentivised 1 nonimmunogenic 1 non-IkBalpha 1 non-iatrogenic 1 nonhypothetical 1 non-homogenous 1 nonhistone 1 non-hemolyzed 1 non-headache 1 nonhairy 1 non-Greek 1 nongravid 1 non-genetic 1 nonfunctional 1 non-fluorescent 1 nonfinancial 1 nonfatal 1 nonfasted 1 non-fallers 1 Non-exudative 1 nonexudative 1 nonexclusive 1 non-events 1 non-esterified 1 non-essential 1 non-erythroid 1 nonepileptic 1 non-EPCs 1 Non-energy-storage 1 nonembalmed 1 nonelite 1 nonelective 1 Non-EIAED 1 non-eccentric 1 nondopaminergic 1 nondopamine 1 non-disease-specific 1 non-diseased 1 non-disabled 1 non-diagnostic 1 nondeterministic 1 non-detected 1 nondepressed 1 Non-denaturing 1 nondegradable 1 nondegenerate 1 noncrossreactivity 1 noncontrast-enhancing 1 non-contrast 1 noncontact 1 nonconservative 1 non-connection 1 nonconditioned 1 noncompressible 1 non-compliant 1 noncompliance 1 Noncompletion 1 noncompleters 1 noncompetitive 1 non-compartment 1 non-commercially 1 noncommercially 1 non-combustible 1 non-colonised 1 noncognitively 1 non-codinggenetic 1 non-CNS 1 nonclonal-related 1 non-clinical 1 noncentral 1 non-categorical 1 non-cardiovascular 1 noncanonical 1 non-cancer-related 1 nonbreast 1 non-blinded 1 nonblastocyst 1 nonbioerodible 1 nonbacterial 1 non-autopsy 1 nonautofluorescent 1 non-ATL 1 non-athletic 1 non-Asian 1 non-ASD 1 nonarteritic 1 non-ART 1 nonanxiousindividuals 1 non-anxious 1 non-amyloidogenic 1 non-AMD 1 Nonaka 1 non-age 1 non-aerobic-based 1 nonadjacent 1 non-AD 1 nonacademic 1 non10-11Q 1 Nomoto 1 nominating 1 nominally6 1 NOMCAR 1 Nojiri 1 noises 1 noise-corrupted 1 Nointracranial 1 Nogueras-Gonzalez 1 Nogueira-Silva 1 Noguchi 1 nography 1 Noga 1 no-G 1 Noemi 1 Noel 1 Noebels 1 node-homing 1 Noda 1 NOD 1 Nocini 1 nociceptive-specific 1 nociception 1 Noch 1 no-cardiac 1 nobody 1 Nobis 1 Noake 1 noactive 1 no7369 1 no12 1 NNT 1 nnr 1 NNAL-glucuronide 1 NMR-based 1 NMP 1 nmolO2 1 NMO-IgG 1 NM-INBRE 1 NMF 1 N-methyltransferase-deficient 1 N-methyl-D-aspartate-activated 1 N-methyl-D 1 N-methyl-2-phenylindole 1 N-methyl 1 nmegasoftware 1 nme805 1 NMDAR-DSE 1 NMDAR2B 1 NMDAR1-knockout 1 Nmcova 1 n-Malo 1 NLP-7 1 nlm 1 NL637 1 NL557 1 NL004 1 NL002 1 NJS 1 Nizar 1 Niwa 1 Niu 1 Nitzsche 1 Nittala 1 Nitsos 1 nitrogen-containing 1 nitrite 1 nitration 1 nition 1 Nithianantharajah 1 Nistico 1 Nissl 1 Niss-brandt 1 Nishizawa 1 Nishishinbashi 1 Nishinomiya 1 Nishino 1 Nishimori 1 Nishigaki 1 NIS-Elements 1 NISC 1 NIS 1 NIR-R 1 Nirdosh 1 Ninety-four 1 Nindl 1 NINCDS-ADRDA 1 Ninan 1 Nimmo8 1 NilssonE 1 Nilsen 1 Nilf 1 Niland 1 Niks 1 Nikolsky 1 Nikolova 1 Nikolov 1 Nikolics 1 Nikolaras 1 Nikolajsen 1 Nikitin 1 Nikbakht 1 Nijs 1 NIH-NIA 1 nihilism 1 NIH-funded 1 NIH5R01AI31036 1 nigrostriatal-projecting 1 nigraregional 1 Nigraland 1 nigrain 1 Nigita 1 nights 1 Nigel 1 Niewoehner 1 Niewerth 1 Niessner 1 Niess 1 Nierenberg 1 Niemeyer 1 Niels 1 Nielens 1 Niehans 1 Niedermeier 1 Niederkorn 1 Niederhagen 1 Nie 1 Nidorf 1 NIDDK 1 Nidd 1 NIDCR 1 NIDA 1 NicoteraP 1 Nicotera 1 NICOR 1 Nicole 1 Nicolantonio 1 Nicodemus 1 nicking 1 Nicke 1 Nicholl 1 Nichol 1 Nichlos 1 NICHD 1 nicemedia 1 NICE16 1 Nicassio 1 Nicaretta 1 NicAlert 1 nica 1 NIB 1 niacin 1 NIAAA 1 N-hydro-succinimidyl 1 NHSFoundation 1 NHR-8 1 NHR-49-dependent 1 nhpco 1 NHGRI 1 nhanes03 1 nguez 1 NFTs 1 NF-kBto 1 NF-kBtargets 1 NF-kBtarget 1 NF-kBsignal 1 NF-kBinhibitors 1 NF-kBin 1 NF-kBfamily 1 Nfkb2 1 Nfkb1 1 NF-kappab-regulated 1 NFkappaB-regulated 1 NF-kappaB-independent 1 NF-kappaBand 1 NFkappaB 1 NFHL5 1 NF1 1 Neyns 1 Neyen 1 nexus 1 next-highest 1 Newsl 1 Newmark2 1 NewmanJD 1 newGreek 1 New-generation 1 newfamily 1 Newer-generation 1 Newell1 1 Newcombe 1 Newcastle-on-Tyne 1 New-castle 1 Newbower 1 Nevitt 1 nevirapine 1 Neville-Webbe 1 Neveu 1 Never-theless 1 Never-ill 1 Nevadawere 1 neutropenic 1 neutralized 1 neutralize 1 Neustadt 1 neuro-visceral 1 Neurourol 1 neurotrophy 1 neurotrans-mission 1 NeuroTrace 1 Neurotoxicology 1 Neurotoxicol 1 neurotox-icity 1 Neurotox 1 Neurotherapeutics 1 Neurother 1 Neurotech 1 Neu-rosurgery 1 neuro-surgery 1 neurostimulation 1 Neurosteroidogenesis 1 NeuroSpin 1 neuro-sensory 1 neuroscientists 1 neuroscientific 1 Neurore-habil 1 Neuroreha-bil 1 neuroradiologists 1 neuro-radiological 1 Neu-ropsychopharmacology 1 Neuropsychopharma-cology 1 neuro-psychological 1 Neuropsy-chiatry 1 neuropsy-chiatric 1 Neuropsiquiatr 1 neuroprotectivecompound 1 Neuro-protective 1 neuroprotec-tive 1 neu-roprotection 1 neuro-protection 1 neuroprotectants 1 neuropil 1 neurophysiologically 1 Neuropeptide 1 Neuropedia-trics 1 neuropath-ological 1 neuropatho-logical 1 neuropathologic 1 neurooutcome 1 Neurooncology 1 neurooncologic 1 Neuro-Oncol 1 Neurontin 1 neuronstriggers 1 neuronsof 1 neuronsis 1 neuronsincholesterol 1 neuronsin 1 neuronsand 1 neuronsaccumulate 1 neu-rons 1 Neuron-microglia 1 neuron-containing 1 neuronalmitochondria 1 neuronalloss 1 neuronal-glial 1 neuronalcells 1 Neuron79 1 Neu-ron 1 neuromye-litis 1 Neuromorphometric 1 neuromorphological 1 Neuromolecular 1 Neuromodules 1 neuromodule 1 neuromodulators 1 neuro-mas 1 Neurologico 1 neuroleptic 1 Neuroinformatics 1 Neuroinform 1 neuro-inflammatory 1 neuroimaging-based 1 Neuro-image 1 neurohypophyseal 1 Neurohormonal 1 neuroglia 1 Neurogenetics11 1 neurogenetic 1 neurogenesisin 1 neurogenerative 1 neuroenergetic 1 Neuroendocrinology 1 Neuroendocrinol 1 neuro-degenerative 1 neurodegen-erative 1 neurodegenerations 1 neurode 1 NEUROD4 1 neuro-critical 1 Neurocircuitry 1 Neurociencias 1 Neurochemistry 1 Neurocentro 1 neuroblas-toma 1 neuro-anatomy 1 neuroanatomic 1 Neuroanaesthesia 1 Neuroactivesteroids 1 NEURL 1 neuritic 1 neuregulin 1 neural-tube 1 neurally-derived 1 neuralcorrelates 1 neura 1 Neumeister 1 Neuland 1 NEUGENE 1 Neugebauer 1 Neuendorf 1 Neuenahr-Ahrweiler 1 Neubrandenburg 1 Neubauer 1 network-based 1 ne-tuning 1 netspace 1 Netrins 1 N-ethylmaleimide-sensitive 1 N-ethyl 1 netball 1 NESUG 1 Nestoriuc 1 Nestler 1 Nesslinger 1 nesses 1 nesL 1 Neske 1 Nesbitt 1 nervoussystem 1 Nervenheilk 1 Nerlekar 1 Nepsilon 1 Nephrol2013 1 nephrogenic 1 nephrectomy 1 neovessel 1 neostriatum 1 neostigmine 1 neonatology 1 neonatalcardiac 1 neo-natal 1 neomorphic 1 neointima 1 neogenin 1 neocortices 1 neocortex 1 Neo 1 Nenadic 1 Nemoto 1 Nemet 1 Nemesure 1 nem-atodes 1 nematodeCaenorhabditis 1 nella 1 nell 1 Nelissen 1 Nekolla 1 Nekhaeva 1 NEJMoa0810118 1 Nejima 1 Neji 1 neighbourhoods 1 neighbor 1 Neich 1 Nehm 1 negotiate 1 Negoro 1 negligent 1 Neglecting 1 neglected 1 Negi 1 negative-going 1 nega-tive 1 negation 1 negating 1 Nefrologia 1 Nee-man 1 Neely 1 Neel 1 needle-to-nerve 1 Needless 1 needleless 1 needle-exchange 1 nedsoverview 1 Nedospasov 1 necrotising 1 NE-containing 1 neatly 1 near-term 1 near-maximal 1 near-lethal 1 near-IR 1 Nearinfrared 1 near-full-length 1 near-complete 1 NE1 1 nding 1 N-dimethylformamide 1 NDI 1 nder 1 NCXs 1 NCX3-mediated 1 NCT02037633 1 NCT01881503 1 NCT01661777 1 NCT01312038 1 NCT01303640 1 NCT00344968 1 NCT00168389 1 NCT00168337 1 NCRR 1 NCMIS 1 NCI-H1299 1 NCI-Frederick 1 NCIC 1 NCCLS 1 NCATS 1 NCAA 1 NC3Rs 1 NBG 1 nberg 1 nb4 1 Nazir 1 nazionale 1 Naylor 1 Nawrot 1 Nawaz 1 Navratilova 1 navigator-triggered 1 Navigator 1 navigation 1 navigate 1 Naveilhan 1 Naveen 1 Navascues 1 Navarro-Alarcon 1 Navarro 1 Navarra 1 Navarese 1 Nav1 1 Naumann 1 Nault 1 Nauheim 1 Naugle 1 Nauck 1 nature-nurture 1 Nature404 1 naturalness 1 naturalistic 1 natural-cycle 1 natriuretic 1 Natri 1 native-PAGE 1 native-like 1 nationalpainreport 1 NationalFindings 1 National-Eye- 1 Nationale 1 nating 1 Naticks 1 Nathke 1 Nathans 1 Nath 1 Natarajan 1 natalizumab 1 NATA 1 Nassogne 1 Nasser 1 Nass 1 Nasr 1 nasopharynx 1 Nasopharyngitis 1 nasogastric 1 Nasir 1 Nash-Barboza 1 Naseem 1 NA-SAL-RNAs 1 narrow-band 1 narrow-age 1 narratives 1 narrative19 1 Narli 1 Narici 1 Nargund 1 nardilysin 1 Nardi 1 Narcotrend 1 narcissistic 1 Narasimha-Iyer 1 NarasimhaIyer 1 Narain 1 NAPs 1 napped 1 Napa 1 NAP5-Ireland 1 NAP4 1 NAP3 1 Naoyuki 1 Naoki 1 Nantes 1 nanostructure 1 nanoString-based 1 nanoparticles 1 nanometer 1 Nanobody-labeling 1 Nanobody-based 1 Nanobiosci 1 nano-and 1 Nannuru 1 Nankivell 1 Nandi 1 Nandgiri 1 Nanchahal 1 namsdl 1 Namiot 1 namegivers 1 Nambiar 1 naltrex-one 1 naltrexone 1 naloxone-on-release 1 Nalls 1 N-ALIVE 1 Nalini 1 Naldini 1 Naldi 1 naked 1 Nakayama 1 Nakatake 1 Nakashiro 1 Nakao 1 Nakani-shi 1 Naka-mura 1 Nakamoto 1 Nakahara 1 Nakagawaet 1 Nakabayashi 1 Naji 1 naissance 1 NAION 1 Naik 1 Naidoo 1 Nahmias 1 NaH2PO4 1 Nagy 1 Nagoya 1 Naghavi 1 Nagendran 1 Nagdev 1 Nagata 1 Nagasawa 1 Nagarajan 1 Nagarajah 1 Nagar 1 Nagano 1 Nagamitsu 1 Nag 1 nafive 1 NAF1 1 Naeini 1 Naef 1 Nadu 1 NADP 1 Nadon 1 Nadler 1 NADH 1 Nader 1 Nadaud 1 Nadaj-Pakleza 1 Nadachi 1 Naclerio 1 Nachreiner 1 Nachmany 1 nach 1 N-ace-tyl-L-cysteine 1 N-acetyl 1 NABTT 1 NABTC 1 Nabel 1 NaB 1 NAA 1 n-6 1 N3S 1 n3p 1 N39 1 n-3 1 N2S2 1 N2-bis-tert-butyloxycarbonyl 1 n1T 1 -N1-hMOG 1 N1b 1 N17 1 -N 1 myxofibrosarcomas 1 Myung 1 Mythen 1 Mysliwiec 1 myself 1 Myrna 1 Myrand 1 Myoung 1 myotoxic 1 myosin 1 myopic 1 myophosporylase 1 myophosphorylase-positive 1 myopho-sphorylase-expressing 1 myopho-sphorylase-deficient 1 myo-phosphorylase 1 Myongsoo 1 Myology 1 Myol 1 myokine 1 myokinase 1 myo-inositol 1 myoglobin 1 myofibrillar 1 myofascial 1 myocytes 1 myo-cardial 1 myocar-dial 1 myoblasts 1 Mylonakis 1 Myklebust 1 MyersJ 1 myelosuppressed 1 Myeloperoxidase-mediated 1 myelopathy 1 Myelin-oligodendrocyte 1 myelino-genic 1 myelinisation 1 myelination 1 Myc-induced 1 MVCs 1 MVAs 1 m-value 1 Muzny 1 Muzikansky 1 mutual 1 Mutua 1 Mutter 1 mutism 1 Muti 1 Mutch 1 mutation-type 1 mutation-specific 1 muta-tions 1 muta-tion 1 mutate 1 Mutant-p53 1 mutantof 1 mutantKRAS 1 mutanthSNCA140 1 mutagenic 1 Mutagenesis28 1 Mustarde 1 Mustafovic 1 Mustafa 1 Musselman 1 Musonda 1 musician 1 musica 1 music 1 Mushtaque 1 Musha 1 Musette 1 musculoskeleton 1 musculo-skeletal 1 Musculoskelet 1 Musculoskel 1 musculocutaneous 1 MuscleLab 1 Muscella 1 Muscatine 1 Muscaritoli 1 Musallam 1 Murtha 1 Murrough 1 MURR 1 Murphree 1 Murney 1 Murinson 1 MurinePrP-driven 1 Murgo 1 Murgia 1 Murgatroyd 1 Murga 1 Murchison 1 Muramatsu 1 Murali 1 Murai 1 Mupapa 1 mu-opioid 1 muopioid 1 Muntane 1 Munster 1 Munoz-Fernand 1 Munnikes 1 Munishk-ina 1 Muniappan 1 Mundorff 1 Munce 1 MunarrizE 1 Munakata 1 Mumby 1 Mumbai 1 Multi-variable 1 multi-valent 1 multiuser 1 multithreading 1 multitasking 1 Multisystemic 1 Multi-system 1 multisurface 1 multi-subject 1 multi-step 1 multistation 1 multistate 1 multistage 1 multi-sensory 1 multisensory 1 multisensorial 1 multiresolution 1 multiregion 1 multipower 1 multiply 1 multi-plied 1 multiple-response 1 multiple-fraction 1 multiple-channel 1 multiple-acquisition 1 multiphoton 1 multi-parametric 1 Multiparametric 1 multiparameter 1 multinucleation 1 multimorbidity 1 multimolecular 1 Multi-modal 1 multimethod 1 multilocular 1 multilayer 1 multi-infarct 1 Multi-Health 1 Multihance 1 multigenerational 1 multi-functional 1 multi-frame 1 multifocalvitelliform 1 multifeature 1 multifac-eted 1 multiexponential 1 multi-edge 1 multidrug-resistant 1 multidrug 1 multi-dose 1 multi-disciplinary 1 multidisciplinarity 1 multi-dimesional 1 multi-dimensional 1 multi-detectable 1 multiday 1 multicultural 1 Multi-component 1 multicollinearity 1 multicode 1 multicentered 1 multiarticular 1 multi-arm 1 multi-analyte 1 multiagent 1 multiacquisition 1 Multi 1 Mulnix2 1 MullikenJB 1 Muller-Madsen 1 Muller-Hocker 1 Muller-Bierl 1 Muller1 1 Mullen 1 Mullani 1 Mullan 1 Mulla 1 Mull 1 Mulin 1 Mulgrave 1 Mulan 1 Mulampaka 1 Mukundu 1 Mukesh 1 Mukaro 1 Mujika 1 Muiswinkel 1 Muhuri 1 Muhrer 1 Muhldorf 1 Muhaisen 1 Mughal 1 Mufloz 1 muffied 1 Muetzel 1 Muenter 1 Mueller-Brand 1 Muellbacher 1 Mudhar 1 Mudge 1 mucous-membrane-dominant 1 Muckersie 1 Mucida 1 MUC2 1 MTS 1 MTR 1 mTORpathway 1 mTOR-dependent 1 mTORC2 1 mTORC1 1 mTORand 1 MTMF 1 mtDNAcopy 1 mTagRFP-mWasabi-LC3 1 MSX2 1 MSX1 1 MSW 1 Msutta 1 MST-1 1 mssm 1 MS-SIM 1 MSP 1 MSi 1 MS-grade 1 MS-F74 1 MSEd 1 MSE 1 MS-CSA 1 MSCs 1 MSCR 1 MSCE 1 MScCH 1 msard 1 MSA02 1 MS413 1 M-S 1 Mrowietz 1 MROncoTreat 1 mRNAexport 1 MRJ 1 MRIs 1 MRI-phenotypes 1 MRI--guided 1 MRI-guided 1 MRI-defined 1 MR-guided 1 mRECIST 1 MREC 1 MRE11-Rad51-NSB 1 MRE00 1 MRCOphth 1 MR-compatible 1 mrc-bsu 1 MR-assisted 1 Mrak 1 MR-021 1 MR- 1 MQHQRQQQED-HANEANYARGTRKC 1 MQ280 1 MPTP-treated-only 1 MPNSTs 1 MPM 1 MPLA 1 MPH2 1 mpencina 1 MPA 1 MP07525 1 Moysidou 1 Moyna 1 Moyes 1 Moye-Rowley 1 moxi-cillin-clavulanate 1 Mowat 1 Movafagh 1 Mouzopoulos 1 Mouth-twitch 1 mouthpiece 1 Moustafa 1 Moussai 1 mousePrP 1 mouse-operated 1 mouse-human 1 Mourtzakis 1 Mourier 1 Mourelatos 1 Moure-Gonzalez 1 Mourcin 1 Mourad 1 Moura 1 Mountjoy 1 Mounsey 1 Moulton 1 Moudon 1 Mouchiroudet 1 Mouatt-Prigent 1 Motzko 1 Motycka 1 Mottaghy 1 Motov 1 Motoshima 1 motorsymptoms 1 motorskill 1 motors 1 motorproteins 1 motor-incomplete 1 motor-driven 1 motorcyclist 1 motorcontrol 1 MotorBehavior 1 motoneurones 1 motoneurone 1 Motoko 1 Motoi 1 motives 1 motive 1 motion-transformation 1 Motifmodule 1 Motek 1 Mota-Vieira 1 Motamed 1 Mot 1 Mosso 1 Mossner 1 Mossiat 1 Mosquera-Valderrama 1 Mosoni 1 Moskovits 1 Moshfeghi 1 Moshfegh 1 Moshe 1 Moshaver 1 Moshakis 1 Moset 1 Moser 1 Mosenthin 1 Moscow 1 mosaicusing 1 mosaicking 1 mosaicadjacent 1 Mortrud 1 Mortelmans 1 Mortazavi 1 mortalityamong 1 mortal-ity 1 mortalities 1 Morson 1 Morrone 1 Mor-ris 1 Morren 1 Mor-phometry 1 morphometrical 1 mor-phometric 1 morpholino 1 morphogenic 1 Morphogenesis 1 mor-phine- 1 Moroccan 1 Mormeneo 1 Morlock 1 Moriyama 1 Moriwaki 1 Morita 1 Morison 1 Moris 1 Morire 1 Morio 1 Morieux 1 Morier 1 Moric 1 moribund 1 Moriarty 1 Morgenthaler 1 Morganstein 1 Morgadinho 1 morework 1 moretraditional 1 more-severe 1 Moresco 1 Morera 1 Morein-depth 1 more-favourable 1 Moreau 1 more- 1 Morden 1 morbidity9 1 morbi-dities 1 Moray 1 Moravec 1 Morau 1 Morari 1 Morar 1 morale 1 Morakis 1 Mora-Jensen 1 moraic 1 Moraes 1 MOPS 1 MOP-93713 1 MOP201257 1 Mootha 1 Moosmang 1 Moosbrugger 1 Moorman-Li 1 Moorin 1 Moorhead 1 Moorfields 1 moonwk 1 moods 1 mood-regulating 1 mood-enhancing 1 Monz 1 Mon-Williams 1 Montville 1 Montserrat 1 Montre 1 Montr 1 Montori 1 Montimurro 1 monthsto12years 1 Montfrans 1 Montfoort 1 Montezano 1 Montez 1 Montero 1 Montelpare 1 Monteiro 1 Mont-Blanc 1 Montanes 1 Montagner 1 Montagna 1 montaging 1 montages 1 montaged 1 Monta 1 Mont 1 Monsma 1 Monsellato 1 Monsell 1 Monroe 1 monozygosity 1 monoxide 1 monotony 1 monotonically 1 monopulse 1 monopolar 1 monophos-phate-dependent 1 monophasic 1 mono-nuclear 1 monomolecular 1 monomeric 1 monoiodinated 1 monohydrate 1 monograph 1 Monogr 1 monocytosis 1 monocyte- 1 monocenter 1 monoamines 1 Monnier 1 Monnet 1 Monique 1 Monika 1 Mongioj 1 monet 1 Mondini 1 Monden 1 Monaghan 1 MOMS-B 1 Momose 1 Momi 1 Momenta 1 Momeni 1 Molyneux 1 Molyneaux 1 Molr 1 Molna 1 Molly 1 Molls 1 Molloy 1 Molitoris 1 Molinaro-Clark 1 Molier 1 Molgaard 1 Moleculaire 1 mole 1 Moldauer 1 Molchadsky 1 molars 1 Mokkink 1 Moke 1 Mokdad 1 Moizard 1 moisture 1 Moisset 1 Moisan 1 Moilanen 1 Mohy-ud-Din 1 Mohsin 1 Mohrmann 1 Mohn 1 Mohit 1 Mohindra1 1 Mohindra 1 mohbgt 1 Mohapatra 1 Mohangoo 1 Mohand-Said 1 Mohan 1 Mohammadi 1 Mohammad-Asef 1 Mohamdee 1 moh 1 mographic 1 Mogil 1 Moghaddam 1 MOG-EGFP 1 Moffat 1 mofetil-treated 1 Moens 1 Moeller 1 modulations 1 modulationof 1 Modula-tion 1 modulatethe 1 Modo 1 modifier 1 modifiedA 1 modificationof 1 modestly 1 Modernity 1 moderators 1 moderator 1 moderating 1 moderate-to-good 1 modeling-based 1 modelal 1 Modarressi 1 Modality-specific 1 modality-and 1 Mod 1 Mobily 1 mobility-aid 1 mobilises 1 mobilisation 1 Moat 1 MO63110 1 Mn-SOD 1 MNP16 1 mnemonic 1 MMP-9 1 MMP9 1 MMP-8 1 MMP-1 1 mmin 1 mmi-micro 1 MMI 1 mme25 1 mm-1 1 MLT3813H-V 1 MLT0699 1 MLPA 1 MLM 1 MLIS 1 Mletzko 1 MLC 1 MLA 1 M-L 1 mkj 1 MK-0974 1 Mjsund 1 MJK 1 Mjartan 1 Mizutaet 1 Mizukami 1 Mizrahi 1 Miyazono 1 Miyati 1 Miyatake 1 Miyanaga 1 Miyakuni 1 Miyakawa 1 Miyaji 1 Miyai 1 Miyabi 1 Mixte 1 mixed-land 1 mixed-homotypic 1 mix-adjusted 1 miu-1 1 Mitton 1 Mittendorf 1 Mitsumoto 1 Mitsiades 1 mitral 1 Mitra 1 Mitooka 1 mitomycin 1 MitomiRs 1 mitofusin2 1 mitocondriale 1 mitochondria-targeted 1 mitochondriaover 1 mitochondria-driven 1 mitochondria-dependent 1 Mitkus 1 Mititelu 1 Mitigation 1 Mitera 1 Miteff 1 MiSun 1 Mistura 1 mistook 1 Mistl 1 mistargeting 1 mistaking 1 mistaken 1 mistake 1 Missotten 1 missions 1 misses 1 misrepresented 1 misreport 1 misremembered 1 misnomer 1 mislocalization 1 Miska 1 misjudging 1 misinterpreting 1 misincorporation 1 Mishima 1 misguides 1 misguided 1 misdiagnosed 1 misconstruing 1 miscoded 1 misclassifications 1 Mischel 1 miscarriage 1 miscalculated 1 misbranding 1 misalignments 1 misalignment 1 miR-seq 1 mirroring 1 mirPremier 1 miRNA-mediated 1 miRNA-410 1 miRNA-146a-mediated 1 MIRenvironment 1 MiR-based 1 miRan-dola 1 MiRandola 1 Mirand 1 MIRAGE 1 Mira 1 miR-92a 1 miR-80null 1 miR-766 1 mir-663 1 miR-574 1 miR-522 1 miR-513 1 miR-494 1 miR-451 1 miR-34suppressed 1 miR34a 1 miR-33 1 miR-328 1 miR-324-5p 1 miR-320d 1 miR-30 1 miR-29is 1 miR-29b 1 miR29a 1 miR-27a 1 miR-239a 1 miR-224 1 miR223 1 miR-222 1 miR-21were 1 miR-219 1 miR-218 1 miR-20a 1 miR-203 1 mir-200 1 miR-193b 1 miR-18a 1 miR-181a 1 MiR-181 1 mir16 1 miR-150 1 mir15 1 miR-149 1 miR-135b-target 1 miR-135binCRCmouse 1 miR-135bin 1 miR-135b-AMO-treated 1 miR135b-AMO 1 mir135b 1 miR-135 1 miR-130b-ZEB1 1 miR-106a 1 MIP-1b 1 MIP-1a 1 minutesyto 1 minus1 1 Mintz 1 Mintorovitch 1 Minton 1 Minthorn 1 mint 1 minorlacerations 1 Minocycline 1 Mino 1 Minno 1 Minni 1 Minneci 1 Minkowski 1 Minkler 1 Minkel 1 Mink 1 Minjarez 1 Ministero 1 Ministere 1 Ministde 1 minipump 1 minimum-frame-duration 1 minimising 1 minimised 1 Minimally- 1 mini-invasive 1 mini-connectome 1 minichromosome 1 Minich 1 Mingarelli 1 Ming 1 minerals 1 mineralization 1 Mineo 1 Minematsu 1 mined 1 Mindy 1 minding 1 mindfulness-based 1 mind-body 1 mind-altering 1 Minchin 1 minced 1 Minami 1 Minagawa-Kawai 1 Minabe 1 Mina 1 Mimura 1 Mimouni 1 mimicked 1 Mimee 1 MIM 1 Milwau-kee 1 Miltefosine 1 Milstone 1 Milpitas 1 Milosevic 1 Milos 1 Milne 1 Mill-wood 1 Mill-ward 1 millstones 1 Millington-Ward 1 millimeters 1 millimeter 1 milliliter 1 Millikan 1 Millhauser 1 MillerG 1 Milleret 1 MillerCA 1 Mille 1 Militello 1 milie 1 Milford 1 Milewski 1 milestones-based 1 mild-severe 1 Milbury 1 Milburn 1 Milbank 1 Milanovic 1 Mil 1 Mikrosk 1 Miklosi 1 Miklea 1 Mikhail 1 Mikasova 1 Mikami 1 Mik 1 Mijnhout 1 Mihok 1 Miguel 1 migratory 1 migrating 1 migrates 1 migrant 1 migrainous 1 Miglioretti 1 mightprotect 1 Mieghem 1 Miedany 1 mid-zone 1 mid-treatment 1 mid-to-previous 1 midterm 1 mid-rectal 1 mid-point 1 midpoint 1 mid-phase 1 mid-peripheral 1 midluteal 1 Midlands 1 midlabor 1 Midha 1 midfemoral 1 Middlesex 1 middles 1 middlepanel 1 middle-income 1 middle-frontal 1 Middle-ear 1 middle-class 1 middle-age 1 Middelkoop 1 midcingulate 1 midbraindopamine 1 mid-brain 1 mid-axillary 1 Mid-Atlantic 1 mid2000s 1 mid-1990 1 mid-1980s 1 mid-1970s 1 microwick 1 microvillus 1 microvesicles 1 microtubule-associated 1 microtubule 1 microtomists 1 micro-tome 1 microtome 1 Microtest 1 Microsystems 1 microsyringe 1 Micro-structural 1 microsphere-based 1 mi-croscopy 1 microscopists 1 Microscopicscleral 1 micro-scopically 1 micro-scope 1 micro-satellite 1 microRNAsas 1 MicroRNAs181 1 microRNAome 1 MicroRNA-mediated 1 MicroRNA-dependent 1 microRNAclusters 1 microRNA-9-3 1 microRNA-410 1 Micro-RNA-34a 1 microRNA-27a 1 microRNA-221 1 microRNA-21-dependent 1 microRNA-205 1 microRNA-19 1 MicroRNA-18 1 microRNA-155 1 MicroRNA-135b 1 microRNA-1296 1 MicroRNA-10A 1 microR-NA 1 Microplex 1 micro-PET 1 microperimetric 1 microperfusion 1 micropathology 1 microorganisms 1 micrometer-thick 1 micro-metastases 1 Micromedics 1 microlaryngoscopy 1 microinjuries 1 micrograph 1 micrograms 1 microglobulin 1 microgliosis 1 Microglia-Muller 1 microglia-mediated 1 Microglia-inhibiting 1 Microgate 1 microg 1 Microenviron 1 micro-dystrophin 1 microdrop 1 microdosimetry 1 microdose 1 microdissectates 1 microdissect 1 microdialysis 1 Microdebrider 1 microcystin 1 microcomputers 1 micro-computed 1 microcirculatory 1 microcirculations 1 micro-circulation 1 micro-circuital 1 microcephaly 1 microcentrifuge 1 microcalcification 1 microarray-as 1 microangiopathic 1 micro-angiography 1 Micrel 1 Mickelson 1 Mickel 1 MICINN 1 Michurina 1 Michels 1 Michellet 1 Michelle 1 Michell 1 Michalovitz 1 Michal 1 Michaelsen 1 Michaelis 1 Micha 1 miceoverexpressing 1 miceexhibited 1 miceat4weeks 1 MICCAI 1 Micanovic 1 mica 1 Mibu 1 Miazgowski 1 Miao2 1 Miall 1 MHSc 1 MHPH 1 MHPE 1 MHN 1 MHC-mismatched 1 MHCM 1 MHCII 1 MH086498 1 MGMT-methylated 1 mGluR6 1 mGluR1alpha 1 mgleeson 1 MGE 1 MGB 1 Mfn 1 MFL 1 MFH 1 Mezrich 1 Meyer-Ter-Vehn 1 Meyerson 1 Mey 1 MEXPRE 1 mevatt 1 MeV 1 Meuth 1 Meuret 1 Meulib 1 Meuer 1 Meucci 1 Metzner 1 Metzinger 1 Metzger 1 Metz 1 MET-weighted 1 metro 1 metrizamide 1 metoprolol 1 meticulously 1 methylspiperone 1 methylphenidate 1 methylome 1 methylguanine-DNA 1 methyl-group 1 Methylfolate 1 meth-ylenetetrahydrofolate 1 methylenetetrahydro-folate 1 methyl-deficient 1 methylcobalamin 1 methylator 1 methylation-speci 1 methy 1 Methoxamine 1 MethodsMol 1 method-dependent 1 method27 1 method14 1 Methner 1 methionine-choline-deficient 1 Methemoglobin 1 methamphetamine 1 methadone 1 methacrylate-based 1 methacrylate 1 methacholine 1 Metcalf 1 METC 1 metathoracic 1 meta-tarsophalangeal 1 metatarsophalan-geal 1 metatarsophalangeal 1 METASTROKE 1 metastasis-specific 1 metastasise 1 metas-tasis 1 Metas-tases 1 metaplasticity 1 metaplasia 1 metaphysic 1 metaphors 1 metaphor 1 metaphase 1 metamorphopsia 1 Metalyser 1 metal-sulfate-stressed 1 metalsand 1 metal-rich 1 metallothioneins 1 metallothionein 1 metalloproteinase-9 1 metalloproteinase-13 1 metallopeptides 1 metallopeptide 1 Metallomics 1 metallization 1 metal-cyclized 1 Metafisica 1 META-EYE 1 metaboreceptors 1 metabolizes 1 meta-bolism 1 metabolic- 1 meta-arsenite 1 meta-analytical 1 meta-analysisis 1 Metaanalyses 1 Mesulam 1 Mestric 1 Messinger 1 Messina 1 Messerer 1 Messe 1 messages 1 Messa 1 mesothoracic 1 mesorectum 1 Mesopic 1 mesodiencephalic 1 mesocortical 1 mesiotemporal 1 mesial 1 meshes 1 mesenteric 1 mesendodermal 1 mesencephalotomy 1 mesencephalon 1 mesencephalic-diencephalic 1 Mescha 1 Mesbah 1 mesangial 1 MESA 1 MES 1 Merzenich 1 Merx 1 Merville 1 Mervaala 1 Merton 1 Mertens 1 Merry 1 Merriman 1 Merrill-Palmer 1 Merrihew 1 Merrick 1 Merriam 1 MERRF 1 Mermelstein 1 Merkle 1 meritorious 1 merited 1 Merin 1 Merikangas 1 Merigo 1 Merians 1 Merialdi 1 merging 1 merge 1 Merello 1 Mere-Enfant 1 Meredith 1 mercury 1 Mercurio 1 Mercken 1 Mercier 1 Merchant 1 Mercator 1 mercato-acetylglycylglycine 1 Mercado 1 Merati 1 mer 1 MEPs 1 meperidine-analog 1 Menzoian 1 ments 1 mentorship 1 mentor 1 mentioning 1 mentation 1 mentali 1 menstruation-type 1 menstruation 1 Mensing 1 menschlichen 1 Mensah 1 Menotti 1 menopausal 1 Menno 1 Menniti 1 Mennes 1 MennerickS 1 meningomyelo-cele 1 meningocele 1 meningitis 1 Meniel 1 Menghiniet 1 Mengede 1 menfrom 1 Menezes 1 Mendritzki 1 Mendoza-Lattes 1 Mendez 1 Mendenhall 1 Menassa 1 Menachem 1 men24 1 memt-soudiss 1 Memphis 1 mem-ory 1 memorised 1 memories 1 memorable 1 membre 1 membranous-debris 1 membrane-type 1 Mem-branes 1 memantine 1 Melucci 1 Meltzer-Brody 1 melts33 1 Melton 1 melt 1 Melsungen 1 Melov 1 mellitus-natural 1 Meller 1 Mell 1 Melki 1 Melkas 1 Melissa 1 Melis 1 Melinda 1 Meletti 1 Meleti 1 Melendez 1 Melckebeke 1 Melchitzky 1 Melberg 1 melanotic 1 melanotan 1 melanopsin 1 melanophores 1 Melanomcortin 1 Melanoma-Targeting 1 melanoma-targeted 1 melanoma-specific 1 melanomas 1 melanocytes 1 Melanin-targeted 1 melanins 1 Melamed-Frank 1 Melamed 1 MELADL 1 Mela 1 MEK1-2 1 MEK1 1 Mejia-Santana 1 Mejia 1 Meitinger 1 Meiselman 1 Meiningen 1 Meinel 1 Meijlink 1 Meibergdreef 1 Mehrotra 1 Mehran4 1 Mehraein 1 Mehilli 1 Meher 1 Mehdawy 1 Meguro 1 Meghji 1 Meghan 1 mega-study 1 MEGA2 1 MEFOPA 1 Meffre 1 MEF 1 Meeuse 1 Meeus 1 meetfull 1 Meerabux 1 Meer 1 Meel 1 Mee 1 Medzihradszky 1 Medves 1 meduniwien 1 medunigraz 1 medullo-blastoma 1 medullar 1 medulla 1 medtronic-pain-pump-blamed-for-14-deaths-8820647 1 med-peds 1 Medoc 1 medlineplus 1 MED-LINE 1 Medley 1 medium-term 1 medium-smooth 1 medium-size 1 medium-range 1 Medium- 1 MediTech 1 meditation-based 1 Medisoft 1 MEDISIP 1 mediotemporal 1 mediodorsal 1 Medina-Sanson 1 Medieterranean 1 Medicinals 1 medication-use 1 medicationsin 1 medication-naive 1 Medication-induced 1 Medicare-Medicaid-Coordination- 1 Medicare-Medicaid-Coordination 1 Medicare-and-Medicaid-Coordination 1 MedicalScience 1 medically-ill 1 medicaleducation 1 Medicale 1 medicalconditions 1 Medi-cal 1 Medicaid-insured 1 mediation 1 Medgraphic 1 medesh 1 Medeiros 1 meded-portal 1 Meddings 1 Meddham 1 mechanotransduction 1 mechanobullous 1 mechanismsand 1 MEC-CONSOLIDER 1 MEC 1 meatus 1 measures22 1 Measureof 1 measurementwas 1 measurementof 1 mea-surement 1 measureable 1 measure- 1 Mease 1 Meany 1 meaningthat 1 meanings 1 meaningfulness 1 mean-ingful 1 Meaney-Delman 1 Meagher 1 Meadows 1 Meacock 1 Me2 1 me- 1 MDz 1 MDT-15tm2182-DCT 1 MDT-15tm2182DCT 1 mdt-15p 1 mdt-15-independent 1 MDT-15-DKIXDCT 1 MDT-15-del 1 MDT-15-DCT 1 MDT-15-binding 1 MDM 1 mdanderson 1 MDA-MB-231 1 MD3 1 MD16 1 mcw 1 McVie 1 McVey 1 McTiernan 1 MC-T 1 MCs 1 MCR-Holland 1 McQuade 1 McPherson 1 MCP-1 1 McNaughtand 1 McNamara1 1 McNabb 1 McMullen 1 McMullanM 1 McMahon-Lacharite 1 MCLs 1 McLintock 1 McLaurin 1 mclapp3 1 MCL 1 McKnight 1 McKirdy 1 McKinley 1 McKinlay 1 McKeown 1 McKenzieDC 1 McKenney 1 McK-eith 1 McKeith 1 McKean-Cowdin 1 McKayet 1 McIntyre 1 McIntosh 1 McIntire 1 McInerney-Leo 1 McIlwain 1 McIlhinney 1 McGwin 1 McGuigan 1 McGuffey 1 McGraw 1 McGowan 1 McGovern 1 McGorty 1 McGlynn 1 McGlone 1 McGinty 1 McGinnity 1 McGinnis 1 McGhee 1 McGehee 1 McGeer 1 McGee 1 McGarrPL 1 McGahon 1 mcg 1 McFarlane-Anderson 1 McFarlane 1 McFarlandet 1 McFadyen 1 MCF7 1 MCF-10A 1 McEniery 1 McElduff 1 McDougall 1 McDonaldMV 1 McDevitt 1 McDaniel 1 McCulley 1 McCubrey 1 McCreary 1 McCoyT 1 McCowan 1 McConell 1 McClure 1 McCloskey 1 McCaulley 1 McCauley 1 McCarty 1 McCartney 1 McCarthyism 1 McCarter 1 McCarten 1 McCarron 1 McCarroll 1 McCargar 1 McCann 1 McCaig 1 McArdles 1 McAr-dle 1 McAr- 1 m-Calpain-mediated 1 McAGraw-Hill 1 MCA711 1 MCA 1 MC1-Rs 1 MC-1R 1 MC1 1 MBq-treated 1 MBH 1 MBChB 1 MBBS3 1 MBBS 1 mb55 1 Mazzulli 1 Mazzoletti 1 Mazzarol 1 Mazzaferro 1 Mazumdar 1 Mazo 1 Mazinani 1 Mazin 1 Mazer-Amirshahi 1 Mazer 1 Mazarakis 1 Maysuria 1 mayoclinic 1 maynotbe 1 Maynard 1 Maymon 1 Mayles 1 Mayeux 1 Maycock 1 mayalso 1 May7 1 May24 1 maximum-likelihood 1 maximizes 1 maximise 1 Maxil-lofacial 1 Maxil-lofac 1 maxillary 1 MaXC 1 Mavri 1 Mauron 1 Maurer-Karattup 1 Maund 1 Mauguiere 1 Maudsley 1 Matuszewski 1 Maturity-associated 1 Maturitas 1 matures 1 Maturen 1 maturation-selection 1 Mattsson 1 Mattson 1 Mattiuzzi 1 Mattiske 1 Matthijssens 1 Matthiessen 1 Matteson-Rusby 1 Mattes 1 mattered 1 Mattei 1 Matt 1 Matsuzaki 1 Matsuura 1 Matsubara 1 Matsota 1 matrix-mediated 1 Matos 1 mator 1 Mathieu 1 Mathiesen 1 Mather 1 mathematician 1 mathematic 1 Matheis 1 mates 1 Materwomen 1 maternal-newborn 1 maternal-infant 1 maternal-derived 1 Materiel 1 Matera 1 Mateo 1 Mateev 1 Mateer 1 mated 1 matchstick 1 Matchar 1 Mataet 1 Mat 1 masuokan 1 Masuda-Suzukake 1 Mastoparan 1 mastoids 1 mastoidectomy 1 mastoidcavity 1 masthead 1 Masters 1 masterpiece 1 Masterman 1 Massoud 1 Massone 1 Massingale 1 Massin 1 Massie 1 Masse 1 Massarelli 1 Massamba 1 massages 1 Massager 1 Masoudi 1 MASOCCO 1 Maslinski 1 Maslinska 1 masks 1 Masius-Olth 1 Masini 1 Masib 1 Mashiyama 1 Mashek 1 MASCOT 1 Mascheroni 1 Mascha 1 Masayuki 1 Masako 1 Masaki 1 Masakazu 1 Masahiro 1 Marzo 1 Marylou 1 Mary-Anne 1 Marxreiteret 1 Marx3 1 Marwick 1 Martz 1 Martucci 1 Martone 1 Martnez-Ordaz 1 Martland 1 Martinuzzi 1 Martinsson 1 Martins-Filho 1 Martin-Lagos 1 Martinez-Vicente 1 Martinez-Moller 1 Martinez-Molina 1 Martinez-Marcos 1 Martinez-M 1 Martinelli 1 Martina 1 Martim 1 Marthyn 1 Martha-Maria 1 Martha 1 Martfn-Oliva 1 Martasek 1 Marston 1 Marsit 1 Marseille 1 Marsden-Institute 1 Marsch 1 marry 1 marrows 1 marriages 1 Marret 1 Marras 1 Marquette 1 Marquart 1 Marquardt-Levenberg 1 Marquardt 1 Maroview 1 Marotta 1 Marosi 1 Maroon 1 Marmot 1 marmeni 1 Marlow 1 Marler 1 Marle 1 Marl 1 Mark-up 1 Markova 1 Markou 1 Markkula 1 Markivskyy 1 markings 1 Markert 1 Maritz 1 Mariotti 1 Marioni 1 Marion 1 Marin-Teva 1 Marinovich 1 Marinob 1 Marino 1 Marinkovich 1 Marini 1 Mariner 1 MARINA 1 Marik 1 Marig-nier 1 Marigliano 1 Mar-ienhospital 1 Marieke 1 Maric 1 Mariash 1 Marianna 1 Marhofer 1 Margulies 1 Margot 1 Margolis 1 margini 1 margin-free 1 margin-ally 1 marginalised 1 Margarson 1 Margalef 1 Marg 1 Marfany 1 Mardaye 1 Marcusson 1 Marcovitz 1 Marconcini 1 Marchman 1 Marchitelli 1 Marchand 1 March6 1 Marca 1 Marburg 1 Marato 1 Maranian 1 Marampon 1 MAPK-pathway 1 map-derived 1 Manzitti 1 Manzano 1 Manyonda 1 Manwaring 1 manufactures 1 manufac-turer 1 manufactured 1 manuals 1 Mantyla 1 Mantlik 1 mantle-cell 1 Mantha 1 mantains 1 Mansvelder 1 Mansmann 1 Manshouri 1 Manser 1 Manresa 1 Manos 1 Manola 1 Manoir 1 manoeuvreora 1 manoeuvreand 1 Mano 1 Mannuzza 1 Mannucci 1 mannitol 1 Manninger 1 Mannila 1 ManneWhitney 1 manners 1 Mannermaa 1 Manjunath 1 Manji 1 Manitoba 1 Manis 1 mani-festations 1 manifes 1 manic 1 Maniatis 1 Mani 1 Manhasset 1 Mangione 1 Manfredsson 1 Manfredi 1 Manes 1 Mandir 1 Mander 1 Mandell 1 Mandelker 1 Mandating 1 mandates 1 Mandarino 1 Manczak 1 Manchanda 1 Manassas 1 Managlia 1 manageable 1 Manach 1 Mamounas 1 mammosphere 1 mammographically 1 mammillary 1 mammaria 1 mammalians 1 mam-malian 1 Mamet 1 Mamada 1 Malyak 1 maltodextrin 1 malpractice 1 Malpositioning 1 Malpighi 1 Malone 1 malnourishment 1 Malmstr 1 Malmgren 1 Malliou 1 Mallin 1 malleoli 1 malleability 1 Mallams 1 Malkin 1 Malipiero 1 Malinova 1 Mali 1 malfunctioning 1 Malfait 1 maleyouth 1 Malewski 1 Maletz 1 male-to-male 1 male-to-female 1 Maletic 1 male-only 1 Malekafzali 1 maledue 1 Malcangio 1 Malavia 1 malati 1 malate 1 MALAT1specifically 1 MALAT1depletion 1 Malarkey 1 Malapaka 1 Malana 1 malacic 1 MAL 1 Makuc 1 Makshanoff 1 makrisalexandros 1 Makras 1 Makori 1 Makkat 1 Makito 1 Makinen 1 Maki 1 Makhlouf 1 maker 1 Makeig 1 Makary 1 Makariou 1 majoror 1 ma-jor 1 Majo 1 Majid 1 Maji 1 Majer 1 Maite 1 Maisch 1 Maira 1 maintenancepathways 1 mainte-nance 1 mainland 1 maining 1 maimer 1 Mailstop 1 mail-out 1 mailing 1 Mailhammer 1 Maierhofer 1 Maidstone 1 Maidment 1 Maia 1 Mahoney 1 Mahomed 1 Mahmoodi 1 Mahillo 1 Mahendroo 1 MahboubiA 1 Mahalanobis 1 Mahad 1 MAH-115445 1 Magotra 1 Magnuson 1 magnitude-reconstructed 1 magnified 1 Magnie 1 Magnevist 1 Magnetom 1 magnetoen-cephalographic 1 magnetoencephalographic 1 Magnetique 1 Magnes 1 Magliulo 1 Maglione 1 Magli 1 Magill 1 Magi 1 Magerko 1 magenta-green 1 Magen 1 Mageed 1 Magassouba 1 Maganaris 1 Magali 1 Magalhaees 1 Magalh 1 Maffulli 1 Maffioli 1 MAF-Based 1 Maet 1 Maessen 1 Maes 1 Maehara 1 Madrilena 1 Mador 1 Madole 1 Madjid 1 Madiona 1 Madhu 1 Mader 1 Madeira 1 Maddox 1 Maddever 1 Madden 1 Madaree 1 Madan 1 Madamanchi 1 Macy 1 mac-ulopathy 1 maculop-athy 1 macula-wide 1 macular-degeneration 1 maculardegen 1 mac-ular 1 maculae 1 Macuga 1 macroscopically 1 macroscalestudies 1 macro-phages 1 macrophage-derived 1 macronutrient 1 macromolecules 1 macrolide 1 macrodis-sected 1 macrodissected 1 Macrocyclics 1 Macpherson 1 MacPhee-Gray 1 Macovski 1 macologic 1 Macol 1 MacNab 1 MacMillan 1 MacMahon 1 MacLaren 1 Macko 1 Mackin 1 Mackey 1 Mackenbach 1 Mackeith 1 Mack-Burkhardt 1 Macintyre 1 Maciejewski 1 Macias 1 machine-based 1 Machin 1 Machado-Vieira 1 Mach 1 Macgillivray 1 MacG 1 MacFall 1 Macerata 1 Macek 1 Macedo 1 Macdougall 1 MacDermid 1 MacCoss 1 Maccio 1 Maccani 1 Macca 1 MacBook 1 Macaulay 1 Macaskill 1 MacArthur 1 macaques 1 Macaluso 1 Maca 1 MABVN1250 1 MAb377 1 MAb360 1 maastrichtuniversity 1 Maassen 1 Maass 1 Maani 1 Maa 1 MA1 1 M78 1 M75 1 M6 1 M5S 1 M5G 1 M50 1 M428Y37 1 m-2was-2 1 M23-AQP 1 M235T 1 M23 1 M1-M2 1 M16-6 1 M156 1 M146 1 M122 1 M116 1 M01 1 LYY 1 LyttonJ 1 Lytton 1 Lytle 1 lytic 1 lyspliced 1 Lysotracker 1 lysosomotropic 1 lysines 1 lysine-27 1 lysine16 1 Lysell 1 lyse 1 -Lys5-Nalpha-maleimido-Gly1-D-GEEEK 1 Lys3-Asp14 1 Lys2 1 Lyritis 1 Lyrica 1 Lynm 1 Lyng 1 lympho-vascular 1 lymphovascular 1 lymphoscintigraphy 1 Lymphology 1 lymphoid-restricted 1 lymphohistiocytic 1 lymphohemato-poietic 1 lymphoede-matous 1 lymphoedema-prone 1 lymphocytotoxicity 1 lympho-cytosis 1 lympho-cytic 1 Lymphocystic 1 lymphochip 1 lymphoblasts 1 LymphNodeBiopsy 1 lymph-node 1 Lymphedemaina 1 lymph-edema 1 Lymphat 1 lym-phangiogenesis 1 lymphangio-genesis 1 Lyle 1 Lyketsos 1 Lyerly4 1 Lydon-Rochelle 1 Lydiatt 1 Lydersen 1 Lycii 1 LXR-responsive 1 LXIX 1 LW 1 LVOTd2 1 LVOTd 1 Lvoff 1 Luypaert 1 LuuSH 1 Luukkonen 1 Luukinen 1 Lutwama 1 Luttin 1 Lutje 1 Luthman 1 Luther 1 Lutetium-177 1 lutetium 1 luteinizing 1 luteal 1 Lust 1 LuSS 1 Luscher 1 Lurz 1 Lunsford 1 Lunney 1 Lunn 1 LUNGTARGET 1 lung-protective 1 Lundqvist 1 Lundgren-Lindquist 1 Lundgaard 1 Lundblad 1 Lundbeck-TEVA 1 Lundbeck 1 Luna-Fineman 1 Luna 1 lumped-parameter 1 Lumley 1 lumc 1 Lum 1 Lukwiya 1 Lukiw 1 Lukic 1 lukerudmik 1 Luisa 1 Luigi 1 Lugano 1 Lue 1 Ludes-Meyers 1 Lucy 1 Lucotte 1 Lucock 1 lucky 1 Luckmann 1 Lucking 1 Luckenbaugh 1 Lucey 1 Lucchinetti 1 Lucchi 1 Luby 1 Lubbers 1 Luan 1 ltrating 1 LSO-LYSO 1 lsmeansLudlow 1 LSI 1 L-shaped 1 Lsh 1 LSAS 1 LRR 1 LRI 1 lrb 1 LPS-induced 1 LPO-586 1 LPL 1 lozenges 1 Loz-ano 1 low-titer 1 low-skill 1 lowrisk 1 low-resolution 1 low-power 1 low-poverty 1 Low-plasma 1 low-oxygen 1 low-or 1 low-molecular-weight 1 low-moderate 1 lowly 1 low-inflammation 1 low-functioning 1 low-fat 1 lowest-volume 1 lowest-cost 1 Lowes 1 LowerSuper 1 lower-quality 1 lower-order 1 lower-middle 1 lower-lip 1 lower-limb 1 loweringits 1 lower-extremity 1 lower- 1 Lowenthal 1 Lowen 1 lowed 1 low-current 1 low-carbohydrate 1 lowback 1 low-abundance 1 low- 1 Lovren 1 Lovisa 1 Loving 1 Lovett 1 Lovering 1 Loveland 1 Lovati 1 Louro 1 Loureno 1 Lourenco 1 Lourari 1 Louise 1 loudness 1 loud 1 Lotz 1 Lottin 1 Lott 1 Lotstein 1 lots 1 Lotrich 1 Lothians 1 Lotarski 1 loss-mediated 1 lossless 1 lossand 1 Losman 1 Losina 1 Losek 1 LoseeJE 1 Loriot 1 Lorini 1 Lorimier 1 Loreto 1 LORETA 1 Lorenzoni 1 Lorenzi 1 Lorentzon 1 Lorentzian 1 Lorch 1 Lopotko 1 Lophathanon 1 Lopez-Martinez 1 Lopez-Garcia 1 LopesTC 1 Lopes 1 loosening 1 Looney 1 lookyto 1 Lookout 1 Lonneux 1 Lonn 1 Longwood 1 long-unreported 1 Longton 1 long-run 1 long-range 1 long-living 1 longlived 1 longevitythrough 1 longevity-promoting 1 LongevityMap 1 longevityconfirmed 1 longevityand 1 longevity-aging 1 Longev 1 long-established 1 Longerich 1 longer-duration 1 longer-distance 1 longer-acting 1 long-chain 1 long-been 1 long-axis 1 long-anticipated 1 Londy 1 Londos 1 LondonWC2A3LY 1 Lommel 1 lomeric 1 Lombardo 1 Lombardino 1 Lombard 1 Lomba 1 Loken 1 Loizou 1 Lois 1 Lohr 1 Lohmann-Hedrich 1 Loher 1 log-transformation 1 logs 1 Logop 1 logo 1 log-normal 1 lognormal 1 logMAR 1 log-link 1 log-linear 1 logistics 1 logistic-regression 1 Loging 1 logically 1 logica 1 Loggia 1 logged 1 logelog 1 Loge 1 logarithmic 1 Log-28 1 Lofgren 1 Loeys 1 Loewith 1 Loewen-stein 1 Loewenstein 1 Loewen 1 Loeser 1 Loepke 1 Loehrs 1 Loeffler 1 Loeb 1 Lodhi 1 Lodewick 1 locusin 1 locuscontributing 1 locus11 1 Locuratolo 1 locomotoractivity 1 locomotive 1 locomoter 1 lockout 1 Lockhart 1 lock-and-key 1 locifor 1 Lochmuller 1 Locati 1 locates 1 Locatelli 1 Locas-cio 1 localizers 1 localization-dependent 1 localisation 1 LOC387715 1 lobulated 1 lobotomy 1 Lober 1 Lobenhofer 1 lobemediated 1 lobbied 1 Lobban 1 Lobato 1 loathing 1 load-induced 1 ln-Hohenlind 1 lncRNAsmay 1 LNCaP 1 LNA-miR-29 1 LNA-control 1 LNA-anti-miR-135b 1 LMNAgene 1 LMMSE 1 lmezoglu 1 lme4 1 Llu 1 llt 1 Lloyd-Jones 1 Llorente 1 Llobregat 1 llner 1 lliaca 1 ller-Tidow 1 LLB 1 llamas 1 LKR13 1 lkopf 1 LKB 1 Ljungqvist 1 Ljubicic 1 Lizbeth 1 Liz 1 Liyanarachchi 1 Living-stone 1 Livingston 1 livinglonger 1 liveda 1 Liu2 1 Litwin 1 Litvan 1 Littman 1 LiTJ 1 Liting 1 Lithium-induced 1 Lithgow 1 literaturein 1 literature1 1 Literatura 1 liter 1 listserv 1 Lister 1 listened 1 Liss 1 Lisiecka 1 Lisette 1 LIRYC 1 Liroff 1 liquor 1 liquid-ordered 1 liquefacting 1 Lipska 1 Lipshitz 1 Lipsett 1 Lippold 1 Lippman 1 Lippincott-Schwartz 1 LippiG 1 lippantonio 1 Lipp 1 liposarcomas 1 lipoproteinmetabolism 1 lipoproteincholesterol 1 lipoproteinand 1 li-poprotein 1 Lipomics 1 lipolysis 1 lipoidal 1 lipoic 1 lipofuscin-rich 1 lipofuscinoses 1 lipofuscin-laden 1 lipofuscingranules 1 lipofuscin-accumu-lating 1 Lipofectamine 1 Lipkus 1 lipiodol 1 lipid-related 1 lipidpro 1 Lipid-poor 1 Lipi-dol 1 lipidmetabolism 1 lipid-lowering 1 lipid-based 1 lipidated 1 lipdisplacement 1 Liow 1 Lioresal 1 Lions 1 Lioger 1 Linzey 1 Lints-Martindale 1 Lintel 1 linoleic 1 linoleaterich 1 Linnstaedt 1 Linnoila 1 -Linneaus 1 Linnartz 1 Linna 1 Linn 1 Linlin 1 linkedto 1 liningcells 1 Lingrell 1 Lingbing 1 Lingaraj 1 linesand 1 line-of-response 1 lined 1 linearity 1 Lindstrom 1 Lindsley 1 Lindsey 1 Lindsay 1 Lindqvist 1 Lindmo 1 Lindigova 1 Lindenburger 1 Lindenauer 1 Lindblad 1 Lindberg 1 Lindam 1 Lind 1 linc 1 Linardakis 1 Limpa-Amara 1 Limousin 1 Limon-Camacho 1 limitingmembrane 1 limitationsin 1 Limburg 1 limb-girdle 1 limb-angle 1 Limagne 1 Lillevang 1 Lillefjell 1 Lilienfeld 1 Lilford 1 LILACS 1 liking 1 Likhodi 1 likert 1 likeliest 1 liked 1 Liguori 1 light-sensitive 1 Lightman 1 lighting 1 lightinduced 1 light-flicker-induced 1 light-dark 1 light-adapted 1 ligation-dependent 1 ligated 1 ligases 1 ligaments 1 lifts 1 lift-off 1 lifters 1 lifted 1 lifetime-risk 1 lifestyle11 1 lifespanreference 1 lifespanin 1 lifespan-extension 1 lifespan-augmenting 1 Lifescan 1 life-saving 1 life-prolonging 1 lifelong-stable 1 Lifeline 1 life-limiting 1 lifeless 1 life-extending 1 life-changing 1 lieu 1 Lien 1 Liehn 1 Lieffers 1 Lieber 1 Lidov 1 LiDCOplus 1 LiDCO 1 Licznerski 1 Lichtenthal 1 Lichtensteiger 1 Lichtenberg 1 Lich 1 Lic 1 Libre 1 Librach 1 Libra 1 Liberopoulos 1 libero 1 Liberman 1 Liberati 1 liberated 1 liates 1 Liapi 1 Liaoet 1 LHUs 1 Lhermitte 1 Lgr5 1 L-glutamine 1 L-glutamic 1 lfcharacteristics 1 Lfblom 1 Lezza 1 Lezius 1 lezen 1 Lezcano 1 lez1 1 Leyva 1 Leypoldt 1 Leyman 1 Ley 1 Lexington 1 Lexicomp 1 Lexa 1 Lewy-type-positive 1 Lewy-related 1 Lewyneurites 1 Lewis-Williams 1 Lewis-GrantL 1 Lewis-Grant 1 Lewis1 1 Lewenstam 1 Lew 1 Levuglandins 1 Levrero 1 Levraud 1 Lev-Ram 1 levodopa-induced 1 levobupivaciane 1 levobupivacaine 1 Levit 1 Levison 1 LevineE 1 Levett 1 leveraged 1 Leventhal 1 Leveno 1 Levene 1 Levendag 1 Levenberg-Marquardt 1 levelsto 1 levelof 1 levelled 1 level-dependent 1 level47 1 Levecque 1 Levarht 1 Levant 1 Leva 1 Leurgans 1 Leung-Hagesteijn 1 leukotriene 1 leukostasis5 1 leukocoria 1 leukemia-lymphoma 1 leukaemia-lymphoma 1 leucotomy 1 leucoencephalopathy 1 leuco-cytes 1 leucocyte 1 leucine-rich 1 Leuchter 1 letype 1 Lettinga 1 Letting 1 LettereNumber 1 Lettere 1 Letournel 1 Letien 1 Letheis 1 Leth 1 Lester 1 lesss 1 lesson 1 Lessius 1 less-invasive 1 Lessingstrasse 1 less-developed 1 lespinosa 1 Leskosek 1 lesions45 1 Lescaudron 1 Lesageet 1 Leroux 1 leptomeningeal 1 leptin 1 Lepretre 1 Lepr 1 LeppkeS 1 Lepper 1 Leppavuori 1 Lepola 1 Lepers 1 Leow 1 Leonetti 1 Leonard-Martin 1 Leo 1 lenzjahr 1 Lenzi 1 Lenzen 1 lentiviruses 1 lentiviral-based 1 lenti-viral 1 lenti-135b 1 lent 1 Lensvelt-Mulders 1 Lenschow 1 Lennox-Gastaut 1 Lennmarken 1 lengthening 1 lengthen 1 Lengauer 1 lending 1 Lencioni 1 lence 1 lenalidomide 1 Lemos 1 Lemke 1 Lemez 1 Lemesre 1 Lembke 1 Lemanek 1 Lema 1 Lelong 1 Lelie 1 Lelanet 1 Lelan 1 Lekoubou 1 Lejeune 1 Lejbkowicz 1 Leitz 1 Leitner 1 leitlinien 1 Leitch 1 Leistner 1 Leis 1 leiomyosarcomas 1 Leino-Arjas 1 Leimer 1 Leighton1 1 Leight 1 Leiers 1 Leidolt 1 Leiden85plus 1 Leica 1 Leibniz-Institute 1 Leiberg 1 Lehtonen 1 Lehrstuhl 1 Lehrer 1 Lehnerdt 1 Lehmann-Che 1 Legrand-Poels 1 Legrain 1 leg-muscle 1 legitimates 1 legitimately 1 legitimacy 1 legislative 1 Legha 1 Legg 1 LEGA 1 left-sided 1 left-mostpanel 1 left-lateralized 1 left-hemisphere 1 Leffell 1 Lefeuvre 1 LEF-1 1 Leese 1 Leening 1 Leenders 1 Lee-Chen 1 Leebeek 1 Leducq 1 Ledikwe 1 lectures 1 lectured 1 Lecrubier 1 Leckman 1 lecithin 1 Lecault 1 LeBrasseur 1 Leblond 1 lebihan 1 Leber 1 Lebenswelt 1 Lebedew 1 least30 1 least20 1 Leas 1 learns 1 learning-dependent 1 learning42 1 Learmonth 1 Leaper 1 LEAP 1 leanest 1 Leal-Leal 1 Leal 1 leaks 1 Leakage-corrected 1 leafy 1 leaflet 1 lead-field 1 lead-exposed 1 leaded 1 Leach 1 Lea 1 LE1 1 LDS 1 LDL-R-mediated 1 LDLR- 1 LDF 1 lD4ex 1 lcut 1 LCIS 1 LC-ESI-MS 1 L-carnitine 1 LC3 1 LB-type 1 LBsformation 1 Lbk1 1 LBC1936 1 LBC 1 Lazzara 1 Lazo-Saenz 1 Lazo 1 Lazic 1 Lazarov 1 Lazar 1 Layzell 1 laypeople 1 Layfield 1 layer-specific 1 layering 1 Lawless 1 Lavoie 1 LaVio-lette 1 LaViolette 1 Lavi 1 Lavery 1 Laverman 1 Lavergne 1 Lavedan 1 Lavalette 1 LaVail 1 Lauven 1 Laursen 1 Laurenceau 1 Laurell 1 Laureate 1 LAURA-based 1 Laur 1 Laun 1 Laumann 1 Laulumaa 1 Lauet 1 Lauderdale 1 lauded 1 Latzer 1 lattices 1 latteris 1 Lattarulo 1 Latruffe 1 Latourelle 1 Latino-Americana 1 Laties 1 Laterre 1 laterlife 1 lateral-to-medial 1 later45 1 late-preterm 1 lateonset 1 latently 1 latency4 1 late-eight 1 Latchman 1 Latchaw 1 Latanoprost 1 lata 1 Laszlo 1 lasts 1 last-observation-carried-forward 1 Lassonde 1 Lass-mann 1 Lassailly 1 Laso 1 Lashuel 1 laser-induced 1 laser-capture 1 laser-assisted 1 Lasanianos 1 LaSalle 1 laryngoscopy 1 laryngoscopes 1 Laryngo-scope 1 Laryngorhinootology 1 laryngealstoma 1 larval 1 Lars 1 Larroque 1 Larquet 1 Larouche 1 LaRossa 1 LaRocca 1 larly 1 large-volume 1 larger-scale 1 large-animal 1 Larcher 1 Lara2 1 lapsing 1 Lappas 1 LaPorte 1 Lapole 1 Lapointe 1 Lapitan 1 Lapiedra 1 Lapidus 1 Lapi 1 Lapchak 1 laparo-scopic 1 Lanterna 1 Lanteri-Minet 1 Lanser 1 Lansdown 1 Lanschuetzer 1 Lanni 1 Lankhorst 1 Lanigan 1 Lanier 1 language-related 1 language-impaired 1 Languageand 1 Langs 1 Langmann 1 Langheinz 1 Langhan 1 Langfort 1 Langeron 1 Langer 1 Langen-Selige 1 Langensalza 1 Langendijk 1 Langberg 1 Langan 1 Lanfermaan 1 lanes 1 Landuyt 1 Landsman 1 Landsittel 1 Landrum 1 Landreville 1 Landreth 1 landline 1 Landini 1 Landewe 1 Landers 1 Landeau 1 Landay 1 Lanctot 1 Lancet357 1 Lancet2008 1 Lana 1 Lamster 1 Lampis 1 lamp 1 Lamontagne-Lacasse 1 Lammers 1 Lamkin 1 Lamki 1 lamination 1 Lamia 1 lament-immunoreactive 1 lamellar 1 Lambton 1 Lambourne 1 Lambalk 1 LaMattina 1 lalo 1 lallooc 1 Lalla 1 Lakshminarayan 1 Lakhani 1 Laken 1 Lakdawalla 1 Laitakari 1 Laippala 1 Laing 1 Laila 1 Lahti-Koski 1 Lahti 1 Lahoz 1 Lahoutte3 1 Lahelma 1 LAH 1 Lagowski 1 Lago 1 Lagerwaard 1 Lagana 1 LaFrancois 1 LaForge 1 Laforet 1 LaFerla 1 Lafaix 1 Laere 1 Laemmli 1 Ladenheim 1 Laden 1 Ladell 1 LacZ 1 lacune 1 lactoferrin 1 lactating 1 lactate-to-pyruvate 1 lactated 1 Lacroix 1 lacrimal 1 Lacourse 1 Lachowycz 1 Lachlan 1 Lachanas 1 Lacerda 1 lacerations 1 Lacambra 1 Labuschagne 1 LabTM 1 Labtech 1 Labsynth 1 labouring 1 Labourier 1 labor-saving 1 laborist 1 laborious 1 labor-intensive 1 labor-consuming 1 Laboratoire 1 Laborat 1 LabMed2011 1 lable-free 1 LabEx 1 Laberge 1 Labelle 1 LA2Rosa26-CreERT2 1 L8S 1 L73-L92 1 L4641 1 L435 1 L42-L61 1 L3-L4 1 L37 1 L2-L3 1 L2 1 L167I 1 L139 1 L137 1 L135 1 L131 1 L130 1 L123 1 L1-2 1 L117 1 L1 1 Kzhyshkowska 1 Kyung-Hun 1 Kyu 1 Kyriazopoulou 1 kyphosis 1 kyoto-u 1 Kyosai 1 Kyme 1 Kyllonen 1 Kyin 1 KXXXK 1 Kwock 1 KWMB 1 Kwee 1 kwaliteit 1 Kwak-Kim 1 Kwakkel 1 Kwak 1 Kvols 1 Kvist 1 Kv9 1 KV7 1 Kuzniecky 1 Kuwakado 1 Kuwaharaet 1 Kuwabara 1 Kuvula 1 Kuusisto 1 Kussmaul 1 Kushnerenko 1 Kushner 1 Kushi 1 Kushan 1 Kusbeci 1 Kusanovic 1 Kurzrock 1 Kurzel 1 Kurumatani 1 Kurtzberg 1 Kurth 1 Kurszewski 1 Kurowski 1 Kuroda 1 Kurland 1 Kuriwaki 1 Kurisu 1 Kurinij 1 Kurian 1 Kurella 1 Kurdyak 1 Kurbatskaya 1 Kurata 1 Kuramoto 1 Kuppusamy 1 Kupferminc 1 Kunze-Kronawitter 1 Kuntal 1 Kunst 1 Kunopart 1 Kuno 1 Kunkel 1 Kunju 1 Kunins 1 KunikME 1 Kunig 1 Kundt 1 Kummu 1 Kumirska 1 Kumeda 1 Kumarswamy 1 Kumari 1 Kumamoto 1 Kulveer 1 Kulstad 1 Kulminskiet 1 Kulmala 1 Kullmann 1 Kuller 1 Kulhavy 1 Kulesz-Martin 1 Kukull 1 Kukulka 1 Kukreti 1 Kujalah 1 Kuivaniemi 1 Kuil 1 Kuick 1 Kuhs 1 kuhp 1 Kuhn-Hallek 1 Kuhnelt 1 Kugel 1 Kufel 1 Kuetal 1 Kuenzi 1 Kuenlin 1 Kuehner 1 Kuehn 1 Kuehbacheret 1 Kuehbacher 1 Kuebler 1 Kudryavtseva 1 Kuczmarski 1 Kuchle 1 Kuchibhatla 1 Kuchenbauer 1 Kucharska-Newtonet 1 Kucharska-Newton 1 Kubecka 1 Kuban 1 Kubacka 1 Kuang 1 Kuan 1 kstepien 1 Ksenia 1 ksauser 1 ksa 1 Krzyzosiak 1 Krystyna 1 Krystal 1 KRYRR 1 Krygowska-Wajs 1 Kruyt 1 Krustrup 1 Kruskal-Wallistest 1 Kruskal-Wallis 1 Krupka 1 Kruizenga 1 Kruip 1 Kruijt 1 Kruck 1 Kruchko 1 Krown 1 Krowiak 1 Krook 1 Krone 1 Kromminga 1 Krokstad 1 Kritchevsky 1 Kristina 1 Kristen 1 Kristeller 1 Krishnamoorthy 1 Krijger 1 Kriegstein 1 Kriege 1 Krieg 1 Kreutzfeld 1 Kreutzberg 1 Kreutz 1 Kretzschmar 1 Krestin 1 Krentz 1 Kremmer 1 Kreitz 1 Kreiskrankenhauser 1 Kreiskli-niken 1 Kreiselmaier 1 Kre-feld 1 Kreek 1 Krebshilfe 1 Krautter 1 Krause 1 KrauQ 1 Krassilnikova 1 Krasnow 1 KrasLSL-G12D 1 KrasLA2-driven 1 KrasLA2-dependent 1 KrasG12-activating 1 Kras-drivenlung 1 K-Ras-dependent 1 Krall 1 Kralev 1 Krakowiak 1 Krainc 1 Kragh 1 Kragballe 1 Kraft 1 Kozyreva 1 Kozulin 1 Kozlowski 1 Kozloff 1 Koziorowski 1 Kozich 1 Kozeny 1 Kozakiewicz 1 KozakewichHP 1 Kowall 1 Kowalak 1 Kowa 1 Kovriga 1 Koves 1 Kovarik 1 Kovanlikaya 1 Kovanen 1 Kouwe 1 Koutsoupaki 1 Koutsoukou 1 Koutsodimas 1 Kouspou 1 Kouskouni 1 Kourilsky 1 Kountouris 1 Koumarianou1 1 Koumarianou 1 Kotze 1 Kotsianidis 1 Kotowska 1 Kotliar 1 Kotilinek 1 Kothy 1 Kothmann 1 Kothmaier 1 Kostopanagiotou 1 Kostelijk 1 Koss 1 Kosower 1 Kosman 1 Koslow 1 Koski 1 Kosillo 1 Koshikawa 1 Koscianska 1 Koschel 1 Kosaka 1 Korytko 1 Kortz 1 Kortschak 1 Kortmann 1 Kortenberg 1 Korpilahti 1 Korotkoff 1 Kornguth 1 Kornfield 1 Kornfehl 1 Kori 1 Korf 1 Koreans 1 Kordan 1 Korcarz 1 Kopsi 1 Kops 1 Koppula 1 Koplan 1 Kopans 1 Koonen 1 Koom 1 Koolschijn 1 Kooi 1 Kontrus 1 Kontopante-lis 1 Kontopantelis 1 Kontoninas 1 Kontinen 1 Kontgis 1 Konstantinova 1 Konrad 1 Konopka 1 Konje 1 Konick 1 Koneru 1 Konen 1 Kondziolka 1 Kondrikova 1 Kondoh 1 Kondapalli 1 Kompoliti 1 Komlos 1 Kominami 1 Komarov 1 Komann 1 Koln 1 Kolmogo-rov-Smirnov 1 Kolmogorov-Smirnov 1 Kollmar 1 Kolling 1 Kollias 1 Kolchanov 1 Koker 1 Kok 1 Kojovic 1 Kojiro 1 Kojda 1 Koizumi 1 Koivogui 1 KoistiMJ 1 Koike 1 Kohno 1 Kohner 1 Kohlmeier 1 Kohlhaas 1 Kohji 1 Kohda 1 Kogan 1 Koga 1 Koflin 1 Koffel 1 Koester 1 Koepsell 1 koennieman 1 Koenen 1 Koenderman 1 Koelman 1 Koehl 1 Koeglsperger 1 Kode 1 Kocsis 1 Kocolas 1 Kock 1 Kochi 1 Kochetkov 1 Koche 1 Kocarev 1 Kocabora 1 Kobrin 1 Kobe 1 Koay 1 Knyazevaa 1 Knutson 1 knows 1 knowledge-to-action 1 knowledge-based 1 Knottnerus 1 Knoss 1 Knopman 1 knocked 1 Knoch 1 Knobloch 1 Knivsberg 1 Knittel 1 Knighton 1 Knighta 1 Knight2 1 Knekt 1 Kneib 1 knee-extensors 1 Knebel 1 Knaut 1 Knaub 1 Knapp-schaftskrankenhaus 1 KMS11 1 KMrkved 1 Kmol 1 Kmetic 1 K-means 1 Kluthe 1 Klupsch 1 Klunk 1 Klugmann 1 Kloth 1 Klosterkoetter 1 Klos 1 Klop 1 Klittich 1 Klipfell 1 Klionsky 1 Klink 1 Kli-nik 1 Kline 1 Klimes-Dougan 1 Kliman 1 k-light-chain-enhancer 1 Klevering 1 Klepstad 1 Klepper 1 Klenk 1 Klejnot 1 Kleimet 1 Kleijnen 1 Kleij 1 Kleihues 1 Kleele 1 Klebe 1 Klc1- 1 Klaus 1 Klaudia 1 Klatt 1 Klarskov 1 Klancnik 1 KL2 1 KKW 1 KJJ 1 Kizony 1 KIX 1 Kiviniemi 1 Kivela 1 Kitzenberg 1 Kitsoulis 1 Kitley 1 Kitchen 1 Kitch 1 Kitasato 1 Kitaoka 1 Kitami 1 Kitakawa 1 Kistler 1 Kissil 1 Kisselev 1 Kispert 1 Kishi 1 Kiselycznyk 1 Kiryu 1 Kirwan 1 Kirveskari 1 Kirschkamp 1 Kirsch 1 Kirkpatrick 1 Kirkman 1 Kirkeeide 1 Kirke 1 Kirkali 1 Kirikc 1 Kirchoff 1 Kirchheim 1 Kircher 1 Kiraly 1 kiprc 1 Kipps 1 Kipasa 1 kiosks 1 kiosk 1 Kint 1 Kinsey 1 Kinoshita 1 Kinome-wide 1 kinome-and 1 kinome 1 Kinney 1 kinks 1 kinking 1 kinin 1 Kingston-upon-Thames 1 Kingston 1 Kingman 1 Kingery 1 Kinesiol 1 kinematically 1 Kinematica 1 Kindler 1 Kindermann 1 kindergartener 1 kinasefamily 1 kinase-1 1 kinase1 1 -kinase 1 Kimura-2 1 KimT 1 Kim-Shapiro 1 Kimpara 1 Kimmons 1 KimmickG 1 Kimmel 1 KimJ 1 Kimberling 1 Kilpatrick 1 kilovolt-peak 1 kilovoltage-switching 1 kilovoltage 1 kilovolt 1 kilometer 1 kilograms 1 kilogram 1 kilocalories 1 kilobases 1 kilobase 1 Killingsworth 1 Kilkenny 1 kilde 1 Kikwit 1 Kikuyama 1 Kijlstra 1 Kiffin 1 Kiev 1 Kiens 1 Kienast 1 Kiehl 1 Kidgell 1 Kiddee 1 Kidambi 1 Kibatala 1 Khosrof 1 Khoo 1 Khong 1 Kholodilov 1 Kho 1 Khlea 1 Khitrov 1 Khine 1 Kheterpal 1 Khetan 1 Kheradiya 1 KHC 1 KHB3481 1 KHB3442 1 KHB0061 1 Khaw 1 Khavari 1 Khatcheressian 1 Kharitonenkov 1 Khansari 1 Khandwala 1 Khandelwal 1 Khanday 1 Khalili-Mahani 1 Khalil 1 Khaligh 1 Khalifeh 1 Khairuddin 1 Khadivic 1 Khademi 1 KH2PO4 1 KH2PO3 1 kg19 1 keying 1 keyenzymes 1 keyelements 1 Kevelam 1 Ketring 1 ketorolac45 1 ketogenesis 1 ketoacids 1 Ketamine-propofol 1 Ketamine-induced 1 Kesterson 1 Kester 1 Keslensky 1 Keski-Rahkonen 1 Keshavan 1 Kertesz 1 Kersey 1 Kerremans 1 Kerpener 1 Kerokoski 1 Kernsposited 1 Kerlin 1 Kerkhoffs 1 Kerkenia 1 Kerherve 1 Kereszteny 1 Kerckaert 1 Kerby 1 keratosis 1 keratopathy 1 keratoconus 1 keratitis-related 1 Keratitis-Induced 1 keratitisea 1 keratinocyte-specific 1 keratin14 1 Keramatian 1 Kepp 1 Kenya 1 Kenton 1 Kentle 1 Kennon 1 Kennelly 1 Kenkyusho 1 Kenjo 1 Kenichi 1 Kendrick 1 Kendig 1 KendalWS 1 Kendall 1 Kenanova 1 Kempton 1 Kempkensteffen 1 Kelsey 1 Kelowna 1 KellyM 1 KellyBL 1 Kells 1 Kellom 1 Kelleher 1 Keks 1 Kejnovska 1 Keizer 1 Keirsey 1 Kehrloesser 1 Keheren 1 Kegelaer 1 Kefer 1 Keers 1 Keeper 1 Keen-Hun 1 Keeling 1 Keeley 1 Keel 1 Keefer 1 Keedy 1 Kee 1 k-edges 1 Keck-UNM 1 kebini 1 Keast 1 Kearney 1 Keaney 1 Keam 1 kDaproteins 1 kDaIkBalpha 1 KCNQ24 1 KCNQ2 1 KCNQ 1 KCK 1 KBY 1 Kazunori 1 Kazui 1 Kazis 1 Kayyal 1 Kayser 1 Kayo 1 Kayikicioglu 1 Kayali 1 Kaya 1 Kawe 1 Kawashima 1 Kawas 1 Kawanokuchi 1 Kawano 1 Kawamoto 1 Kawamata 1 Kawahara-cho 1 Kawachi 1 Kavoussi 1 Kavousi 1 Kavanaugh 1 Kavanagh 1 Kaur 1 Kaunitz 1 Kaukonen 1 Kaufmann 1 Kaufhold 1 Kauffmann 1 Kaufer 1 Katzav 1 Katy 1 katu 1 Kattan 1 Katsuyama 1 Katsutoshi 1 Katsarou 1 Katkuri 1 Katkoori 1 Katie 1 Kathirvel 1 Katherine 1 Katharinenhospital 1 Kath 1 Kate 1 Katayama 1 Kastenand 1 Kastelein 1 Kaste 1 Kassoff 1 Kassel 1 Kass 1 Kasperkiewicz 1 Kasner 1 Kasman 1 Kasl 1 kasis001 1 Kasina 1 Kashiwazaki 1 Kashii 1 Kased 1 Kasamatsu 1 Karzai 1 karyotyping 1 Karyotypic 1 karyotypes 1 Kartunen 1 Kartalis 1 Karson 1 Karskens 1 Karsh 1 Karram 1 Karppi 1 Karppanen 1 Karpischenko 1 Karpf 1 Karper 1 Karousos 1 Karolinska 1 Karnowski 1 Karnovsky 1 Karnell 1 Karnani 1 Karma 1 KarlssonI 1 Karkheiran 1 Karithanom 1 Karhunen 1 Karelina 1 Karcher 1 Karapondo 1 Karamohamed 1 Karakiulakis 1 Karakaya 1 Karakatsanis 1 Karadimitris 1 Karabulut 1 Karabanov 1 Karaayvaz 1 Kara 1 Kapton 1 Kaptoge 1 Kaptein 1 Kapsenberg 1 Kappert 1 Kappen 1 -kappab 1 kappaB 1 Kapoor 1 KaplanMeier 1 Kaplan- 1 Kapil 1 Kapahiet 1 Kaori 1 Kantrowitz 1 Kantola 1 Kantarjian 1 Kant 1 Kansy 1 Kanowski 1 Kannisto 1 Kannapolis 1 Kanis 1 kaninchenaorta 1 Kangfu 1 Kanfer 1 Kaneuchi 1 Kandasamy 1 Kanchuger 1 Kanbe 1 Kanapin 1 Kanao 1 Kanagasingam 1 Kamugisha 1 Kamps 1 Kampk 1 Kampik 1 Kaminski 1 Kaminker 1 Kaminaris 1 Kamimura 1 Kamen 1 Kamano 1 Kalyanasundaram 1 Kalso 1 Kalsch 1 Kalsbeek 1 Kalman 1 Kallio-Laine 1 Kallen 1 Kallehauge 1 Kalkman 1 Kalk 1 Kalina 1 Kalin 1 Kalendar 1 Kalemis 1 Kale 1 Kalbitzer 1 Kalbacher 1 Kalari 1 Kalantar-Zadeh 1 Kalampokas 1 Kalafong 1 Kakizaki 1 Kakiuchi 1 Kakita 1 Kakigi 1 Kake 1 Kakavouli 1 Kajdas 1 Kajander 1 Kairat 1 Kaindl 1 Kaijser 1 Kaida 1 Kaiafa 1 Kahonen 1 Kahler 1 Kahl 1 Kahari 1 Kagaya 1 Kagaku 1 Kaftan 1 kaeus 1 Kaenjak 1 Kaeberleinet 1 Kadyk 1 Kaducu 1 Kadlecov 1 Kadhim 1 Kademani 1 Kadam 1 Kaczorowski 1 Kaczkowski 1 Kachur 1 Kachhap 1 Kacerovsky 1 Kaboli 1 KA1 1 K-A 1 K99-DK088589 1 K70 1 K5-positive 1 K56 1 K400311 1 K26 1 K227A 1 K20me2 1 K20Ac 1 K2009-61P-20945-03-1 1 K16 1 K14-positive 1 K12Ac 1 K10-positive 1 K10-expressing 1 K10 1 K08 1 K07 1 K000500 1 --K 1 Jyoti 1 J-Y 1 JWH 1 Juyal 1 Juxtaposing 1 juvenile-onset 1 Juurlink 1 Justo 1 justly 1 Justine 1 Justin 1 justifying 1 Juster 1 Jus- 1 jus 1 Jurrus 1 Jurk 1 Jurjus 1 Juristische 1 Jurek 1 Juranek 1 JUPITER 1 Juonala 1 Junque 1 Junod 1 Junkins 1 Junjie 1 Jungreis 1 Junga 1 Junfeng 1 JunD 1 juncture 1 junctionline 1 JunB 1 Jumani 1 July2 1 Jullien 1 Juliusson 1 Julius 1 Julien 1 Julie 1 Jules-Gonin 1 Jules 1 Jul 1 Jukic 1 Jukema 1 Juhl 1 Juhasz 1 Judy 1 Judith 1 judgments 1 Jubrias 1 Juang 1 jtselect 1 jtrights 1 JTP-74057 1 jt200607 1 JSH 1 JSC 1 jsasisekaran 1 J-S 1 Jrvenpb 1 JRJ 1 jrg 1 Jret 1 J-pouch 1 JPJ 1 jphys 1 JPEN 1 JPEG 1 J-P 1 Jozsa 1 JoyceS 1 Jowett 1 Jovanovich 1 Jottard 1 Joslyn 1 Josephson 1 Josephs 1 Josef-Hospital 1 Joris 1 JorgeR 1 Jorgenson 1 Jorgen 1 Jorge 1 Jorg 1 Joormann 1 Joo 1 Jonnalagadda 1 Jonkman 1 Jongenelis 1 Jonge 1 Jones-Rhoades 1 Jonak 1 Jolles 1 Jolepalem 1 Jokinen 1 Joke 1 Joiner 1 Johnsrude 1 JohanssonK 1 Johansen-Berg 1 Johan 1 Joffe 1 Joehaneset 1 Jochum 1 Jocelyn 1 Jobst 1 JNucl 1 jnnp-2014-307569 1 jnnp-2013-307044 1 JNK1-dependent 1 JMS 1 Jmjd3 1 JMF 1 jmcgough 1 JLJ 1 J-K 1 JJP 1 JJM 1 JJD 1 Jirtle 1 jirovecii 1 Jinzaki 1 Jinno 1 Jin1 1 JImmunol 1 Jimi 1 Jimenez-Beristain 1 Jime 1 Jim 1 Jillian 1 Jick 1 jianfeng64 1 JHMG 1 JGM 1 jg8 1 JFM 1 J-F 1 Jezzard 1 Jezequel 1 Jeyakumar 1 -Jewish 1 Jewish 1 Jevtovic 1 Jeurissen 1 Jeukendrup 1 Jeuken 1 Jesu 1 Jestin 1 Jessop 1 Jessberger 1 Jespersen 1 Jesper 1 Jerskey 1 Jerrold 1 Jerrett 1 Jerosch-Herold 1 Jeromin 1 Jermann 1 Jeremy 1 jeopardy 1 jeopardized 1 JEOL 1 Jens 1 Jenny 1 Jennie 1 Jennbacken 1 Jenewein 1 Jenden 1 Jen 1 JEM 1 JELINEK 1 jejunum 1 Jeffords 1 Jeffery 1 Jeff 1 Jean-Pierre 1 Jeanny 1 Jeannice 1 Jean-Michel 1 Jeanie 1 Jeandel 1 jdr 1 jdisterhoft 1 JDG 1 jdelcoso 1 J-D 1 JClinOncol 1 JCAHO 1 JCA 1 Jaycock 1 Jayaraman 1 Jayant 1 Javanmard 1 JAutismDev 1 Jauregui 1 Jaume 1 Jauhiainen 1 Jauch 1 Jasser 1 Jaspers 1 Jaslok 1 Jasinska-Myga 1 Jasiak 1 Jasi 1 Jarup 1 Jarrett 1 Jaroniec 1 Jarolimek 1 Jarius 1 Jarid2 1 Jardim 1 japplphysiol 1 Jappelli 1 Japanese-language 1 Japanese-American 1 Janus 1 Januleviciene 1 Januario 1 Jant 1 Janssens 1 Janssen1 1 JansonI 1 Janosky 1 Jannink 1 Janneke 1 Jankowski 1 Janke 1 Janjan 1 Janin 1 JanH 1 Janey 1 Janetzky 1 Janete 1 Jane 1 Janda 1 Jancke 1 Janak 1 JAMT 1 Jamshidi 1 Jamrozik 1 Jampol 1 JAmMed 1 Jamil 1 Jamie 1 JAmColl 1 Jamaica 1 JAm 1 Jallah 1 Jallad 1 Jalan 1 Jakubowiak 1 Jakoby 1 Jakobson 1 Jakobsen 1 Jaissona 1 jaideep 1 JaICA 1 Jahr 1 Jahnke 1 Jahn 1 Jahangiri 1 Jagust 1 Jaggi 1 Jagadha 1 Jaffar 1 Jaeschke 1 Jaeger 1 Jaeckle 1 Jacqueline 1 Jacobsohn 1 Jacobijn 1 jacobantonsen 1 Jackson-Lewis 1 Jackman 1 jaci 1 JAC 1 Jaasko 1 Jaaskelainen 1 Jaarsma 1 Jaarrap-portage 1 jaac 1 J-A 1 j7cclm 1 j45 1 J3230 1 J2-3 1 J2 1 j15 1 Izumiya 1 Izquierdo-Garcia 1 Izpisu 1 Izhar 1 ization 1 Iyoda 1 Iyer 1 Iyengar 1 ix 1 Iwayama-Shigeno 1 Iwatani 1 Iwasaki 1 Iwas 1 Iwarsson 1 Iwanaga 1 Iwam-oto 1 Iwakura 1 Iwakuma 1 Iwai 1 Iwabuchi 1 Ivins 1 IVF-SET 1 IVF-related 1 IVF-ET 1 Ivers 1 IVD 1 Ivanusic 1 Ivanova-Smolenskaya 1 Ivankovich 1 IV-3with 1 IV-3and 1 IV-3 1 Iung 1 iumrecently 1 Iudice 1 Itri 1 itreduces 1 ITK 1 itealmost 1 itching 1 Italian-speaking 1 Italiano 1 Itagaki 1 isyand 1 isunclear 1 Istituto 1 isthmic 1 isthe 1 istat 1 Istanbul 1 issueof 1 issue-files 1 Issioui 1 ISRCTN92187251 1 ISRCTN71142851 1 ISRCTN61384873 1 ISRCTN44485060 1 ISRCTN08435261 1 ISRCTN05689407 1 ISRCTN0568 1 ISRCTN02147658 1 Israeli-Arab 1 Israe 1 Isradipine 1 Ispradit 1 ISPOCD1 1 ISPOCD 1 ISPD 1 isozyme-specific 1 isozymes 1 Isoya 1 isovolaemic 1 isotropically 1 isotretinoin 1 isotopically-labeled 1 isotopic 1 isotope-labeled 1 isotope-dilution 1 isotonic 1 isothermal 1 Isotani 1 Isot 1 isosmotic 1 Isose 1 isopropanol 1 isoprenoid 1 isopentane 1 Isoo 1 isomorphism 1 isomers 1 Isomerization 1 Isom 1 isoLG-protein 1 isoLG-modified 1 isoLG-associated 1 isoLG 1 isolevuglandin-associated 1 isolevuglandin 1 isolable 1 isoften 1 isoform-specific 1 isoformof 1 isoflavones 1 isoenzymes 1 isoelectric 1 iso-data 1 Isoda 1 iso-A2E 1 ismediated 1 Ismael 1 Isler 1 Islanders 1 ISLAMICTERRORISTS 1 Islam 1 Iskrenova 1 Iskandar 1 Isis 1 isinexcessofO2 1 Ishizuka 1 Ishizawa 1 Ishiwata 1 Ishioka 1 Ishigame 1 Ishai 1 I-SGMIBand 1 I-SGMIB-5F7GGC 1 Isett 1 Iserson 1 ISe 1 isdegraded 1 ISCIII-MINECO 1 ischemia-driven 1 ISBN 1 isan 1 Isala 1 Isabelle 1 Isaacs 1 Isaac 1 Irx3 1 Irwig 1 Irvington-Wiley 1 Irving 1 IrvineeGass 1 irus 1 IRS-2-deficient 1 irrigated 1 irrelevance 1 irreconcilable 1 irrational 1 Iron-water 1 ironically 1 Iron-binding 1 Irizarry 1 iritis 1 Irioka 1 Irina 1 Irimie 1 Iria 1 Irene 1 IREDswere 1 IRE1-or 1 Ire1alpha 1 IRDye 1 IRCCS 1 IRBs 1 IRBP 1 IR-based 1 IR-B 1 Irazabal 1 Iranian 1 IQ-type 1 IQOLA 1 IPTG 1 iPS-RPE 1 ipsilesional 1 ipsilaterally 1 iPS 1 Ipiranga 1 iPET 1 IPAT2 1 IP-13-613 1 Iovino 1 IOP-or 1 iontophoresis 1 ion-spray 1 ionotropicreceptors 1 ionisation-tandem 1 ionisation 1 ionicmilieu 1 ionic 1 ionbeam 1 IOF 1 iodobenzoyl 1 iodobenzoate 1 iodo-4-phosphonomethylbenzoate 1 iodine-water 1 iodine-subtraction 1 iodine-filled 1 iodine-based 1 iodine-123 1 iodination 1 IOC 1 InWT 1 invulnerability 1 involvingmiR-181a 1 involution 1 invokes 1 invoked 1 in-vivo 1 In-vitrogen 1 Invitreal 1 inviting 1 invite 1 invisual 1 invisibility 1 investigator-sponsored 1 investigator-initiated 1 investigator-administered 1 Investigacions 1 Investigaciones 1 Investigacion 1 Investigaci 1 inverting 1 inversion-recovery 1 inventors 1 invention 1 inventilatory 1 invalidated 1 invalid 1 invagination 1 Inukai 1 Inui 1 intype 1 intuition 1 introductory 1 introductive 1 intricacy 1 intravitreally 1 intra-venous 1 intraureteral 1 intraumatic 1 intratumoural 1 intratracheally 1 intrathoracic 1 intratendinous 1 intrasubject 1 intraspinal 1 intrascleral 1 intrasarcoplasmic 1 intraquartile 1 intra-procedural 1 intrapharyngeal 1 intrapalatal 1 intra-oral 1 intraoral 1 in-transit 1 intranasal 1 intra-myofibrillar 1 intramyo-fibrillar 1 intramyocellular 1 intramyelinic 1 intra-muscular 1 intramuscle 1 intra-MHC 1 intramembranous 1 intraluminal 1 intra-laboratory 1 intra-hospital 1 intra-graft 1 intragenic 1 intra-frame 1 intrafallopian 1 intrachromosomal 1 intracerebro-ventricular 1 intracardially 1 intra-articular 1 intra-and 1 intra-amniotic 1 intraamniotic 1 intra 1 intoxicated 1 intolerant 1 IntJ 1 Intine 1 intimidation 1 intimal-medial 1 intimal 1 Intimacy 1 inter-views 1 Intervention-Specific 1 interventions30 1 intervention-related 1 Interventionist 1 Intervent 1 intervendor 1 intervaricosity 1 interval-optimized 1 interval-mediated 1 intertrial 1 inter-subject 1 interstimulus 1 interspace 1 intersect 1 interscan 1 interrupts 1 interruptive 1 interrupt-driven 1 interrelate 1 interregional 1 inter-quartile 1 interprets 1 interpretable 1 interposing 1 interplaying 1 interpeduncular 1 interob-server 1 internists 1 interneuronal 1 Internet-enabled 1 internet-derived 1 Internet-connected 1 internally-controlling 1 inter-myofibrillar 1 intermixed 1 intermittent-sprint 1 intermediate-stage 1 intermediate-high 1 inter-locking 1 inter-limb 1 interleukin-4 1 Interleukin-22 1 interleukin-1beta 1 interleukin-1b 1 Interleukin-17 1 interlaced 1 interjections 1 intergroup 1 inter-gestural 1 intergestural 1 inter-frame 1 Interfibrillar 1 interferongamma 1 interferon-b 1 interferometric 1 interferometers 1 interferograms 1 interferogram 1 interfacing 1 interfaced 1 interexamination 1 Inter-estingly 1 interestin 1 in-terest 1 interdependency 1 interdependence 1 Interdepartmental 1 intercycle 1 intercostal 1 intercorrelation 1 Intercooled 1 interconvertible 1 interconverted 1 interconvert 1 interconversion 1 interconnection 1 Interchim 1 interchangeably 1 inter-capillary 1 intercalates 1 intercalated 1 inter-block 1 inter-batch 1 interassay 1 inter-and 1 interactsgenetically 1 interactionin 1 interactional 1 interac 1 intentions 1 intentio 1 intensiveness 1 inten-sity-modulated 1 intensity-matched 1 intensity-based 1 intensity-and 1 intensifying 1 intensification 1 intensely 1 intends 1 intelligencee 1 intelli-gence 1 Intell 1 integrin-targeting 1 integrin-mediated 1 integrators 1 integrator 1 integers 1 integer 1 intakeon 1 Insurers 1 insure 1 insupplemental 1 in-superclass 1 insultsthat 1 insulinstimulated 1 insulinreceptor 1 insulin-mediated 1 insulin-induced 1 insu-lin-dependent 1 insulin-dependent 1 insu-lin 1 insulated 1 insular-opercular 1 insuficient 1 insufcient 1 insuf 1 insu 1 instruct 1 institution-level 1 institution-building 1 institutionalized 1 Institute-Working 1 Institutet 1 Insti-tute 1 Institucio 1 instilled 1 instigator 1 instigation 1 instigating 1 instants 1 instantiates 1 installing 1 installation 1 instable 1 instabilities 1 insporadic 1 inspiring 1 inspire 1 inspecting 1 inspectation 1 insomniac 1 insomewomen 1 insofar 1 in-situ 1 insisted 1 insignificantly 1 insignificant 1 INSIG1 1 in-services 1 insertion-deletion 1 inserting 1 insensitivity 1 insenescent 1 insecurities 1 ins 1 inroad 1 inretinoblastoma 1 Input-output 1 input4 1 inpulmonary 1 In-Process 1 inpresynaptic 1 Inpress 1 in-plane 1 inplane 1 inparticular 1 inParkinson 1 inparallel 1 inoxidative 1 inotropy 1 inor-ganic 1 inopportune 1 inoperable 1 Inokuchi 1 Inoko 1 in-office 1 inoculating 1 innumerable 1 innovate 1 Innovacion 1 Innovacio 1 Innov 1 innonword 1 Innocenti 1 innigral 1 inneuronal 1 Innes 1 innervating 1 innersegment 1 inneonatal 1 Innala 1 inmost 1 inmodestly 1 inmodel 1 inmM 1 inmice 1 inmammalian 1 inluding 1 inkling 1 injustice 1 injure 1 injection-based 1 injectate 1 injectables 1 inJapanese 1 initiator 1 initiatedby 1 inischemia 1 inifitiating 1 inhomogeneous 1 inhomogeneity 1 inhibitor-associated 1 inhibitions 1 in-hibition 1 in-hibited 1 inherits 1 inhealthy 1 inhaled 1 Inhal 1 inhabit 1 Ingunza 1 ingredients 1 ingest 1 ingenious 1 Ingels 1 Inge 1 Ingalls 1 Inga 1 Ing 1 Infumorph 1 infra-red-emitting 1 inframe 1 informed-consent 1 Informativo 1 informationist 1 InformationbyDrugClass 1 information-based 1 informational 1 informally 1 infographic 1 InfoBriefs 1 influuence 1 influ-ence 1 inflow 1 inflicted 1 inflict 1 inflammation-remain 1 inflammation-not 1 inflammatione 1 Inflammation42 1 Infinitt 1 infinitesimally 1 inferring 1 inferiorly 1 inferiority 1 Infectiousness 1 infection-prevention-and-control-recommendations 1 infection47 1 infant-successful 1 Infante 1 Inf 1 inextricably 1 inexpression 1 inexplicably 1 inexperienced 1 inertness 1 inertia 1 inequities 1 inequitable 1 inequality 1 inen 1 inefficiently 1 Inefficacy 1 ineffectual 1 INEF 1 ined 1 ine 1 industry-sponsored 1 Indurkhya 1 induration 1 indurated 1 Induc-tion 1 -inducible 1 Indrosophila 1 In-DQTA-NAPamide 1 indominantly 1 indo-methacin 1 indoles 1 indocyanine-green 1 indoctrination 1 indoctrinated 1 individual-participant 1 Indiv 1 Indium-111 1 indistinguishable 1 indisease 1 indiscernible 1 indi-cating 1 indicatesthat 1 indicatedby 1 Indianopolis 1 indiabetes-induced 1 index-guided 1 Index28 1 indeterminacy 1 in-der-Welt-Sein 1 indepth 1 independentof 1 -independent 1 inde-pendent 1 independency 1 indentifying 1 indentation 1 indebted 1 inDanish 1 inDA 1 Ind 1 incubator 1 incremented 1 incredibly 1 increas-ing 1 increaseof 1 increasein 1 Incor-porated 1 inconvenience 1 incontrives 1 inconsequential 1 incongruent 1 incommunity 1 incoherently 1 inclusivity 1 inclusionlike 1 inclusion-exclusion 1 includedd49 1 inclines 1 incline 1 inclination 1 inclinatio 1 inciting 1 incisions 1 incised 1 incidenza 1 incidentCVD 1 inchildren 1 incentivized 1 incentivize 1 incentivised 1 INCELL 1 incarceration 1 incapacitate 1 inCaenorhabditis 1 inBVMD 1 in-built 1 inbrain 1 Inborn 1 Inazawa 1 inaugural 1 inattentive 1 inaridimento 1 inappropriately 1 inAPOEepsilon4 1 inaortas 1 inaorta 1 inall4subjects 1 inageing 1 Inagaki 1 In-Ae 1 inadequately 1 Inaddition 1 inactivator 1 inaction 1 inaccuracies 1 inaccessible 1 inaccessibility 1 inaccelerated 1 in6-year-old 1 in2010 1 in1998 1 IMwnYpDcs 1 imputing 1 imputations 1 impurities 1 impure 1 improve-ment 1 improperly 1 improbable 1 imprisonment 1 imprisoned 1 imprinted 1 Impressively 1 impress 1 impregnation 1 impregnated 1 impracticality 1 imposingly 1 importat 1 importantfor 1 importanceof 1 implores 1 implicationfor 1 impli 1 implementations 1 implant-releasing 1 implanting 1 implanters 1 implantations 1 implantable 1 impingement 1 Imperial 1 imperfections 1 imperfect 1 impeding 1 Impediments 1 impedances 1 impatience 1 imparting 1 impartially 1 impairment-AD 1 impair-ment 1 impairedand 1 impaction 1 IMP 1 Imoto 1 immured 1 immunoturbidimetric 1 immuno-therapies 1 Immunother 1 immunosuppressives 1 immu-nosuppressive 1 immuno-suppressants 1 immunoSPECT 1 immunosignal 1 Immunosenescence-associated 1 immunoscope 1 immunoresearch 1 immuno-regulation 1 immunoreactivities 1 immunoradiometric 1 Immunopurified 1 immunoprobe 1 immunoprecipitated 1 Immunophe-notyping 1 immunoPET 1 immunoperoxidase 1 Immunopa-thol 1 Immunopath 1 immunonephelometric 1 Immunologics 1 immunologically-targeted 1 immunolocalized 1 immunolabelled 1 immuno-labeling 1 immunohistochemically 1 immunohis-tochemical 1 immunogold 1 immunoglobuling 1 immunoglobulin-and 1 immunoglobu-lin 1 immunogenic 1 immunogenetic 1 immunofluorescence-based 1 immuno-fluorescence 1 immunoflourescence-flourescent 1 immunodetection 1 Immunodepletion 1 immunode 1 immunocytology 1 immuno-cytochemistry 1 immunocytochemistry 1 Immuno-cytochemical 1 immunoconjugates 1 immuno-chemical 1 immunobullous 1 immuno 1 immunize 1 immunhistochemical 1 immune-targeted 1 immuneresponse 1 immuneprivilege 1 immune-modulatory 1 immune-modulating 1 immune-mediated 1 immune-driven 1 Immunchemie 1 Immunbiologie 1 immortalized 1 immobilized 1 immobilization 1 immobility 1 Immobil 1 imminently 1 immense 1 immediate-early 1 immaturity 1 imitating 1 imitate 1 I-mismatched 1 imipramine 1 Imhoff 1 IMFT 1 IMEDOS 1 IMCRJ 1 imatinib-resistant 1 Iman 1 Imamichi 1 Imakita 1 imagingwith 1 imagings 1 imaging-only 1 imaging-guided 1 imaging-genomic 1 imagingand 1 imagination 1 imagin 1 imageswere 1 ImageJ-extracted 1 IMAGEbet 1 image-analysis 1 image28 1 image- 1 im- 1 ILUVIEN 1 Ilm-Kreis-Kliniken 1 ILM 1 Illustrator 1 illustrating 1 illustratedin 1 illusory 1 illuminators 1 illumi-nance 1 illuminance 1 Illoh 1 illiterate 1 ill-equipped 1 ill-defined 1 Illawarra 1 Ilkjaer 1 Ilias 1 ileus 1 Ildong 1 ILARIA 1 Ilangovan 1 IL-7 1 IL6 1 IL-5 1 IL-4 1 IL-23-induced 1 IL21R 1 IL-21 1 IL1b 1 IL-1a 1 IL-18 1 IL-17-producing 1 IL-15 1 IL-13 1 IL-12p40 1 IL-12 1 Ikuta 1 Ikonomidis 1 IKK-mediated 1 IKKbeta-and 1 IKKalpha-deficient 1 Ikibas 1 IkBproteins 1 IkBalpha-NF-kBtransient 1 IkBalphaNES 1 IkBalpha-knockout 1 IkBalphaD55-106 1 IkBalpha-binding 1 Ikawa 1 IkappaBbeta 1 Ijiri 1 Iizuka 1 IItumors 1 IIRG-08-88872 1 Iijima 1 Iidaka 1 IIb2 1 IIb1 1 IIb 1 II-alpha 1 ii45 1 ii42 1 ii13 1 IHS 1 Ihl 1 Igualada 1 Igor 1 Iglesia 1 Igk-light 1 IGK 1 IGHG 1 IGH-FGFR3 1 IGH-CCND1 1 IgG-TCO 1 IgGs 1 IgGl 1 IgGk-secreting 1 IGF-Akt 1 Igarashi 1 Iftimia 1 IFN-g 1 IFNa 1 IFMTreduces 1 ifg-1 1 IFCN 1 IFB-Tx 1 Iezzoni 1 Iex 1 IEMBS 1 Ieke 1 IE-33 1 IDW 1 Idoate 1 idiosyncrasies 1 IDH1 1 Idezuka 1 Ideologies 1 identifined 1 Identifiler 1 identically 1 identi- 1 identfied 1 identfication 1 Idempotency 1 ideals 1 idealization 1 idealistic 1 iddle 1 idd 1 id547285 1 ID4 1 ICVR2011 1 ICTRP 1 icterus 1 icteric 1 iCT 1 ICSsex 1 ICS 1 icr 1 ICPR 1 I-converting 1 Ickes 1 ICIQ 1 icing 1 Ichinose 1 ICHD-3 1 ice-water 1 ICECT 1 ICD-CM 1 -ICD9CM 1 ICD-11 1 ICD- 1 ICD 1 ICBM 1 ICARE 1 ican 1 IC90 1 -IBZM 1 ibuprofen 1 ibrutinib-treated 1 ibrutinib-based 1 ibrutinib-associated 1 ibrutinib2 1 ibrutinib19 1 iBlot 1 IBL 1 IBD-related 1 IBD-invasive 1 ibapotib 1 ibandronate 1 I-band 1 Iba1-positive 1 iasp-pain 1 Iasonos 1 IASHFBGN-GF-BIO 1 IARS 1 IALP 1 Iain 1 Iagaru 1 IAAF 1 I99-114 1 i95 1 I916 1 i90 1 i69 1 i50 1 I34 1 I3 1 i29 1 I135 1 I103 1 hzurayk 1 Hyva 1 HYV 1 Hyun 1 Hyuen 1 hypoxia-ischemia 1 hypoxia-inducible 1 hypoxia-induced 1 hypoxia-driven 1 hypoxemia 1 hypovolemic 1 hypovitaminosis 1 hypovascularity 1 hypotony 1 hypothetically 1 hypothesis-guided 1 hypothesis-free 1 hypothesise 1 hypothesis-driven 1 hypothesis0 1 hypothalamus-pituitary-adrenal 1 hypothalamo-pituitary 1 hypo-synchronization 1 hypopyon 1 hypopneic 1 hypophyseal 1 hypophosphorylated 1 hypoperfusion 1 hypoperfused 1 hyponatremia 1 Hyponatraemia 1 hypomyelination 1 hypomorphic 1 hypomethylation 1 hypometabo-lism 1 hypometabolic 1 hypomania 1 hypokinesia 1 hypointensity 1 hypointense 1 Hypoglycemic 1 hypoglycemia 1 hypogammaglobulinemic 1 hypogammaglobulinemia 1 hypofractionated 1 hypo-fluorescence 1 hypoesthesia 1 hypodermal 1 hypocortisolemia 1 hypocellular 1 hypocatalasemic 1 hypocaloric 1 hypobetalipoproteinemia 1 hypobetalipoproteinaemia 1 hypobaric 1 hypoanxiety-like 1 hypoactive 1 hypo- 1 hypnic 1 hypervolumes 1 hypervascularity 1 hypertriglyceridemia 1 hypertonia 1 hyperthropy 1 hypertensives 1 hyper-resonance 1 hyperpnoea 1 hyperplane 1 hyperphatic-type 1 hyperoxygenation 1 hyperoxygenated 1 hyperoxic 1 hypermutation 1 hypermetabolism 1 hyperlobulated 1 hyperlinks 1 hyper-intensities 1 hyperinsulinemic 1 hyperinsulinemia 1 hyper-homocysteinemia 1 Hyperglycaemia 1 hyperflu 1 Hyperfilm 1 hyperextended 1 hyper-Doppler 1 Hyperdopaminergia 1 hyperdiploid 1 hypercircuit 1 hyper-cholesterolemia 1 hypercalcemia 1 hyperbolic 1 hyperbilirubinemia 1 hyper-baric 1 hyper-algesia 1 hyperalgesia 1 hyperaemic 1 hyperacute 1 hyper-activity 1 hyperactivation 1 hype 1 hyoid 1 Hyogo 1 hyo-epiglottoplasty 1 hyoepiglotto-plasty 1 Hynynen 1 Hyle 1 Hylarides 1 Hyer 1 Hyeong-Gon 1 Hye 1 hydroxylases 1 hydroxyl 1 hydroxy-cotinine 1 Hydroxycholesterol 1 hydroxychloroquinesulfate 1 hydroxychloroquineretinopathy 1 hydrops 1 hydronephrosis 1 hydromorphone 1 hydrolyzes 1 hydrolyze 1 hydrolysis 1 hydrolysate 1 hydrolocalization 1 hydrogen-deuterium 1 hydrochloric 1 hydro-carbon 1 hydrated 1 hydomorphone 1 Hyder 1 Hyden-Granskog 1 hybridomas 1 hy-bridization 1 Hybond-ECL 1 Hyberts 1 hyaline 1 H-Y 1 Hwangbo 1 Hvid 1 HuZ 1 Huynh 1 Huybrechts 1 HUVEC 1 Hutzal 1 HuttonM 1 Hutton 1 Huttenlocher 1 Hutmacher 1 Huth 1 Hutchison 1 Hutchinson-Gilford 1 Hutchins 1 Hutcheson 1 Hutcheon 1 Hutchens 1 Huston 1 Husseini 1 Hussein 1 Hussain 1 Huso 1 Huskisson 1 Husfeldt 1 Huse 1 Huschenbett 1 husband 1 Husain 1 HUs 1 Hurwitz 1 Hurvitz 1 hurts 1 hurting 1 HurtigH 1 Hurtig 1 Hur 1 Huppertz 1 Huntsville 1 Huntingtin-encoded 1 huntingtin 1 Hunsley 1 Hunninghake 1 Hunker 1 Hungs 1 Hunfeld 1 Hundt 1 Humphris 1 Humphrieset 1 Humphreys 1 Humphrey-Murto 1 humiliation 1 humidity 1 humidified 1 Humby 1 humble 1 humanumbilical 1 human-specific 1 humanPD 1 human-like 1 HumanitiesResearch 1 humangenerations 1 human-friendly 1 humanely 1 human-development 1 human-derived 1 HumanCommunication 1 humancentered 1 humanbrain 1 hu-man 1 Hulshoff 1 Huizinga 1 Huisgen 1 Huidy 1 Hui-Chou 1 Hui-Chan 1 Huh 1 Hugo 1 Hug 1 Hufford 1 Huff 1 Hufeland-Klinikum 1 Hufeland 1 Huettner 1 Huestis 1 Huesman 1 Hueppe 1 Hudsonet 1 Hudry 1 Hudecz 1 Hudak 1 Huda 1 Hubrech 1 Hubl 1 Hubert 1 Hubanks 1 huans 1 Hualde 1 Hua-Kang 1 Hua 1 HtrA 1 HTLV-2 1 HTLV-1-Tax 1 HTLV1-infected 1 HTLV 1 Htel-Dieu 1 HT115 1 hss 1 HSR 1 HSP90B1 1 Hsp70 1 hSNCA-specific 1 hSNCAin 1 hSNCAbehind 1 hSNCA140using 1 hSNCA140under 1 hSNCA140transgenic 1 hSNCA140showed 1 hSNCA140overexpression 1 hSNCA140-overexpressing 1 hSNCA140fused 1 hsf-1 1 HSD 1 hsCRP-an 1 HSC-4N35 1 Hruschka 1 Hrstka 1 HRSD 1 hronic 1 Hristov 1 hringer 1 HRECs 1 HREC 1 Hras-induced 1 H-Ras 1 HQ 1 Hp-Hb 1 HPF 1 HPC 1 HPB 1 HPA-2 1 HP1 1 Hoyng 1 Hoya-Arias 1 Hoxha 1 HOXD3 1 HOXC10 1 HOXB9 1 Hoxb8-promoter 1 HOXB7 1 HoxA5 1 Howren 1 Howorka 1 Howlett 1 Howitz 1 Howieson 1 Howie 1 Howes 1 Howe 1 Howatson1 1 Howatson 1 Hovsepian 1 hovered 1 hover 1 Hoven 1 Hovda 1 Houx 1 Houtrow 1 Hout 1 Houssier 1 Houser 1 householders 1 Houry 1 Houri 1 Houlihan 1 Houldin 1 Houdenhove 1 Houck 1 Houben 1 Hou1 1 Hotton 1 HotStarTaq 1 Hoth 1 hot-cold 1 Hotchkiss 1 hostility 1 HospitalQualityInits 1 Hospitalist 1 Hospitalet 1 hospitalcompare 1 Hospital-Asil 1 hospital-acquired 1 hospice-care 1 Hosokawa 1 Hosmane 1 Hoskins 1 Hosker 1 Hosie 1 Hoschl 1 Hos 1 Horswell 1 Horsfield 1 Horrevoets 1 Horowitz 1 Hornychova 1 Hornery 1 Horner 1 Hornegger 1 hormone-releasing 1 hormone-refractory 1 hormetic 1 Hormes 1 Horlocker 1 Horl 1 Horky 1 Horkko 1 Horiuchi 1 Hordijk 1 hordeolum 1 Horbar 1 Horan 1 Horak 1 hopping 1 Hoppe-Seyler-Str 1 Hopper 1 Hopman 1 HopkinsJ 1 hopeless 1 hopeful 1 Hooper 1 Hoop 1 hooks 1 hook 1 Hooijkaas 1 Hooda 1 Honore 1 honorary 1 Honkanen 1 Hongying 1 Hongsawad 1 honey-comb 1 hone 1 Honberg 1 Hompes 1 homozygotes 1 homopolymers 1 Homoplasmy 1 homoplasmic-pattern 1 homoplasmic 1 homo-oligomers 1 homologues 1 homologue 1 homogenizing 1 homogenize 1 homogenization 1 homogeneously 1 homo-geneous 1 homodimers 1 homocysteine-induced 1 homeschooling 1 Homer 1 home-prepared 1 homeosta-sis 1 homeless 1 homeandrecreationalsafety 1 Homburg 1 Holzwarth 1 Holzemer 1 holy-grail 1 Holtzheimer 1 Holtbrugge 1 Hologic 1 holocaust 1 Holmquist 1 Holmgren 1 Holme 1 Holman 1 Hollstein 1 hollow 1 Hollmann 1 Hollingsworth 1 Holle 1 Holland-Bouley 1 holidays 1 Holgate 1 Holdsworth-Carson 1 Holdings 1 Holbrook 1 Hoksrud 1 Hokanson 1 Hohmann 1 Hohman 1 Hogue 1 Hogstrom 1 Hogikyan 1 Hogendoorn 1 Hoge 1 Hogart 1 Hoftberger 1 Hofstra 1 Hofstetter 1 Hofmockel 1 Hofmeyr 1 HoffmanS 1 Hofele 1 Hoeve 1 Hoepital 1 Hoenicka 1 Hoelzinger 1 Hoekstra 1 Hoehn 1 Hoehe 1 Hoefsloot 1 Hoefnagel 1 Hoechst-33342 1 Hoechst 1 Hoechberg 1 Hoeber 1 Hodgins 1 Hoddinott 1 Hod 1 Hockley 1 Hock 1 Hochstein 1 Hochsmann 1 Hochschule 1 Hochman 1 Hochberg-Bonferroni 1 Hobel 1 Hoare 1 Hoadley 1 hnRNPA1may 1 hnRNP 1 HNO 1 HNLBI 1 hnl 1 hnehealth 1 Hnatowich 1 HMPAO 1 Hmga2 1 HMA 1 Hlubek 1 Hlth 1 hldorf 1 Hlavac 1 HL61753 1 HL087120 1 HL079611 1 HL071021 1 H-K 1 Hjortdal 1 HIV-RNA 1 HIV-LTR 1 HIVdataset 1 HIV-1-infected 1 hitting 1 Hitters 1 Hitoshi 1 Hitchman 1 Hitachi 1 histotypes 1 history-related 1 Histopathologists 1 histopathologically 1 histone-peptide-array 1 histone-bound 1 his-tone 1 Histologie 1 histo-logic 1 Histogram-based 1 histogenesis 1 his-tochemically 1 histiocytomas 1 Hist 1 His-D-Phe-Arg-Trp 1 His- 1 Hirvonen 1 Hirota 1 Hiromi 1 Hiroki 1 Hirnrinde 1 Hirnforsch 1 Hirneiss 1 Hirakawa 1 Hirai 1 hippo-campus 1 HIPK2 1 HIPAAprotects 1 Hioki 1 Hinz 1 hinted 1 hint 1 Hinnebusch 1 Hinn 1 Hinkis 1 Hinkel 1 hinges 1 Hinds 1 hindrance 1 Hindman 1 hind-limb 1 hindlimb 1 hindawi 1 Hinchey 1 Himberg 1 Himalayan 1 Hilty 1 Hilton 1 Hillsdale 1 Hillis 1 Hillier 1 Hilliard 1 Hiller 1 Hillegass 1 Hillan 1 HILIC 1 Hildesheim 1 Hilderbrand 1 Hilde 1 Hilbrands 1 Hilbe 1 Hilario-Vargas 1 hiking 1 Hijdra 1 Hijazi 1 Hiikkinen 1 Higuchi 1 HighWire-hosted 1 Highway 1 high-velocity 1 high-titre 1 highthroughput 1 high-through 1 high-stress 1 high-stakes 1 high-specific-activity 1 High-sensitive 1 high-saturated 1 highrisk 1 high-resolu-tion 1 highresolution 1 High-reproducible 1 HighPure 1 high-protein 1 high-power 1 high-poverty 1 high-molecular-weight 1 high-mobility 1 high-low-medium-load 1 Highlevels 1 Highland 1 high-input 1 high-fructose 1 high-field 1 highest-risk 1 highest-ranked 1 higher-volume 1 higher-value 1 higher-than-average 1 higher-ranking 1 higher-order 1 higher-level 1 higher-energy 1 high-dosage 1 high-dimensional 1 high-dimension 1 High-cost 1 high-contrast 1 high-cardiovascular-risk 1 high-cardiovascular 1 high-carbohydrate 1 high-calorie 1 high-afinity 1 high-acuity 1 Higbie 1 Higbee 1 Higano 1 HIF-1alpha 1 HIF-1 1 Hietanen 1 Hiemstra 1 hide 1 Hida 1 Hicking 1 Hickey 1 hhu 1 HHSN261200800001E 1 HHSH 1 HG-U133 1 HF-specific 1 hfeld 1 Hezel 1 Heyndrickx 1 Heyndels 1 Heynck 1 Heyman 1 Heymach3 1 Heye 1 Heyden 1 hexokinase 1 hexamers 1 hexagon 1 hEx51F 1 HEX 1 Hewlett 1 Heutink 1 heuristically 1 Heuckmann 1 Hetzer 1 Hetzel 1 Hettstedt 1 Hetrick 1 Hetherington 1 Hetet 1 heterozygosis 1 heterotypic 1 heterotrimeric 1 heterotopia 1 heteropolymers 1 heteromeric 1 heterogenic 1 heteroge-neous 1 heterochronicity 1 heterochronic 1 heterochro-matin 1 heterochromatin 1 heterochromatic 1 hetero 1 hetastarch 1 hest 1 hesonline 1 Heslin 1 Hesler 1 Heskamp 1 Hesk 1 hesitations 1 hesi 1 Heschl 1 hes1 1 Herzlich 1 Herzer 1 Herz 1 Herve 1 Hertog 1 Hertlein 1 Hertl 1 Hertel 1 Hert 1 Herston 1 Herstal 1 Hershman 1 Hersheson 1 Herschbach 1 Hersch 1 Herrstrom 1 Herrmann 1 Herrlinger 1 Herrick 1 Herrera 1 Herrarte 1 Heron 1 heroin-related-deaths-in-the-u-s 1 Heroin-related 1 heroin-dependent 1 heroic 1 herniated 1 Hernand-Sanchez 1 Hernandez 1 Herna 1 Herms 1 Hermosilla 1 Hermine 1 Hermien 1 Hermens 1 hermaphrodite 1 Hermanson 1 Hermann 1 Herken 1 heritable 1 Herishanu 1 Heriot-Watt 1 Herfkens 1 heretofore-unlinked 1 Herestraat 1 Herchuelz 1 Herchel 1 Herceptin 1 Herbst 1 Herbosa 1 -Herbert-Nieper-Krankenhaus 1 Herala 1 HER-2-expressing 1 HER2-binding 1 Hepworth 1 Heppner 1 Heppeler 1 Hepp 1 hepatoprotective 1 hepatoprotection 1 Hepatogastroenterology 1 hepatocyte 1 hepatocelluar 1 hepatocarcinogenesis 1 hepatobiliary-gastrointestinal 1 hepaticresection 1 he-patic 1 heparinase 1 Henselmans 1 Henriksen 1 Henningsen 1 Hennig 1 Hennerici 1 Hennepin 1 Hennenlotter 1 Henley 1 Henkle-D 1 Henkind 1 Henkelman 1 Henke 1 Henk 1 Henikoff 1 Henggeler 1 Heneweer 1 Hendrickx 1 Hendrata 1 Henderson-Smart 1 Hen 1 Hemphill 1 hemorrhoidectomy 1 hemor-rhagic 1 hemorrhage-induced 1 hemopericardium 1 hemolyzed 1 hemolysates 1 hemolysate 1 hemo-globin 1 Hemogard 1 hemodynamical 1 hemodilution 1 hemodialysis 1 Hemmy 1 hemizygous 1 hemisensory 1 Hemil 1 hemifield 1 hemidesmosomal 1 hemicolectomy 1 hemianesthesia 1 hemeproteins 1 hematoxylin-eosin 1 hematocrit 1 hemangioma 1 hemangiogenesis 1 Helzlsouer 1 helpfulybecause 1 Helmholtz 1 Hellstrom 1 Hellstein 1 Hellkamp 1 Hellesnes 1 Hellersdorf 1 Heller 1 Hellemons 1 Helkala 1 helium 1 helices 1 helically 1 Helge 1 helenmcnamara 1 Helayel 1 Helali 1 Hekkert 1 Hejblum 1 Heitzeg 1 Heisler 1 Heise 1 Heinzer 1 Heinz 1 Heinssen 1 Heinsen 1 Heinemann 1 Heine 1 Heindl 1 Heimans 1 Heimann 1 Heilmeyer 1 Heilig 1 Heikenwalder 1 Heijmans-Antonissen 1 heighten 1 Heier 1 Heiderscheit 1 Heidenreichet 1 Heidenreich 1 Heidari-Rostami 1 Hegde 1 Hegarty 1 Heffron 1 Heerlen 1 Heerden 1 Heerbeek 1 heel 1 Hedwig-shohe 1 Hedwig-Krankenhaus 1 Hedrick 1 Hedman 1 Hede 1 Heddings 1 Hedden 1 hectic 1 Heckmann 1 Hebro 1 Hebert-Blouin 1 Hebenstreit 1 Hebbar 1 heaviness 1 heatstroke 1 heat-pinch-cold 1 heatmaps 1 Heathcare 1 Heath 1 heatdenatured 1 heart-related 1 HeartFail 1 heartbreak 1 heartbeat 1 Heartache 1 hears 1 hearingloss 1 Hean 1 healthyaging 1 health-state-specific 1 health-seeking 1 healthit 1 health-ier 1 Healey 1 Heales 1 healed 1 Heald 1 heal 1 head-shaking 1 headlines 1 headline 1 HeadleyAJ 1 headed 1 Head-ache 1 -Head 1 HDxt 1 HDR-XR200VE 1 HDRB 1 HDO57022 1 HDM2-mediated 1 HDLs 1 HDL-mediated 1 hdeng008 1 HDAC6-Hsp90 1 HDAC4 1 HDAC3 1 HD250 1 HD050369 1 HD041899 1 hcup-us 1 hcupnet 1 HCT116 1 HCGHR 1 HCA-was 1 H-C 1 HBOC-more 1 HBOC- 1 HBIPS 1 HBCO-201 1 HbA 1 Hazzard 1 Hazuda 1 Hazlett 1 Hazime 1 Hazif-Thomas 1 Hazen 1 Hazebroek-Kampschreur 1 Hazan 1 Haza 1 Hayward 1 HayesSC 1 Haye 1 Haybaeck 1 Hayakawa 1 Haxer 1 Hawley 1 Hawker 1 Hawdon 1 Hawasli 1 Hawaiian 1 Hawaii 1 Havlik 1 havea 1 havarian 1 Hautarzt 1 Haussermann 1 Hauser 1 Haus-dorff 1 Hauptmann 1 Haughton 1 Haug 1 Haubitz 1 Hau 1 Hatzigeorgiou 1 Hatzidaki 1 Hatoum 1 Hatjis 1 Hatin 1 Hathaway 1 hatha 1 hate-groups 1 hatching 1 Hastings 1 hastened 1 Hastan 1 Hassink 1 Hassfjell 1 Hassett 1 Hassel 1 Haskell-Luevano 1 Hasheminasab 1 Hashemi 1 Hasday 1 Haschke 1 Hasbold 1 hasbeen 1 Harview 1 harvests 1 har-vested 1 Haruyama 1 Haruki 1 Hartz 1 Hartsell 1 HartogJW 1 Hartog 1 Hartikainen 1 Hartialaet 1 Hartiala 1 Hartholt 1 Hartgens 1 harrymg 1 harrymclaughlin 1 Harrow 1 Harrold 1 Harrogate 1 Harrisonet 1 Harriet 1 Harries 1 Harpin 1 Harousseau 1 Harnish 1 harnessing 1 harnesses 1 Harmuth 1 harm-reduction 1 harmonizing 1 Harmonisation 1 Harmonin 1 harming 1 harm-free 1 Harmelen 1 Harman 1 Harland 1 Hariprasad 1 Harino 1 Haring 1 Haren 1 Harel 1 Hare 1 Hardy-Weinberg 1 hard-working 1 hard-wiring 1 hard-wired 1 hardwire 1 Hardt 1 hardship 1 hard-pressed 1 Hardman 1 hardcopies 1 Harburg 1 harbours 1 Harazny 1 Harasawa 1 Haran 1 Haracopos 1 hapten 1 HA-PS-IkBalpha 1 happening 1 haplotypic 1 haplo-types 1 haplotypein 1 haplogroupsJ 1 haplo 1 Hao 1 Hanusch 1 Hanusa 1 Hantzigeorgiou 1 Hanton 1 Hanssens 1 HansonAY 1 Hansjuerg 1 Hans-Joachim 1 Hansberry 1 Hanning 1 Hann 1 Hanlon 1 Hankey 1 Hanin 1 Hanimann 1 Hanig 1 hanging 1 Hangai 1 Hanet 1 Hanekom 1 Handycam 1 Handy 1 handwriting 1 Handsfield 1 Handorf 1 Handoffs 1 handbooks 1 HanChinese 1 Hananel 1 Hanan 1 Hanafi 1 han00364 1 Hamurtekin 1 Hamunen 1 hamstrings 1 Hamrick 1 Hamos 1 Hamnegrad 1 Hamnegard 1 Hammersen 1 Hammers 1 Hammer 1 Hamm-Clement 1 Hammarqvist 1 Hamilton-Dutoit 1 Hamers 1 Hamburg-Eppendorf 1 Hamblin 1 Hambel 1 Hamasaki 1 Hamadeh 1 Hama 1 Halyard 1 Halwani 1 Halvorsen 1 halved 1 Halton 1 Halterman 1 Halter 1 Halsted 1 halsives 1 Halpin 1 Halpern 1 Halpain 1 halothane 1 Halm 1 hallux 1 Halliwell 1 Halling 1 Hallidaya 1 Halle 1 Hallal 1 Halkein 1 Halim 1 Halilamien 1 halfway 1 halftone 1 Halfon 1 half-maximum 1 half-court 1 Halene 1 Haldar 1 Halbwedl 1 Hakim 1 Haker 1 Hakansson 1 Hajek 1 Hajari 1 Haisch 1 Hains 1 Hainfeld 1 hailed 1 Haiko 1 Haigh 1 Haiem 1 Haider 1 Haiden 1 Haibi 1 Hagop 1 Hagiwara 1 Haghnejad 1 Hagglund 1 Hagerstrom 1 Hagerstown 1 Hagemann 1 Hage 1 Haga 1 Haffez 1 Hafeman 1 Haesendonck 1 Haertter 1 Haenzel 1 Haentjens 1 Haenszel 1 haemostatic 1 haemorrhages 1 haemo-poietic 1 haemopoietic 1 haemolytic 1 Haemolysis 1 haemoglobin-based 1 haemodynamically 1 Haemo-dynamic 1 haemodilution 1 haematuria 1 haem 1 Haegeman 1 HAECwhile 1 HAECs 1 HAEC 1 Hadzi-Pavlovic 1 Hadwiger 1 hadsymptoms 1 HADS 1 Hadjivassiliou 1 Hadjistavropoulos 1 Hadjiminas 1 Hadipour-Niktarash 1 Hadimioglu 1 Hademenos 1 Haddow 1 Hackmann 1 Hackett 1 Hack 1 Habli 1 habitus 1 habituation 1 habituate 1 habit 1 Haberkorn 1 Haberkern 1 Haatanen 1 Haataja 1 Haass 1 Haase 1 HAART-suppressed 1 Haar 1 Haapanen 1 Haan 1 Haahr 1 Haag 1 Haack 1 H9 1 H87PG 1 H866-H873 1 h51r 1 H50Qvariant 1 H50 1 H4-K16 1 H4502 1 H3K4me1 1 H3A1A1 1 H2X 1 H2O2and 1 H1103 1 H1060 1 H-1000 1 GZMB 1 GZ 1 GyureKA 1 Gyulai 1 Gynaecologie 1 GylysKH 1 Gygax 1 GYF 1 Gybels 1 GX 1 Gwye 1 GWTG 1 Gwinn 1 Gwilym 1 Gweon 1 Gwathmey 1 GWA 1 Guzzardo 1 Guye 1 Guttmann 1 Guttman 1 Gutteridge 1 guttate 1 gut-origin 1 Gutmann 1 Guthrie 1 Gustin 1 Gusterson 1 gustaveroussy 1 Gustav 1 Gustaaf 1 Gussow 1 Gusse-kloo 1 Guskiewicz 1 Gusella 1 Gurwood 1 Gurwitz 1 Gurtner 1 Gurtler 1 Gurova 1 Gurney 1 Gurlo 1 Gurling 1 Gureje 1 Gurcan 1 Gur 1 Gunzburg 1 guntinas 1 Gunstad 1 Gunma 1 Guney 1 Gundersen 1 Gunde 1 Gunby 1 Gunaratne 1 gun 1 Gummersbach 1 Gumerlock 1 gum 1 Gulsun 1 Gulshan 1 Gullstrand 1 Gulkilik 1 Gulisano 1 Gulbins 1 Gulati 1 GUK1 1 Guitter 1 Guisasola 1 Guire 1 Guimaraes 1 Guillozet-Bongaarts 1 Guillot 1 Guillonneau 1 Guillermina 1 Guillem 1 Guillausseau 1 Guil-lain 1 Guildford 1 Guild 1 Guigui 1 Guigo 1 Guidotti 1 Guidolin 1 guidelines-browse 1 guidelines49 1 Guidebook 1 GUIDANCE-October-2012-FINAL 1 GuidanceComplianceRegulatoryInformation 1 Gug-gisberg 1 Guggisberg 1 Gugelmann 1 guez-Capote 1 Guetta 1 Guessous 1 guessing 1 guessed 1 Guessan 1 Guertler 1 Guerrero 1 Guerreiro 1 Guerin 1 Guenot 1 Guellec 1 Guberek 1 Guastella 1 Guarino 1 guarded 1 guarantor 1 guaranteed 1 guanosine 1 guanidinomethyl-3-trimethylstan-nylbenzoate 1 guanidinium 1 GualtieriC 1 Gualtieri 1 Guallar 1 Gualberto 1 Guadagnolo 1 GTS-related 1 GTPases 1 GSTT1 1 GSTs 1 GST-H4 1 GST-H2A 1 gst-4p-driven 1 GSPD 1 GSK-3b 1 G-sepharose 1 GSE9782 1 GSE54177 1 GSE54163 1 GSE44968 1 GSD 1 Grzybowski 1 Gruttola 1 Grutter 1 Grusby 1 Grupp-Phelan 1 gruppo 1 Grunstein 1 Grunnet 1 Gruner 1 Grundz 1 Grundformen 1 Gruman 1 Grujicic 1 Gruenewald 1 Grubb 1 Groy 1 growth-suppressive 1 growth-promoting 1 growth-factor-1 1 Growdon 1 Groves 1 Grover 1 group-think 1 group-specific 1 group-related 1 group-oriented 1 group-love 1 groupings 1 GroupFICB 1 Groupers 1 groupdfrom 1 group20 1 group1 1 ground-truth 1 Groth 1 Grotegut 1 Grosso 1 Grossmann 1 Grosskreutz 1 Grossbart 1 Groscurth 1 Groppe 1 Grootendorst 1 Groote 1 Groom 1 Grond 1 grommet 1 Groenkloof 1 Groenhof 1 Groenendaal 1 groceries 1 Grobholz 1 Grobbelaar 1 Grobbee 1 GRO1 1 Gro 1 GRK6 1 Grizzle 1 Gritti 1 Grip-D 1 Grinnan 1 Grinberg 1 GRIN 1 Grimmer 1 GRIM3 1 Grillner 1 Grigorian-Shamagian 1 Grigorian 1 Grifols 1 Griffioen 1 Griffin 1 Grieve 1 Griesinger 1 Griesemer 1 G-rich 1 Gribble 1 Greyhoundbus 1 Grevelding 1 Gressens 1 Grespi 1 Greipp 1 Greim 1 Greif 1 Gregorevic 1 Greerand 1 Greenwood-Ericksen 1 Greenwood 1 Greenwich 1 Greenwald 1 Greenstein 1 Greenspace 1 Greenson 1 Greengard 1 Greenfield 1 Greenbaum 1 Gredler 1 Gredilla 1 Greck 1 Grecco 1 Grebe 1 greater-than 1 Grbovic 1 GRB10-interacting 1 Graziano 1 Graziadei 1 gray-levels 1 gray-level 1 Graybiel 1 Gray23 1 Graw 1 gravity 1 gravidity 1 gravide 1 Gravenmaker 1 Gravendijkwal 1 Gravante 1 Gravallese 1 Graus 1 Graubard 1 Grau 1 grating 1 Gratema 1 gratefully 1 Gratama 1 Grassl 1 Grass-Kapanke 1 Grass 1 grasping 1 grasped 1 grasp 1 GRAPPA 1 GraphPad-QuickCalcs 1 graphed 1 grapes 1 granulopoiesis 1 granulomas 1 granuloma 1 granulocytopenic 1 Grants-in-Aids 1 Grant-in-Aid 1 GrantinAid 1 Granollers 1 Granhall 1 Grangeat 1 Graner 1 Grandis 1 Grand-in-Aid 1 grand-average 1 Granata 1 Granacher 1 Grams 1 Grammeret 1 grammatically 1 grammatical 1 grammar 1 Gramer 1 grains 1 grain 1 GRAID 1 Gragoudas 1 graft-versus-host 1 Grafe 1 Graf 1 Graemmel 1 Graeff 1 Graeber 1 Grading19 1 gradientecho 1 Gradient-Based 1 gradepro 1 Grade6to8 1 Gracy 1 Graciela 1 Grabowski-Abramson 1 Grabowski 1 Grabocka 1 grab 1 Graaff 1 Graa 1 Gra 1 Gr-1 1 GPSports 1 GPS-accelerometer 1 GPS 1 Gp120-CCR5 1 Gozes 1 Gozalo 1 Goyal11 1 Goyal 1 Goy 1 Gowland 1 Gower 1 Govindan 1 Govind 1 governs 1 governor 1 Govan 1 Gouya 1 Gourtsoyianni 1 Gournay 1 Gourmelin 1 Gourley 1 Goupil 1 Goulet 1 Goulding 1 Gougeon 1 Goudie 1 Goude 1 Goubert 1 Gotzsche 1 Gottsch 1 Gotto 1 Gottlieb11 1 Gottfries 1 Gottesman 1 Gotta 1 Gotshall 1 Gotoh 1 Gotha 1 Gostin 1 Gossop 1 Gossell-Williams 1 Gosselin 1 Gossage 1 Gospel 1 Goslar 1 Gosey 1 Gosbee 1 Gosal 1 Gorzov 1 Gorwitz 1 Gorur 1 Goru 1 Gortmaker 1 Gorski 1 Gorska 1 Gorrini 1 Gorrindo 1 Gormley 1 Gorin 1 Gori 1 Goretsky 1 Gores 1 Gore 1 Gordillo-Moscoso 1 Gorby 1 Goossens 1 Goody 1 Goodwin 1 good-to-very-good 1 Goodrick 1 Good-quality 1 Goodpaster 1 Goodney 1 goodness-of-fit 1 goodness-of- 1 goodness 1 Goodkin 1 Goodhouse 1 Goodchild 1 Goodall1 1 Gonzalez-Hilarion 1 Gonzalez-Freire 1 Gonzalez-Badillo 1 Gonzalez-Alonso 1 Gonzales 1 Gonza 1 goniometric 1 goniometer 1 Gongrich 1 Goncharova 1 Goncharov 1 Goncalves 1 gonads 1 gonadotropin-releasing 1 gonado-trophin 1 gomilpitas 1 Gomez-Sanchez 1 Gomez-Esteban 1 Gomes 1 Gombrich 1 Gollub 1 Gollnick 1 Golian 1 golgistained 1 Goldwurm 1 Goldstraw 1 Goldstein-Muller 1 Goldstar 1 Goldschneider 1 Goldkorn 1 Goldin 1 Goldbourt 1 Goldblatt 1 Goldacre 1 Gold- 1 Golberstein 1 Golbaz 1 Golay 1 Golan 1 Gokce 1 Gok 1 goire 1 Goin-Kochel 1 Goias 1 Goi 1 Gohier 1 Gohel 1 Goharian 1 Goglia 1 goggles 1 Gogel 1 GOFs 1 Goetze 1 Goetghebeur 1 Goessler 1 Goerres 1 Goerlitz 1 Goerdt 1 Goedicke 1 Goede 1 Goeckeler 1 Godoy 1 Godolias 1 Godden 1 Goddard 1 Godbey 1 Godard 1 Godar 1 Goda 1 Gocek 1 Goate 1 Goadsby 1 Gnanapragasam 1 Gnaiger 1 gmx 1 GMN-G 1 GMMs 1 GMMJ 1 GME 1 gmatch 1 GM098308 1 GM065211 1 Glycoxidized 1 glycoxidation 1 glycolytic-derived 1 glycogen-derived 1 glycine-negative 1 glycer-aldehyde-3-phosphate 1 glyceraldehyde 1 glycemia 1 glycated 1 Gluth 1 gluteraldehyde 1 gluten-free 1 gluten- 1 glutaredoxin 1 glutaraldehyde 1 glutamate-using 1 glutamatergically 1 glutamate-related 1 glutamate-induced 1 GluR7 1 GluR1 1 GluN2B 1 Glujovsky 1 glucosyl 1 Glucose-Test-Ace 1 glucose-induced 1 glucose-6-phosphate 1 glucose-6-phosphatase 1 glu-cose 1 glucose- 1 gluconeogenesis 1 glucometer 1 Gluco-corticoids 1 glucocorticoid-mediated 1 Glucocorticoid-induced 1 Gluck 1 glucagon 1 glp-1 1 Gloushankova 1 glottic 1 glomerulopathy 1 globules 1 globes 1 Glob 1 Glitz 1 glioneuronalheterotopia 1 glioma-CpG 1 glioblas-tomas 1 glinger 1 glimpses 1 Glicksman 1 glia-pain 1 Glialchoristomain 1 glia-derived 1 Glenview 1 Glenn 1 Glenda 1 Glazier 1 Glaukos 1 glaucoma13 1 Glauchau 1 Glassock 1 Glassman 1 glasses 1 Glanz 1 Glaholm 1 Gladwin 1 Gladwell 1 Glabus 1 Glabe 1 gla 1 GKV 1 Gkliatis 1 GKGGAKRHRKV 1 Gjoerup 1 Gjesdal 1 Gjerstad 1 Gjeilo 1 Giza 1 giventest 1 Givelber 1 Giusti 1 Giust 1 Giugno 1 Giuffre 1 Gitenay 1 Gissler 1 Gissi 1 Gispert-Sanchez 1 Gisela 1 Gisborne 1 Girtovitis 1 Girona 1 Girmens 1 GIRK2 1 Gire 1 Giraudon 1 Giraudo 1 Giraud 1 Girardot 1 Giralt 1 Gipponi 1 Giovannucci 1 Giovangrandi 1 Giorgio 1 Giordano 1 Giordani 1 giogenic 1 Gioftsidou 1 Ginter 1 Ginneken 1 Ginjaar 1 Ginj 1 gingiva 1 Ginghina 1 Gingeras 1 Ginet 1 Gine 1 Gincherman 1 Gimona 1 Gimenez 1 Gim 1 Gilmour 1 Gilmore 1 GilmanS 1 Gillon 1 Gillings 1 Gillian 1 Giller 1 Gillatt 1 Gillard 1 Gillam 1 Gilhus 1 Giles-Corti 1 Giles 1 Gilchrest 1 Gilard 1 Gijn 1 gih 1 GIGYF2 1 GIGANTESCO 1 Gif-sur-Yvette 1 Gif 1 Giessen 1 Giese-Davis 1 Giesebrecht 1 Giel 1 Giegerich 1 Giedrojc 1 Gidlof 1 Giddings 1 Gibson4 1 Gibco 1 Gibbstown 1 Giardina 1 giant-cell 1 Giangrande 1 Giandolini 1 Giancardo 1 Gianaroli 1 Giacino 1 GHz 1 ghts 1 Ghoreschi 1 Ghoneim 1 Ghiran 1 Ghikaa 1 Gherbassi 1 Ghebremedhin 1 Ghazizadeh 1 Ghayathri 1 Ghandour 1 Ghali 1 Ghadimi 1 GGTGGTATTGGTCTGCTGAA 1 GGCATCACCAACTTCGACA 1 Gfroerer 1 gforge 1 Geyer 1 Gevorg 1 Geuns 1 Geula 1 Geudelin 1 Getz 1 gets 1 geteyesmart 1 Getachew 1 gestural 1 Gestio 1 Gestewitz 1 gestationis 1 gestalt 1 Gesells-chaft 1 Gesell 1 Gerwin 1 gerven 1 Gertz 1 Gert 1 gershwin 1 Gershonand 1 Gershman 1 Gerritsen 1 gerontologie 1 geronto 1 Gerold 1 germlineless 1 Germiniani 1 Germany-wide 1 germane 1 Gerlinger 1 Gerdle 1 Gerda 1 Gercel-Taylor 1 Ger-bershagen 1 Gerbershagen 1 Gerbasi 1 Gerards 1 Gerard 1 geranylgeranyl 1 Geraisy 1 Gera 1 Georgopoulos 1 Georgioua 1 Georgios 1 Georgel 1 georgeinstitute 1 Georg 1 Geo-Information 1 geographically 1 geo-graphic 1 Geografia 1 Geoffroy 1 Geocadin 1 Genzyme 1 genu 1 Gentxo 1 Gentry 1 Gentile 1 Gentil 1 GenSciences 1 Gensch 1 genotype-specific 1 genotypeon 1 geno-type-dependent 1 geno-type 1 genotoxicity 1 genomicresources 1 genome-euro 1 genomeby 1 Geno 1 genitalia 1 GenInfo 1 Genie 1 genic 1 Gengyo-Ando 1 Genetools 1 Genetique 1 genetic-related 1 geneticists 1 Genetic-epigenetic 1 genetic-environmental 1 geneticand 1 geneticallyheterogeneous 1 Genest 1 genesreveal 1 GeneSpring 1 Genesnap 1 genesin 1 generelated 1 general-purpose 1 generalizes 1 generalization 1 generalist 1 generalise 1 generalisable 1 generalisability 1 generale 1 gener-5D 1 GenePD 1 gene-nutrient 1 Gen-entech 1 geneidentified 1 gene-gene 1 gene-environment 1 gene-encoding 1 gene-dosage 1 gene-diet 1 GeneChip 1 geneand 1 gene-1 1 Gendreau 1 Gender-related 1 gender-matched 1 genderdon 1 gender-comparative 1 GEMMs 1 GEMM-derived 1 Gemma 1 Geminiani 1 Gemert 1 gemcitabine-resistant 1 Gelre 1 Gelmon 1 gel-bound 1 gelatinized 1 gelatinases 1 Gelal 1 gelaehmten 1 Gekka 1 Gekeler 1 Geisingen 1 Geisbert 1 Gehlken 1 Gehl 1 Geghman 1 Geest 1 Geerling 1 Geerke 1 GEE 1 Gedda 1 gedanken 1 gears 1 gearing 1 gear 1 Gd-DTPA 1 GD2 1 gcu 1 -GCTGGGTACAGTTATCCCCCT-3 1 GCTGAGTATGTCGTGGAGTCTA 1 GCSF 1 gcs-1 1 gchantada 1 GCCATACACAAGAG 1 GBR12909 1 GBP3 1 GBP1 1 GBP 1 GBD 1 gazing 1 gaze-throw 1 Gaynes 1 Gaveriaux-Ruff 1 Gaver 1 gauze 1 Gautron 1 Gauster 1 Gauler 1 Gaul 1 Gauderman 1 Gaucher 1 Gatts 1 Gatto 1 gatherings 1 gatewayto 1 Gater 1 Gatenby 1 GatehouseS 1 Gatan 1 GATA 1 gastrointestinal-related 1 gastro-intestinal 1 gastroin-testinal 1 Gas-troenterology 1 gastrin 1 GAS-to-body 1 Gaster 1 Gastambide 1 Gassen 1 Gaspari 1 Gaskin 1 gas-guided 1 Gases 1 gaschromatograph 1 Garzozi 1 Garzon 1 Garzel 1 Garzanti 1 Garza 1 Garvin 1 Garvey 1 Garvan 1 Gartlehner 1 Garten 1 Garscube 1 Garrod 1 Garrido 1 Garrick 1 Garrenton 1 Garraux 1 Garonzik-Wang 1 Garnotel 1 Garnier 1 garnering 1 Garner 1 Garmisch-Partenkirchen 1 Garmel 1 Garite 1 Garhammer 1 Gargus 1 Gargasson 1 Gargano 1 Gardiner 1 gardening 1 Garden 1 Gardella 1 Garcia-Silva 1 Garcia-Sierra 1 Garcia-Osuna 1 Garcia-Horsman 1 Garcia-Gorostiaga 1 Garcia-Consuegra 1 Garcia-Cazorla 1 Garcia-Caballero 1 Garcia-Benitez 1 Garcia-Bengochea 1 Garcia-Arumi 1 Garcia-Aguilar 1 Garce 1 Garca 1 Garc 1 Garbitt 1 Garber 1 Garatacheaet 1 Gar 1 Ganzel 1 Gans 1 Gannon 1 Gann 1 Ganjavi 1 Gangnon 1 Gangaputra 1 Ganesan 1 Gandek 1 Gan 1 Gamper 1 Gamna 1 gamma-tocopherol 1 gammamutation 1 gammainduced 1 gamma-emission 1 gamma-Counter 1 gamma-amino-butyric-acid 1 gamma-aminobutyricacid 1 gammaaminobutyric 1 gamma-1 1 gamete 1 Gameren 1 Gamelli 1 Gamel 1 game-action 1 Gambloux 1 Gambini 1 Galvan-Aguilera 1 Galteau 1 Gallucci 1 Gallou 1 Gallorini 1 gal-lop 1 Gallo 1 Gallivan 1 gallium-labeled 1 gallium 1 Gallino 1 Gallezot 1 gallbladder 1 gallate 1 Gallacher 1 Gall 1 Galimberti 1 Galim 1 Galie 1 Galicia-Castillo 1 Galic 1 Gald 1 Galbreath 1 Galban 1 Galazka-Friedman 1 Galatea 1 Galantino 1 Galanos 1 Galan 1 GalambosC 1 Galacto-RGD 1 Gala 1 GAL4-UAS 1 Gal4-driven 1 Gal4DBD-MDT-15 1 Gal4AD 1 GAL4 1 Gal11p 1 -Gal 1 Gal 1 Gajulapalli 1 Gajraj 1 gaitretraining 1 gait-oriented 1 Gainkam 1 gainful 1 Gaillien 1 Gaida 1 Gai 1 Gagov 1 GagneR 1 Gagne 1 G-agarose 1 Gagarine 1 Gagandeep 1 gag 1 Gafa 1 Gaetz 1 Gaedicke 1 Gaede 1 Gaebel 1 Gadovist 1 gadolinium-based 1 gadolinium 1 Gadobenate 1 Gadgil 1 gAC-mediated 1 GAclinicopathological 1 Gackowski 1 Gackowska 1 Gabrielson 1 Gabrielli 1 GABRB3 1 GabramS 1 Gabra 1 Gaborit 1 Gablofen 1 Gabilondo 1 Gaber 1 Gabel 1 Gabbay 1 Gabay 1 GABA-related 1 GABA-gated 1 GABAerigc 1 GABA-enhancing 1 GABAB 1 GABA-A 1 Gaafary 1 G9545 1 G906919 1 G7 1 G65 1 G6378 1 G634-G642 1 G60 1 G50 1 G5 1 g4793 1 G4 1 G3G4 1 G30 1 G233T 1 G209Amutation 1 G1-phase 1 G11 1 G1068-G1077 1 G1001C 1 G0700718 1 G0700704 1 G0700355to 1 G0 1 -G 1 Fyles 1 FXR 1 FX380 1 FWHM 1 FWF 1 FV 1 fuzziness 1 fuzzier 1 Futter 1 futility 1 Futakuchi 1 FUT9 1 Fuster 1 fusions 1 Fuschini 1 Furuta 1 Furuna 1 Furtado 1 furosemide 1 Furness 1 Furman-Haran 1 Furlan 1 Fure 1 Furchtgott 1 Furberg 1 Funnel 1 Funkenstein 1 Funke 1 funisitis-as 1 fungible 1 fundus-based 1 fundoscopy 1 fundi 1 functionsl 1 functionmutants 1 function-limiting 1 functionaries 1 functionallyreorganized 1 func-tion 1 Funabashi 1 fun 1 Fultz-Butts 1 Fulmer-Smentek 1 fully-automated 1 fullwidth-at-half-maximum 1 full-width-at 1 full-time 1 full-thickness 1 full-term 1 full-range 1 fullPIERS 1 fullled 1 full-fledged 1 fullfieldelectroretinogram 1 Fullerton 1 full-day 1 full-blown 1 Fulham 1 fulfills 1 fulfillment 1 Fuld 1 Fukuma 1 Fukui 1 Fukuda 1 fuklen 1 Fukai 1 Fukae 1 Fujiyama 1 Fujimuro 1 Fujimori 1 Fujii 1 Fuhring 1 Fuentes-Duculan 1 Fuente-Fernandez 1 Fudala 1 Fuciarelli 1 Fua 1 fth 1 FT03 1 FSL-VBM 1 fslstats 1 FSIQ 1 F-S 1 FRZB 1 Frydman 1 Frustrations 1 frustrating 1 frustrated 1 Frumkin 1 Frum 1 fruiterers 1 fructose-drinking 1 Frucht 1 Froyd 1 frown 1 Fronza 1 fronts 1 Fronto-parietal 1 frontoparietal 1 Frontocingulate 1 fronto-central 1 front-load 1 frontline 1 frontally 1 Fromont 1 frommolecular 1 fromaccumulating 1 Frolova 1 Froldi 1 Frol 1 Frokjaer 1 Frohna 1 Frohm 1 frogs 1 Froese 1 fro 1 Fritz 1 Fritschi 1 Frischmeyer 1 Friling 1 Friis 1 frightened 1 Frighetto 1 Friesenbichler 1 friendly 1 Friege 1 Friefeld 1 Fried-man 1 Friedenreich 1 Frieden 1 Fridley 1 Friden 1 Fricker-Gates 1 Frias 1 Freysz 1 Freymann 1 Frey-evoked 1 Freundt 1 freshly 1 Fresco 1 Frerker 1 Frerk 1 frequency-swept 1 frequencyof 1 frequency-domain 1 Frenzel 1 Frenkel 1 French-Australian 1 Fren 1 fremitus 1 Fremann 1 Frejd 1 -Freixa 1 Freitas 1 Freising 1 Freischlag 1 Freiman 1 Freilich 1 Freier 1 Freidman 1 Freidenreich 1 Fregosa 1 Fregonezi 1 Fregonesi 1 freeze-fracture 1 free-to-total 1 Freemantle 1 free-induction 1 free-fatty 1 Freedland 1 Freddie 1 Frebourg 1 FRCPC 1 FRCOphth 1 Frazer 1 Fray 1 Frautschy 1 Frauenfelder 1 fraudulent 1 Franzen 1 Fransen 1 Frankowski 1 Frankfurter 1 Frankfurt 1 Frangieh 1 francophone 1 Francois 1 Franco 1 Francke 1 Franciotta 1 Francione 1 Francescato 1 Francesca 1 Francesc 1 Frampton 1 Framing 1 frame-shifted 1 frame-shift 1 frameshift 1 frame-rate 1 frameis 1 Frame-Based 1 Fram 1 Fraki 1 Fraizer 1 Fraidakis 1 fragility 1 fractals 1 fractalkine 1 Frackowiaka 1 FP7-PEOPLE-2009-ERG256303 1 FP7-2007-IST-223920 1 Foyil 1 Foxwell 1 FoxP3t 1 FOXP3 1 FoxOproteins 1 FOXO6 1 FOXO4 1 Fox-Hiley 1 FOVs 1 foveolar 1 fovealthinning 1 foveally 1 fovealisland 1 fovea-like 1 fovea-involved 1 FOVand 1 fourth-grade 1 fourth-degree 1 fourth- 1 Fourteen-year 1 four-ring 1 four-point 1 Fourney 1 four-item 1 four-colour 1 founders 1 founded 1 foundational 1 founda 1 Foulis 1 Fotenos 1 Fossati 1 Fossan 1 Foskett 1 FoschiniMP 1 fos 1 forwarded 1 forward-directed 1 forvascular 1 forty-three 1 Forty-seven 1 Forty-micrometer-thick 1 Forty-four 1 Forty-eight 1 forty 1 fortunate 1 Fortuna 1 fortuitous 1 Fortini 1 Fortin 1 For-The-Marina-Study-Group 1 forth-coming 1 forthcoming 1 Forsythe 1 Forsterova 1 Forster 1 Forssblad 1 Forss 1 forskolin-stimulated 1 Forshew 1 Forschungsgemeinschaft 1 Forschung 1 forSAL-RNA2 1 forParkinson 1 Foroud 1 Fornwalt 1 Fornaguera 1 formulating 1 formulary 1 formost 1 Form-McGill 1 formiR-47 1 formic 1 formerly 1 formedication 1 forme 1 formazan 1 formations 1 for-mation 1 formalizing 1 formalize 1 formalization 1 formality 1 formaldidactics 1 Form-12 1 Forlanini 1 Forked 1 Forke 1 Forio 1 forintraocular 1 forGoodRx 1 forgoing 1 Forexample 1 foreshadow 1 fore-runners 1 Forensic 1 fore-limbs 1 foreign-born 1 foregoing 1 Forecasting 1 forebrain-specific 1 Ford-Smith 1 forcontinued 1 forcing 1 forcibly 1 force-velocity 1 forceps 1 force-producing 1 forced-choice 1 Forcases 1 foran 1 forall 1 foraging 1 fora 1 for6 1 for2weeks 1 for2months 1 for20 1 for12 1 For- 1 FOPFLASH 1 Foot-lift 1 Foothills 1 footfall 1 foolishness 1 food-frequency 1 Fontaine 1 Foniatria 1 Fone 1 fonder 1 fondazioneveronesi 1 Fondation 1 Fon 1 fomites 1 Folsom 1 FOLR3 1 FOLR2 1 FOLR1 1 followup 1 follow-through 1 followedupfor1 1 follow-17 1 follicle 1 foliaceus 1 Foldes 1 foldable 1 Folch-extractable 1 folate-related 1 folate-receptor 1 folate-mediated 1 folate-fortified 1 folate-compromised 1 Fok 1 Fogo 1 fodrin 1 focuson 1 Focalcystically 1 FN-related 1 fndings 1 Fn1 1 fmol 1 FMK 1 FMA20 1 Fly-through 1 Flye 1 flutter 1 flushed 1 fluro-scently-tagged 1 FluoView 1 fluoroscopy 1 fluoroquinolones 1 fluorophotometric 1 fluorophore-conjugated 1 fluoro-phore 1 fluorometry 1 fluoro-L-DOPA 1 fluoro-D-glucose 1 fluorodeoxyglucose-PET 1 fluorodeoxy-D-glucose-positron 1 fluorobenzoate 1 fluoro-2-deoxy-D-glucose 1 Fluorine-18- 1 fluorescing 1 fluoresces 1 fluorescent-tagged 1 fluorescence-activated 1 Fluor-18-fluorodeoxyglucose 1 fluocino-lone 1 Flume 1 fluidity 1 fluid-filled 1 Fluet 1 fluency-inducing 1 fluctuation 1 fluctuated 1 Fluck 1 Flt3 1 floxuridine 1 flowrate 1 flowprobes 1 flowprobe 1 FlowJo 1 flowgraphy 1 -Flow 1 Flournoy 1 flourishes 1 flourished 1 Flotte 1 Florida 1 Florey 1 Flores-RojoM 1 Floreat 1 Flohr 1 fll 1 Fliss 1 FLIRT 1 flip-flop 1 Flinn 1 fline 1 Flickerevoked 1 flexing 1 flexibly 1 flex-ibility 1 Fleury 1 Flesner 1 Fleshman 1 Fleisch 1 Flegal 1 flecks 1 Flecken-stein 1 fl-derived 1 Flaxman 1 flawless-operative-cardiovascular-unified-systems 1 flavoprotein 1 flattened 1 flatness 1 flatmounts 1 Flatman 1 Flatley 1 flat-bottom 1 flask 1 flashing 1 flashbacks 1 flares 1 flare-cell 1 Flanagan 1 Flaman 1 FLAIR-T2 1 FLAIR-and 1 Flaig 1 FlahertyWA 1 flaggingby 1 flaggingalgorithm 1 fl4B 1 Fkhr 1 FK506 1 fixing 1 fixed-weight 1 fixate 1 five-point 1 five-parametric-curve 1 fiveletza 1 FIVB-Volleyball 1 fivb 1 Fiuza-Luces 1 Fitzke 1 Fitzgibbon 1 fittest 1 FITC-conjugated 1 Fita 1 fisterreichische 1 fissure 1 Fishburn 1 Fischetto 1 firts 1 first-year 1 first-spike 1 firsts 1 first-order 1 firstline 1 first-in-human 1 first-in-class 1 first-hand 1 Firouzabadi 1 FIR-may 1 Firinciogullari 1 Fireman 1 FIQ 1 Fiorentino 1 Fiorello 1 Fiol 1 Finzi 1 Finzel 1 Finocchiaro 1 Finnstrom 1 Finns 1 Finniss 1 Finney 1 Finnegan 1 Finn 1 Finlay 1 Finlanda 1 Finkle 1 Finkensieper 1 Finkenauer 1 Finkbeiner 1 finite 1 finish 1 Finiels-Marlier 1 Fingler 1 Fingerle-Rowson 1 Fine-scale 1 finer 1 FineFix 1 Findlay 1 Findl 1 findingin 1 findgings 1 finasteride 1 FinancialModelstoSupportStatesEffortsinCareCoordination 1 finalizing 1 Fina 1 Fimmers 1 FIMIM 1 FIM 1 filter-bottom 1 filovirus 1 Filosto 1 filo651 1 fills 1 Filliol 1 Filla 1 Filipo 1 Filipek 1 Filing 1 Filho 1 Filatova 1 fila-mentous 1 Filaggrin-expressing 1 fil 1 fIkBto 1 FIH-1 1 Figures7NandS7E 1 Figures7K 1 Figures7Band 1 Figures6Jand 1 Figures6D 1 Figures6B 1 Figures5Band 1 Figures4A 1 Figures3E 1 Figures2E 1 Figures2DandS2E 1 Figures2Band 1 Figures2B 1 Figures1J 1 Figures1E 1 Figures1B 1 FigureS1Aavailable 1 Figures1A 1 Fig-ures 1 Figureisan 1 Figure9 1 Figure8 1 Figure7O 1 Figure7I 1 Figure7F 1 Figure7E 1 Figure7D 1 Figure7A 1 Figure6I 1 Figure6H 1 Figure6E 1 Figure6B 1 Figure6 1 Figure5on 1 Figure5D 1 Fig-ure5C 1 Figure5C 1 Figure5B 1 Figure5A 1 Figure4K 1 Figure4J 1 Figure4H 1 Figure4G 1 Figure4 1 Figure3G 1 Figure3D 1 Figure3 1 Figure2M 1 Figure2L 1 Figure2J 1 Figure2H 1 Figure2E 1 Figure2D 1 Figure2A 1 Figure1I 1 Figure1G 1 Fig-ure1D 1 Figure1B 1 Figure11onthe 1 fight-or-flight 1 fighting 1 fight-flight 1 fight 1 Fig-For 1 Figeac 1 -Figares 1 Fifty-six 1 Fifty-one 1 Fifty-nine 1 Fifteen-year 1 fifteenth 1 Fifer 1 FIFA 1 fiexure 1 Fieschi 1 Fierens 1 fierce 1 Fienberg 1 Fieldston 1 Fielding 1 Fiebich 1 FIDs 1 fidelity 1 Fidan 1 Fidalgo 1 fiction 1 Ficoll 1 Ficht-ner 1 Fichorova 1 fibrovasculart 1 fibrovascular 1 fibrotic 1 fibroglandular 1 fibrofatty 1 fibroblasts-secreted 1 fibroblastic 1 fibro-blast 1 fibroadipose 1 fibroadenomas 1 fibrillization 1 fibril-forming 1 fibersof 1 FIBA 1 Fiatarone 1 FHM 1 Fgf21expression 1 FGF 1 ffski 1 Ffrench-Mullen 1 FFG 1 FFDG 1 Feyer 1 fewcases 1 FEVi 1 Feurer 1 Feugeas 1 Feuerstein 1 Feuerhahn 1 Fetz 1 fetal-derived 1 FESS 1 Fesik 1 fertilization-embryo 1 Ferry 1 Ferrrous 1 Ferroukhi 1 Ferro 1 ferritin 1 Ferrio 1 Ferres-Marco 1 Ferrer-Acosta 1 FerreiraA 1 Ferreir 1 Ferree 1 Ferre 1 Ferraro 1 Ferrari 1 Ferraretti 1 Ferrante 1 Ferrajoli 1 ferning 1 Fernand-Lizarbe 1 Fermentas 1 Fermanian 1 Ferman 1 Ferlay 1 Ferland 1 Fergusson 1 Fergus 1 Ferger 1 Ferencz 1 Ferdinando 1 Ferber 1 Feo 1 FenwickE 1 Fenwick 1 Fenton 1 fentanyl-mediated 1 fenomenologico-psichiatrica 1 Fenomenologia 1 Fenichel 1 fenestration 1 Fenech 1 Fendt 1 femtomolar 1 Femto 1 feminine 1 Femia 1 femalespleen 1 female-specific 1 female-only 1 Feltrinelli 1 fellow-ship 1 fellow- 1 Fellini 1 Fellinger 1 Feller-Kopman 1 Feller 1 Felkey 1 Felisari 1 Felipe 1 Feliciano 1 Felice 1 Felgar 1 Feldwisch 1 Feke 1 Feintuch 1 Feinleib 1 Feiner 1 Feinbaum 1 FEI 1 Fehrmann 1 Fegion 1 Feeny 1 Feeney 1 feel-now 1 Feeley 1 feed-restricted 1 feedbacks 1 feedback-biased 1 feedback-based 1 Fedotova 1 Fedorowet 1 Federoff 1 Federman 1 Federici 1 Federations 1 federally-funded 1 Fedele 1 Fedder 1 Fecteau 1 features-specifications 1 featureof 1 featured 1 feature-based 1 feat 1 Feasibilityof 1 fear-avoidance 1 fear-anxiety 1 FE141 1 fdrtool 1 FDR 1 FDN200 1 fDl 1 FDA-issued 1 fda-approves-ibrutinib-chronic-lymphocytic-leukemia 1 FDA-approved 1 FDAAA 1 FCz 1 FcyRIIa 1 Fcy 1 FCS 1 FcR-stimulated 1 FcRn 1 Fc-mediated 1 FcgammaRIIIa 1 FCCM 1 FbS-free 1 F-box 1 FBA 1 Fazi 1 Faye-Petersen 1 faxing 1 Favus 1 favours 1 favourite 1 favouring 1 favourably 1 Favier 1 Fauser 1 faulty 1 Fauler 1 Fauber 1 Fau 1 fattyacids 1 Fatty-acid 1 Fat-touma 1 fatter 1 fatigue-like 1 fatalities 1 Fast-Switch 1 fast-spin-echo 1 Fastrak 1 fast-progressing 1 fast-paced 1 fast-mode 1 fastingglucose 1 fast- 1 Fassan 1 fashions 1 FASEBJ 1 Fascial 1 Fas-associated 1 Fasanoa 1 Fasano 1 Farthing 1 Farrugia 1 Farrow 1 Farreret 1 farrelld 1 Farrar 1 Farquhar 1 Farooq 1 Farney 1 FarnetiP 1 farnesol 1 Farnedi 1 farms 1 Farmer 1 Farmand 1 Farmacologiche 1 Farmacologia 1 Farmacia 1 Farissc 1 Farine 1 Fariello 1 Farewell 1 Farese 1 fares 1 Fardell 1 Faravelli 1 Faraone 1 Farahani 1 Fantuzzi 1 fantome 1 Fant 1 fanout 1 Fanini 1 Fangberget 1 Fanalia 1 FamPract 1 family-planning 1 family-centred 1 family-based 1 familiarization 1 Famil-ial 1 Fami-glietti 1 falsely 1 false-discovery 1 fallopian 1 Fallin 1 Fallavier 1 fallacies 1 Falkenburger 1 Falkenberg 1 Falkai 1 Falcone 1 Falcao 1 Falc 1 Falaschetti 1 Falaleevaet 1 Falaleeva 1 Fakultat 1 Fajardo 1 faithfully 1 Faisal 1 failure-normal 1 Faillenot 1 Faidley 1 Fahn 1 Fahlstrom 1 Fahlgren 1 Fahlen 1 FAH 1 Fagerlund 1 Fager 1 Fage 1 faecal 1 fads 1 fades 1 fad 1 Facult 1 Faculdade 1 factuality 1 factsheet 1 factorsdtype 1 factors4 1 fac-tors 1 factor-resistant 1 factor-mediated 1 factor-like 1 factor-kappa 1 factorization 1 factored 1 factor-depleted 1 factorDAF-16 1 factor-1a 1 facto 1 FACSCanto 1 FACR4 1 Facon 1 facialartery 1 facets 1 facet 1 faces14 1 Facchini 1 FACC 1 FAc-and 1 fac- 1 Fabritius 1 Fabregat 1 Fabio 1 Fabian 1 Fabia 1 Fabbrini 1 Fabbri-Destro 1 Fab 1 F-91191 1 f6625 1 f6530 1 f6234 1 F158V 1 F-12 1 F1000Prime 1 Ezzell 1 Ezra 1 Ezquerra 1 EZlength 1 EZH1 1 Ezgi 1 ezetimibe 1 Eysenck 1 Eyrich 1 Eyre 1 eye-tracking 1 eye-tracker 1 eyesmart 1 eyelid 1 eye-hand 1 eyedrops 1 eye-disease 1 eyedata 1 eyecontact 1 eyecheck 1 Eyberg 1 Eyal 1 EY06109 1 EY02576 1 EY018383 1 EY015128 1 EY014800 1 Exzel- 1 exuberant 1 extrude 1 extrfascicular 1 Extremitaeten 1 extremism 1 extravasation 1 extrastriate 1 extraspinal 1 extrascleral 1 extraretinal 1 extrarenal 1 extrapolations 1 extrapolation 1 extrapolate 1 extraplacental 1 extraordinary 1 extra-ocular 1 extranigral 1 extraneous 1 extra-muscular 1 Extra-mural 1 extrameatal 1 extra-hippocampal 1 extra-foveal 1 extrafascicular 1 extradural 1 Extract-N-Amp 1 extracorpuscular 1 extracellularmicroRNAs 1 extracellularly 1 extra- 1 extinguishing 1 exteroceptive 1 external-beam 1 exteriorem 1 extents 1 extent-of-resection 1 extensivegenotype 1 extensionvia 1 extensibility 1 exsanguinating 1 exquisite 1 expressionin 1 expressionare 1 expressional 1 -expressing 1 expressedRosa26 1 expressedbyan 1 ex-pressed 1 exposure-adjusted 1 expo-sure 1 exposes 1 exportable 1 ExpOphthalmol 1 exponentials 1 exponentially 1 explosiveness 1 exploreyso 1 Explorative 1 Explora 1 exploitation 1 explicable 1 expiredgas 1 expiration 1 ExpEye 1 experimenter-blind 1 experimenter 1 experimenteller 1 Experimentelle 1 experiential 1 experience-specific 1 experiencemet 1 experience-can 1 expelling 1 expelled 1 expectation-maximization 1 expandits 1 Exot 1 exostoses 1 exosome 1 exondosage 1 exome-sequencing 1 EXM 1 exits 1 existent 1 exhibitedreduced 1 exhaustively 1 exertion-induced 1 exercisetesting 1 exercise-interventions-for-upper-limb-dysfunction-due-to-breast-cancer 1 exercised-induced 1 Exer 1 exemption 1 exemplifying 1 executed 1 excursus 1 excretory 1 excretions 1 excommunication 1 exclusivity 1 exclusions 1 exci-totoxicity 1 excito-toxicity 1 excited 1 excitations 1 excisional 1 exci-sion 1 exchanges 1 exchanger-3 1 exchanger-1 1 exchanged 1 Excerpta 1 excels 1 Excavation 1 exam-separate 1 exampleis 1 examing 1 Examina-tion 1 exaggerating 1 exacerbant 1 Ewing 1 EVT-2 1 evolvingconcepts 1 EvolutionTM 1 evoking 1 evokes 1 evocative 1 EVMS 1 evika 1 evidently 1 evidenceis 1 evidencefor 1 evidenceestudy 1 evidencebased 1 evi-dence 1 eviction 1 Eveson 1 eversivo 1 ever-present 1 Everolimus 1 Everitt 1 ever-increasing 1 ever-greater 1 ever-expanding 1 Everest 1 events-eye 1 event-based 1 Evensen 1 Evengard 1 Even-chain 1 evasive 1 evascularization 1 Evarts 1 evaporation 1 Evanston 1 Evangelisches 1 Evangelia 1 evanescent 1 Evaluation-Revised 1 evaluationof 1 evalu-ation 1 evakoetsier6 1 euthymic 1 Eustachiantube 1 Eusta-chian 1 EUSOMA 1 Eusebi 1 EuroQol-5D 1 Europfiische 1 Europeo 1 eurocat-network 1 EUROCAT 1 EUROCAST 1 EURObservational 1 Euroanaesthesia 1 Eurlings 1 EURETINA 1 eUniversit 1 eukaryotes 1 EU-integrated 1 eugenics 1 Eugenfn 1 Euclidian 1 Euclidean 1 etymology 1 Etxebarria 1 etude 1 Ettle 1 Etsuko 1 Ets 1 etre 1 etr 1 etoposide 1 Etit 1 etiologies 1 etiological 1 etiologic 1 etiocho-lanolone 1 ethz 1 ethos 1 ethnography 1 ethmoid 1 Ethiodol 1 Ethik 1 ethically 1 Ethic 1 Etherton 1 ethanolamine 1 etexilate 1 Eter 1 ete 1 ETD-specific 1 etb23 1 eta-squared 1 Etard 1 eta-bonate 1 ET11001 1 Estudis 1 Estrov 1 estrogens 1 estreicher 1 estradiol 1 Estrada 1 Estomatologia 1 estimators 1 Esteve-Garcia 1 Esteva 1 ester-rich 1 Esterman 1 esteraseL1 1 esterase 1 Estep 1 E-stained 1 establishedforCu 1 Esserset 1 essence 1 Esselman 1 Essa 1 ESRD 1 ESR1 1 Espree 1 espoused 1 Esposito 1 Esport 1 Espnes 1 esplorazione 1 Espinosa1 1 Espina 1 Espie 1 Esperienza 1 ESPEN 1 Esp 1 esoteric 1 Esmer 1 Eskicioglu 1 Escobar-Hurtado 1 Escobar 1 escaped 1 Escalona 1 escalating 1 Escalated-dose 1 escalated 1 Esaki 1 Erythromelalgia 1 erythroid 1 erythrocyteswas 1 erythematous 1 erythaematosus 1 Erwan 1 Ertl 1 Erskine 1 error-sensitive 1 error-free 1 Erro 1 Erritzoe 1 Erridge 1 Errett 1 erred 1 errands 1 Erol 1 erode 1 ERO 1 Erngaard 1 Ernest 1 ER-negative 1 ERN1 1 erkenntnis 1 Erkankung 1 Erin 1 Erika 1 Ericson 1 Erich 1 Ergun 1 Ergotest 1 ergogenicity 1 Ergocard 1 Erginay 1 ERG 1 Erfurt 1 erez 1 erentiation 1 erent 1 erections 1 ere 1 Erdmann 1 Erdjument-Bromage 1 Erdal 1 Ercolani 1 Erbs 1 Erblich 1 Erbersdobler 1 ErbB2 1 ERBB 1 erasure 1 ErasmusMC 1 Erasmo 1 erase 1 ERare 1 ERA-Net 1 eradication 1 ER61661 1 equities 1 equitably 1 Equitable 1 equipoise 1 Equi 1 equator 1 Equat 1 equality 1 equalities 1 equalise 1 Epstein-Peterson 1 Epstein-Barr 1 EPSRC 1 epsilon2 1 EPS 1 Epperson 1 eponyms 1 epoch 1 Epleygroup 1 epitope-specific 1 EPITHET 1 epitheliocytes 1 epithe-lial-mesenchymal 1 Epithelia 1 epistaxis-related 1 episcleral 1 epiphenomenon 1 epiphenomenal 1 epiphenomena 1 epipharyngeal 1 epilepticus 1 epilepsy-related 1 epiglottis 1 Epigenomics5 1 epigastric 1 Epigallocatechin 1 epifluorescence 1 epididymis 1 epidermidis 1 Epi-demiology 1 Epi-demiol 1 epi-demic 1 Epidem 1 EPICOR 1 epicondyle 1 EPI-04-0736 1 ephrin-B2 1 ephedrine23 1 ephaptic 1 Eph4A 1 epfl 1 ependymomas 1 ependymal 1 EPConDB 1 EP2010 1 eotaxin 1 eosinophils 1 EORTC-based 1 EORP 1 EOG 1 EO-07-027 1 enzyme-product 1 enzymelinked 1 enzyme-inducing 1 enzyme-conjugated 1 enzymatically 1 Enzinger 1 Enwu 1 envisage 1 environmentally 1 environmental- 1 enve-lope-mediated 1 enumerated 1 entwined 1 entuk 1 entryid45 1 Entomed 1 Entman 1 enticing 1 enthusiasm 1 Enterprise 1 enterocyte 1 entailed 1 ensues 1 Ensrud 1 Ensembl 1 Enseignement 1 enrollee 1 Enright 1 enriching 1 Enquiry 1 eNOStargeting 1 Enoka 1 Enns 1 Enlund 1 enlisted 1 enlarging 1 enlarges 1 enjoyed 1 enjoyable 1 Enikolopov 1 ENI 1 enhancements 1 engulf 1 Engstrom 1 Englund 1 Engljahringer 1 Englesbe 1 Engineer 1 Engin 1 engendering 1 engender 1 Engelsen 1 Engelhardt 1 Engelender 1 Engelborghs 1 engagementin 1 Enfants 1 energy-sensing 1 Energy-selective 1 energy-producing 1 energy-consuming 1 ene 1 endure 1 endurance-trained 1 End-trial 1 end-systolic 1 end-systole 1 end-stages 1 Endres 1 end-points 1 Endoxane 1 endows 1 endotoxin 1 endotoxemia 1 endothelium-dependent 1 endo-thelium 1 endothe-lium 1 endothelialization 1 endothelialcells 1 endothelialageing 1 endothelia 1 endosymbiotic 1 endosomal 1 endoscopically 1 endorphin-specific 1 endorgan 1 endoplamic 1 endo-phenotypic 1 endophenotypic 1 endopheno-type 1 endoperoxidase 1 endonuclease 1 endometrium 1 endome-trioma 1 endometrial 1 endolymphatic 1 endoleaks 1 Endoleak 1 endoge-nous 1 Endogen 1 end-of-movement 1 Endod 1 endocrinologists 1 Endocr 1 endocannabinoid 1 endobronchial 1 Endnote 1 endlessyI 1 end-exercise 1 endeavors 1 end-diastolic 1 end-diastole 1 endarterectomies 1 encyclopedia 1 encryption 1 encrypted 1 encroachment 1 encodingare 1 encod-ing 1 encloses 1 encircled 1 Encino 1 encephalomyopathy 1 encephalomyopathic 1 encephalomyelitis-like 1 enceph-alitis 1 Encarnacion 1 encapsulation 1 Enc 1 Enav 1 enantiomers 1 enamoured 1 enacted 1 en-ables 1 emulsion 1 emulsified 1 emulsificant 1 Emson 1 Emrick 1 Emrech 1 empyema 1 emptiness 1 empties 1 empowerment 1 empowering 1 Empiric 1 emphysema-like 1 Emphyrio 1 emphasised 1 emperor 1 Emotion-related 1 emotion-labeled 1 emotionally 1 EMMES 1 Emmert 1 Emmerling 1 Emmanouil 1 EMM 1 Emlyn 1 emitted 1 emits 1 emissions 1 emission-only 1 emissary 1 Emiliozzi 1 Emilia 1 emigrate 1 E-MEXP-3034 1 E-MEXP-2360 1 emesis 1 emergencies 1 emedicine 1 Embry-Riddle 1 Embryology 1 embryologically 1 embrace 1 Embosphere 1 embolotherapy 1 EMBOlong-term 1 embolisation 1 EMBOJ 1 embellished 1 embalmed 1 Embabi 1 emaxT 1 Emanuele 1 Emanuel 1 Emami 1 Emamalizadeh 1 E-mails 1 emails 1 El-Zein2 1 El-Zaiat 1 Elzahaf 1 Eluants 1 Elting 1 ELT 1 Elswick 1 Elstrott 1 Elstneret 1 elsson 1 Elsonet 1 El-Sohemy 1 Elshal 1 El-Serag 1 Elsaesser 1 ELS 1 Elovitz 1 Elorza 1 eloquent 1 elongating 1 elongated 1 Eloffsdarl 1 Elmussareh 1 Elmslie 1 Elmquist 1 Elmer 1 Ellwood 1 Ellison-Wright 1 Ellisen 1 ellipsoidal 1 ellipse 1 Ellger 1 Ellenberg 1 ell 1 Elkin 1 El-Khoury 1 El-Khoueiry 1 El-Khairy 1 Elkayam 1 Elizondo-Fraire 1 Elizalde 1 elision 1 Elisenda 1 Elisabeth-Krankenhaus 1 Elinder 1 Elina 1 Elife 1 Elicitation 1 Elias-Smale 1 Eliaet 1 Elia 1 Elhwairis 1 El-Hizawi 1 El-Harazi 1 Elhakem 1 El-Hage 1 Elflein 1 ElfervigJ 1 El-Far 1 elevator 1 elevates 1 Elephants 1 elementsin1 1 element-binding 1 ele-mentary 1 elegant 1 elegansageing 1 elects 1 electrotonically 1 electrosurgery 1 electrostimulation 1 electroretino-graphic 1 electroretinographic 1 electroretinogram 1 electrophoretic 1 Electro-oculography 1 electrooculogram 1 Electro-ocular 1 electron-transparent 1 electron-dense 1 electron-contrast 1 electromyographic 1 Electromyogr 1 electromagnetically 1 electro-magnetic 1 electrolytes 1 electroen-cephalography 1 Electroencephalographic 1 electroencephalograms 1 electrocorticography 1 electrocorticographic 1 electrocap 1 electoral 1 electing 1 Eleanor 1 El-Danaf 1 Elce 1 Elbert 1 ElBardissi 1 elav-GAL4 1 elation 1 elastase 1 Elashoff 1 Elan 1 el151-e1159 1 Ekstrand-Hammarstrom 1 Ekstrandet 1 Ekselius 1 Ekhato 1 EKF 1 Ekbom 1 Ekblom 1 Ekblad 1 Ejiogu 1 eitheralone 1 Eisenmann 1 Eisenman 1 Eisenhut 1 Eisenberger 1 Eisenberg 1 Eisenach 1 Eisen 1 eisch 1 eine 1 Eimer 1 Eileen 1 Eikelenboom 1 Eijkenboom 1 Eighty-four 1 eighty 1 eight-week 1 Eighteen 1 eight-channel 1 eigenvalue 1 eigenartige 1 Eifert 1 EIF4G1Ala502Val 1 EIF4G1 1 eIF4G 1 EIF2AK3 1 Eif2a 1 eicosapentaenoic 1 Eickmann 1 Eich-mann 1 Eichacker 1 EIB 1 eI 1 ehu111 1 eht570 1 Ehrlichman 1 Ehrhardt 1 EH4 1 EGTA 1 egress 1 Egr-1 1 Egol 1 ego-involvement 1 Eghtesady 1 Eggert 1 Eggersc 1 Eggan 1 EGFRvIII-expressing 1 EGFRvIII 1 EGF104900 1 EGF 1 Egerter 1 Egert 1 Egenotypes 1 E-genotype 1 Egami 1 EGA 1 Eftychia 1 Efrat 1 efor 1 EFNS 1 eFigure1 1 EFIC 1 effortlessly 1 effortful 1 effort45 1 effluxes 1 efficiencyto 1 efficiencies 1 efferents 1 efferently 1 efferent 1 effects7for 1 effector-binding 1 effectof 1 effectiveness15 1 effcts 1 Efemp1 1 efavirenz 1 EF1800 1 E-Entropy 1 EEG-generators 1 EEG-changes 1 Edusc 1 education-service 1 EDUCATIONQUESTIONS 1 educationeWMH 1 educationally 1 edu-cation 1 Edsborg 1 edopioidabuseguidelines 1 edo 1 Edlo 1 Edizioni 1 Editor-in-Chief 1 editorials 1 editions 1 Editeur 1 edit 1 edibles 1 e-diaries 1 edge-to-edge 1 Edgerton 1 edge-enhancement 1 edge-contrast 1 edge-based 1 Edgar 1 Edenfield 1 Eden 1 EDEM3 1 EDEM1 1 Edelstyn 1 Edelsbeerg 1 E-deficiency 1 ED-based 1 Ecublens 1 Ecstacy 1 Economou 1 economists 1 economically 1 Eco-nomic 1 ecologic 1 ecogenetic 1 Ecoffey 1 ecks 1 Eckmann 1 Eckloff 1 Ecker 1 Eckelt 1 Eckel 1 echolalia 1 echoing 1 echogenicity 1 echocardiograms 1 echocardiogram 1 Echeveste 1 ECFCs 1 ECDEU 1 eccentrics 1 eccentricity 1 ECAT 1 E-cadherin 1 ECA 1 Ebsco 1 Ebrecht 1 ebolavirus 1 Ebola-infected 1 ebola-20140808 1 Eberli 1 Ebendal 1 Ebco 1 Ebbeling 1 eating-related 1 eat-2 1 easy-to-remember 1 easy-to-read 1 Eastham-Anderson 1 Eastham 1 Easterling 1 Easterbrook 1 EASPN2 1 Easlon 1 Eary 1 earning 1 early-versus 1 early-phase 1 early-infantile 1 early-childhood 1 Earlycases 1 early20th 1 Earley 1 Earl 1 Earhart 1 EAP 1 eAddendafora 1 eADCmean 1 EACPR 1 ea-aw 1 EAAT3 1 e9869 1 e98 1 e979-e980 1 E933-E939 1 e9306 1 e93 1 E915 1 E910 1 e90390 1 e88566 1 e88118 1 e88 1 e8758 1 E869 1 E860 1 E858 1 E850 1 e83759 1 e83 1 e82506 1 E820 1 e8101 1 E8 1 e7945 1 e79083 1 e789 1 e7889 1 e78636 1 e782 1 e7697 1 e76490 1 e763 1 e74-e80 1 E749-E755 1 E73-H92 1 e73480 1 e718-e724 1 E706Y13 1 e70274 1 e7 1 e69-426 1 e66924 1 e6353 1 e62422 1 e62 1 e61353 1 e609-630 1 e606 1 e60378 1 e60336 1 e60 1 E5b 1 E5a 1 e59567 1 E590 1 e59 1 e58636 1 e57769 1 e57753 1 e57454 1 e574 1 e56099 1 E545K 1 e540 1 e53728 1 e53 1 E516-E519 1 e51431 1 e4nTTyielding 1 e4npTT 1 E4initially 1 E4d 1 E4c 1 E4b 1 E4allele 1 E4a 1 e47786 1 e476 1 E46K-mutated 1 e46439 1 e45876 1 e4542 1 E446 1 E439 1 E42-H61 1 e42 1 e41883 1 e4160 1 e411 1 E40K 1 e405 1 e404-e411 1 E4025 1 E4016 1 E3d 1 E3b 1 E3a 1 e395 1 e39227 1 e391Y479 1 e39154 1 e38545 1 e38413 1 e37926 1 e37326 1 E37 1 e36199 1 e3556 1 e350 1 e34872 1 e34688 1 e33438 1 E33 1 e329- 1 e31718 1 e31645 1 e316 1 e31380 1 e30313 1 e301 1 e2n 1 E2F1 1 E2b 1 E2a 1 e29848 1 e29482 1 e28 1 e27068 1 E268-76 1 e25982 1 e2593 1 e259 1 e257 1 e25451 1 e24870 1 e24585 1 e24145 1 E24 1 e23-e30 1 e2316 1 e2264 1 E223Y30 1 e220-e227 1 e21666 1 e212 1 e211 1 E2090 1 E2079 1 e20709 1 E20 1 e1-e8 1 E1-E10 1 e19941 1 e19-30 1 e1-9 1 e18501 1 e183-e189 1 e182-e185 1 E18 1 e17978 1 e17944 1 e179 1 e17698 1 E176-86 1 e173-e182 1 e171 1 e17059 1 e167 1 e166 1 e161 1 e1-6 1 e16 1 e15924 1 e159 1 e145 1 e144-e146 1 E1440Y9 1 E1333 1 e13164 1 e13 1 e12932 1 E1267-75 1 e1241 1 E1235-E1242 1 e1208 1 e117-e120 1 e1160 1 e113 1 e112 1 e1-10 1 e107 1 E1062 1 E1054 1 e1053 1 e10344 1 e10329 1 e1015 1 e101 1 e1004263 1 e1004214 1 e1004141 1 e1003737 1 e1003368 1 e1002792 1 e1002645 1 e1002629 1 e1001208 1 e1001106 1 e1001048 1 e1001041 1 e1000412 1 e1000242 1 e1000196 1 e1000100 1 e1000074 1 e1000021 1 e00762 1 e002742 1 e000262 1 e000101 1 DZNep 1 Dzirasa 1 Dziggel 1 Dzieciatkowski 1 Dziaman 1 Dziados 1 Dzemidzic 1 DYT 1 dystrophywith 1 dystrophygene 1 Dystrophinopathy 1 dystrophin-deficient 1 dystrophin-associated 1 dystro-phin 1 dys-trophic 1 dystroglycan 1 dystopian 1 dysthymic 1 dysrhythmias 1 dysregulatedbymiR-135b 1 dysregulate 1 dyspnoeic 1 dyspnoea 1 dys-pneaasa 1 dysphoria 1 dysphagia-specific 1 dysphagia8 1 dyspareunia 1 Dyson 1 dysmotility 1 dysmorphic 1 dyslipemias 1 dysfunctionin 1 dysfunction-associated 1 dysfunctionand 1 dys-function 1 dysconnectivity 1 Dysconnection 1 dysbiosis 1 dysautonomia 1 dysarthria 1 DynEx 1 dynamin1 1 dynamin 1 dynamically 1 Dyn 1 Dyke 1 Dyck 1 dyanmics 1 dyadlevel 1 Dwyeret 1 dwellers 1 dwell 1 dwarf 1 Dvv 1 Dvk 1 DVD 1 DV4 1 Duvoisin 1 Dutton 1 dUTP-biotin 1 dUTPase 1 Dutkiewicz 1 Dutka 1 Duthie 1 Duteil 1 Dutchak 1 dutasteride 1 Dustoor 1 Duseja 1 Durrer 1 Durkina 1 dur-ing 1 Durif 1 Durbin 1 durationsis 1 Durand 1 Duran 1 durable-polymer 1 Dupuits 1 Dupre-Aucouturier 1 duplicated 1 duplexes 1 duplex 1 Duong 1 duodenum 1 Dunsky 1 Duno 1 Dunnington 1 Dunner 1 Dunea 1 Dunaway 1 dumped 1 Dumoulin 1 Dummer 1 Dumitru 1 dumbstruck 1 Dumas 1 Dulmen 1 dulled 1 dull 1 Dul 1 Duivenvoorden 1 Duisburg-Essen 1 Duin 1 Duhn 1 Duhamel 1 Duguet 1 Dugel 1 Dugar 1 DuganW 1 Dufort 1 Dudzik 1 Duculot 1 ductus 1 Duchesne 1 Duchen 1 Duchateau 1 Dubowitz 1 Dubowith 1 Dubovsky 1 Dubovik 1 dubious 1 Dubinett 1 Dubern 1 Duband 1 Duara 1 dual-velocity 1 dual-scale 1 dually-eligible 1 dual-color 1 dual-channel 1 dual-angle 1 dualacting 1 DU145 1 D-to-A 1 DTI-based 1 DTBZ 1 DSP 1 DSM-V 1 DSM-IVdisorders 1 DSM-IV-diagnosed 1 DSM-defined 1 dsm5 1 DSM-4 1 DSD 1 DSCA 1 DSA- 1 DS7AH 1 DS00284 1 dryAMD 1 drusenlike 1 drusen-associated 1 drunk 1 Drumond 1 drug-treatment 1 DrugSafety 1 drug-related 1 drug-receptor 1 Drug-Overdose-Report-released 1 drug-mediated 1 drug-elutingstents 1 Drugas 1 drosophilia 1 DrosophilaParkin 1 DrosophilaIkappaBhomologue 1 droshafor 1 Drosha 1 drop-out 1 Dromerick 1 Drobnic 1 DRn 1 DrMedSci7 1 DrishtiCare 1 Drimmelen 1 drilling 1 drilled 1 Drife 1 Driessen 1 D-ribose 1 Drewniak 1 Drevon 1 dressing 1 dressed 1 Dresden 1 Drechsler 1 Drechsel 1 dreams 1 dream 1 DRCR 1 DRB 1 drawings 1 draw-backs 1 Dravid 1 Drastic 1 Drannik 1 Drake 1 Drahosova 1 drags 1 Dragovich 1 Dragovic 1 Dragonetti 1 dragon 1 dragging-and-dropping 1 dragged-and-dropped 1 Draganski 1 draftees 1 Drachman 1 Dracheva 1 DR006 1 DQB 1 DQ-alpha 1 DQA 1 DPT-100 1 D-Phe7-a-MSH 1 DPH 1 dpag 1 DPACE 1 Dp260 1 Dp140R3 1 Dp140F 1 DP0879769 1 Dozmorov 1 Dozier 1 doxycycline 1 doxorubicin-induced 1 Downward1 1 downtime 1 downsteam 1 downstaging 1 downsides 1 down-regulatory 1 downregulates 1 downplaying 1 downmodulation 1 downloaded 1 downhill 1 downgrade 1 Dowie 1 Dowidar 1 Douhe 1 Dougan 1 Doug 1 Douek 1 Doudnikoff 1 douching 1 doubts 1 double-walled 1 double-transgenic 1 double-stranded 1 double-leg 1 double-immunofluorescent 1 Doubleet 1 Doublea 1 Doubal 1 Douay 1 Douaud 1 dotsyndrome 1 DOTA-rhenium-cyclized 1 DOTA-rhenium 1 DOTA-a-melanocyte-stimulating 1 dose-volume 1 doses34 1 dose-independent 1 dose-finding 1 dose-dependently 1 Dose-dense 1 Dosani 1 dorsalhorns 1 Dorrius 1 Dornmair 1 Dornas 1 Dorn 1 dormant 1 dormancy 1 Dorling 1 Doris 1 Doreen 1 Dore 1 Dorchester 1 Doraiswamy 1 DOQI 1 DOPU 1 Doppler-angle 1 doping 1 dopaminergicGAL4 1 Dopamine-dependent 1 dopa-mine 1 DOPA 1 door-to-imaging 1 door-to-computed 1 doors 1 Doornaert 1 Doorenweerd 1 doodling28 1 donut 1 donot 1 donor-matched 1 Donohoe 1 Donoghue 1 dono 1 Donnenfeld 1 Donnellan 1 Donia 1 Dongen 1 Doncaster 1 donations 1 Donangelo 1 Donaghue 1 Donabedian 1 Domingo-Sabat 1 dominant-negatively 1 Domes 1 Domenici 1 Domenicano 1 Domany 1 domain-specific 1 domain-containing1 1 domain- 1 Dom 1 dolorosa 1 Dolores 1 Dolmetsch 1 dollars 1 Doll 1 Dolecek 1 Dolderer 1 Dokkyo 1 doiathesis-stress 1 Do-Hyun 1 Doha 1 Dogra 1 Doganci 1 Doffoel-Hantz 1 Doessing 1 Doesch 1 Doerr 1 Doering 1 Doerfler 1 Doejaaren 1 Doehring 1 Dodon 1 Dodiya 1 Dodge 1 dodecyl 1 Doddrell 1 doctor-patient-lists 1 docosahex-aenoate 1 Doci 1 Dochartaigh 1 Dobscha 1 Dobre 1 Dobelbower 1 Doat 1 doassociate 1 DOA 1 DO2 1 dNTPs 1 DNS 1 DNM1 1 DNApolymerase 1 DNAmicroarray 1 DNA-methylation 1 DNAJB9 1 DNAdisease 1 DNA-dependent 1 DNAdeletions 1 DNAdamage 1 DMVneurons 1 DMVare 1 DMR 1 dmin 1 DM6000B 1 dLys 1 Dlx5 1 dls 1 DLPFC-dependent 1 dl-methionine 1 dle 1 DLB 1 dl21 1 dl-1 1 dl1 1 DK57516 1 DK56350 1 DK55865 1 DK-2600 1 DK069406 1 DK035108 1 djj0 1 Djavaheri-Mergny 1 Djarmati 1 DJ-1mutants 1 DJ-1genes 1 DJ1 1 dizziness-related 1 Dizziness21 1 dizygotic 1 diyudeshouhuzhe 1 Dixit 1 Diwan 1 Divison 1 divisive 1 Divilov 1 Divgi 1 diverticuli 1 divert 1 diversification 1 diverges 1 divalent 1 DIV 1 dium 1 Diukova 1 Ditterich 1 Ditte 1 -dithiobis- 1 dithiobis 1 disuptive 1 disturbingly 1 districts 1 distri-bution 1 distraction 1 distracting 1 distract 1 distort 1 distinctions 1 distantly 1 distance-matching 1 distal-to-proximal 1 distally 1 dissolve 1 dissipation 1 dissipates 1 disseminate 1 Disselhirst-Klug 1 Disruptionof 1 disruptedin 1 disqualified 1 disputes 1 disputed 1 disproves 1 disproved 1 dispositions 1 disposed 1 dispose 1 dis-play 1 dis-placement 1 displace 1 disperse 1 Dispenzieri 1 dispenses 1 Dispensers 1 dispensed 1 dispense 1 dispels 1 dispase 1 dis-parities 1 DiSouza 1 disorientation 1 disorganisation 1 disordersamong 1 disorderamong 1 Dis-ord 1 dismutases 1 dismal 1 Disma 1 dislodged 1 dislocation 1 disliked 1 disk-shaped 1 disinhibits 1 dishing 1 disguise 1 disfluency 1 disequilibrium 1 disenrollment 1 disenroll 1 disengagingattention 1 Disengagement 1 disengage 1 disease-United 1 diseasestudy 1 diseasesof 1 diseaseslike 1 diseaseor 1 disease-of-interest 1 disease-modifying 1 disease-linked 1 diseasein 1 disease-association 1 disease-and 1 diseaseand 1 Disease3 1 disease1 1 Disease00 1 discriminator 1 Discriminative 1 discriminations 1 discriminable 1 discretized 1 discredit 1 discoveryof 1 discoverers 1 discoverable 1 Dis-cov 1 discourses 1 discourages 1 discouraged 1 discounts 1 discounting 1 discontinuity 1 discontinuities 1 discontinue 1 discontents 1 disconnects 1 disconnectedmind 1 Disconnected 1 disconfirming 1 disconfirm 1 disconcertingly 1 disconcerting 1 discoidal 1 discogenic 1 disclusures 1 disclaimers 1 Disclaimer 1 Dische 1 disc-based 1 discards 1 discarding 1 disasters 1 disappointingly 1 disappearing 1 disappearances 1 disallowed 1 disagrees 1 disagreements 1 disagreeing 1 disagreed 1 disaggregated 1 disadvantaging 1 disability6 1 disabilitiesor 1 Dirkx 1 Dirksen 1 Dirisina 1 Di-rezione 1 Direzione 1 directs 1 directly35 1 Directives 1 Directive 1 directionselectivity 1 direction-selective 1 directionally 1 directionalities 1 direction11 1 direct-from-recovery-room 1 Dir 1 diques 1 DIPS 1 Diprivan 1 Dippel 1 diploid 1 Dipartimento 1 Diot 1 Diosdado 1 Dionne 1 diode 1 dInR 1 dinner 1 Dinh 1 Dingxin 1 Dingli 1 Dingledine 1 Dinghra 1 Dina 1 dimorphic 1 dimly-positive 1 Dimitrov 1 Dimitropoulou 1 Dimitrijevic 1 Dimitrakopoulou-Strauss 1 diminishing 1 Dimick 1 Dimichele 1 dimethylarginine 1 dimethyl 1 dimerization 1 dimensins 1 DiMatteoMR 1 Dimaras 1 DiMaio 1 dim 1 dilution-mass 1 diluent 1 Dillard 1 Dilks 1 diligently 1 diligence 1 dilatations 1 dilactate 1 DiIorio 1 -dihydrotetrabenazine 1 dihydropyridine-sensitive 1 dihydrofolate 1 dignity 1 Digitimer 1 digit1-to-digit5 1 Digging 1 digest 1 DIGE 1 Difluprednate 1 difluoride 1 Diffusion-Weighted-Magnetic 1 diffusion-trace 1 diffusion-restricting 1 diffusion-driven 1 diffusion-and 1 diffusional 1 diffusable 1 diffraction 1 diffferences 1 differentIkBalpha 1 differentiallymethylated 1 differentages 1 differen-ces 1 difference-in-difference 1 diffcult 1 diferuloylmethane 1 diferent 1 Dieuleveult 1 dietwere 1 Dietrich-Bonhoeer-Klinikum 1 Dietlein 1 dietis 1 diet-induced-obese 1 dieticians 1 dietician 1 diethylstilbestrol 1 diethylenetriaminepen-taacetic 1 diethylenetriamene 1 Diet-dependent 1 dietary-restriction-mimicking 1 dietary-induced 1 dietaryarachidonic 1 Diestelhorst 1 diesel 1 diesease 1 Dierker 1 Diercks 1 Dieppe 1 Diener-West 1 Diefenback 1 Diederich 1 didnot 1 Didelot 1 didactics 1 Dictionary 1 DICOM 1 diclofenac46 1 diclofe-nac 1 Dickman 1 Dickie 1 Dickerson 1 dichotomy 1 dichotomize 1 dichotomizations 1 dichotomised 1 dichotic 1 dichloromethane 1 dicer1-dependent 1 Dicer1 1 dicarbonyls 1 DIC 1 dibromo 1 Dibiase 1 Dibble 1 DiBartolo 1 Diaz-Sanchez 1 Diazgranados 1 Diaz-Espinoza 1 -Diaz 1 diatchen-ko 1 diastole 1 Dias 1 diarrheal 1 diaphoresis 1 Dianosis 1 Dianna 1 Diann 1 diamonds 1 diaminoben-zidine 1 Dialogo 1 Diakonissen-Stif-tungskrankenhaus 1 Diakonie-Kliniken 1 Diakomi 1 diagonally 1 diagnosticity 1 Diagnostica 1 diag-nosed 1 diagment 1 Diagenode 1 Diadema 1 diabetic-related 1 Diabetes-Dementia 1 diabetesd2009 1 diabetes-associated 1 dia-betes 1 Diabet 1 D-I 1 Dhuey 1 DHtest 1 DHRD 1 Dhonneur 1 dhmh 1 Dhingra 1 Dhillon 1 DHEW 1 Dhesi 1 DHD 1 Dharmacon 1 Dhalla 1 DGp 1 D-glutamates 1 D-glutamate 1 D-glucose 1 dg6 1 DFO 1 DFG 1 DF2 1 DF1 1 Deyn 1 Dey 1 dextran-based 1 dextran 1 dexosomes 1 dexmedetomidine 1 dexamthasone 1 dexametha-sone 1 Dewi 1 Dew 1 Devroey 1 Devriendt 1 Devoy 1 devote 1 Devoogdt3 1 DevlinN 1 devitalization 1 Devinsky 1 Devine 1 Deville 1 Devilee 1 Deviet 1 Devico 1 device-related 1 de-vice 1 deviation7 1 deviates 1 deviances 1 Devereux 1 deVere 1 developneuronal 1 DevelopmentalPsychobiology 1 developmental-degenerative 1 develop-mental 1 developmental- 1 developers 1 developer 1 Devaux 1 devastated 1 Deutz 1 Deutsche 1 Deuster 1 Deuschl 1 Deumens 1 Deulofeu 1 deubiquitinating 1 Deubel 1 Deu 1 Detroit 1 detrended 1 detractors 1 detoxifying 1 Deterre 1 determinates 1 determinantsof 1 determinable 1 deteriorations 1 deteriorates 1 deteriorate 1 detergent-or 1 detergent-like 1 detectors 1 Detaille 1 detail21 1 desynchronized 1 desumoylation 1 desumoylated 1 de-struction 1 destroying 1 DeStefano 1 destabilized 1 destabilization 1 Desrosiers 1 Desroches 1 Desplanches 1 Desnick 1 desmosomal 1 Desmond 1 desmoglein 1 designer 1 designating 1 Deshpande 1 desferrioxamine 1 desferal 1 deserves 1 Desempenho 1 desease 1 described14 1 described13 1 Deschenes 1 Deschaies 1 descended 1 desaturates 1 desaturate 1 Desarrollo 1 Desaki 1 Deryk 1 Dervisevic 1 Dersh 1 derqvist 1 DeRoos 1 Dermitzakis 1 Derminio 1 Dermietzel 1 dermatosis 1 dermatoses 1 dermatologic 1 Dermatolog 1 dermal 1 Derlacki 1 Derenzo 1 Derenne 1 DeRemee 1 Der-Avakian 1 Derambure 1 Deputy 1 depts 1 depressions 1 depression-anxiety 1 depression0 1 depres-sion 1 depressing 1 -depressed 1 depressant 1 depots 1 Depot-glucagon 1 depositing 1 depolarizations 1 deploy 1 deplored 1 depletionin 1 depigmentation 1 Depienne 1 de-pends 1 dependentupon 1 dependences 1 dependenceies 1 dependant 1 dependable 1 DEPDC1 1 DePas 1 department-level 1 Depart-ment 1 Departament 1 Deparment 1 deoxyribonucleic 1 deoxynucleotidyl-transferase-mediated 1 -deoxyguanosine 1 deoxycholate 1 deosmication 1 deontology 1 Denyes 1 Dentzer 1 denture 1 density51 1 densitized 1 densin 1 DeNour 1 Denny 1 Denniston 1 Denmeade 1 Denko 1 Deniz 1 Denget 1 Dendrimers 1 DeNavas-Walt 1 Demuth 1 Dempfle 1 Demozay 1 Demonstrations 1 demonstrateda 1 demon-strate 1 demonstrably 1 demography 1 demodulation 1 demo 1 Demirtas 1 DeMill 1 Demierre 1 DeMets 1 demethylase 1 Demerjian 1 demented 1 Demenkov 1 Demb 1 demarcations 1 demarcates 1 demarcated 1 demarcate 1 Demakas 1 DeMaat 1 Delvecchio 1 delusions 1 DeLucia 1 Deltheil 1 delta-method 1 delta-4-5-alpha-reductase 1 -Delta 1 Delori 1 DeLoach 1 Delmas 1 Dello 1 Dellinger 1 Deller 1 Dellen 1 DelleDonne 1 delle 1 Dellas 1 Della-Maggiore 1 Delke 1 deliverer 1 deliverable 1 delipidated 1 delinquent 1 delineatethe 1 deliberately 1 deliberated 1 Delgado-Lista 1 Del-Favero 1 Delevallee-Forte 1 deletion-DHFR 1 Deldin 1 Delcroix 1 delay-encoded 1 delayed-onset 1 delayage 1 Delattre 1 Delasalle 1 Delany 1 Delahunt 1 Delaby 1 dela 1 DeKoskyST 1 DeKosky 1 Dekomien 1 deKemp 1 Dejerine 1 Deistung 1 Deisseroth 1 Deiorio 1 deinstitutionalization 1 dehydroepiandrosterone 1 dehydration 1 dehumanize 1 Dehning 1 Dehnavi 1 Dehmeshki 1 Dehejia 1 Dehaene 1 degruyter 1 degrades 1 degradative 1 degradation-resistant 1 Degos 1 Deglon 1 degli 1 degenerationewhat 1 degener-ation 1 degenerates 1 degenerate 1 DeFronzo 1 DeFrances 1 deformed 1 deformations 1 deformable-shape 1 deformable 1 defluorination 1 deflections 1 deflected 1 definable 1 DeFilippi 1 defi-cits 1 deficiency-associated 1 defi-ciency 1 Deferio 1 defenders 1 defended 1 defendant 1 Defebvre 1 defeat 1 def17gennaio 1 DeerlinV 1 Deerfield 1 deepening 1 Deeney 1 Deene 1 deem 1 Deeds 1 de-duplicating 1 deductions 1 deducing 1 Dedova 1 Dedov 1 Dedman 1 dedifferentiation 1 Dede 1 deDavila 1 DeCuyper 1 de-criminalizing 1 decriminalized 1 decriminalize 1 decriminalization 1 Decressac 1 DeCrespigny 1 decreasein 1 decreased26 1 decoupling 1 decouple 1 Decos 1 Decorte 1 Decorrelating 1 decorrelated 1 decoratively 1 decorative 1 decoration 1 decon-volved 1 deconvolution-based 1 deconvolution 1 de-contextualized 1 decongestants 1 decompressive 1 decompensation 1 decompensated 1 D-Eclipse 1 declarations 1 Decker 1 decisionmaking 1 deciphered 1 decile-based 1 decideto 1 decerebrate 1 deceptive 1 decentralized 1 decent 1 deceives 1 decedents 1 decalcified 1 Decaillot 1 decades-long 1 debulking 1 debulk 1 debris-filled 1 Debre 1 Debra 1 DeBow 1 Debipersad 1 debilitated 1 Debey-Pascher 1 Debetto 1 Debenham 1 DeBeaumont 1 Debby 1 Debarges 1 DeBacker 1 deathsfrom 1 death-registration 1 Deatherage 1 death-associated 1 Deas 1 Dearani 1 de-anonymization 1 Deaner 1 deaminase 1 de-afferented 1 deafferenation 1 dead-time 1 deadly 1 deadlift 1 deacylase 1 deactivations 1 deactivating 1 deactivated 1 Deaconess 1 Deacon 1 deacetylasesfor 1 DDP 1 DDB1 1 Dda 1 dctd 1 -DCT 1 dconnect 1 Dc2 1 DC009433 1 dbm 1 DBD 1 db81 1 db35 1 days2 1 day-light 1 daylight 1 Dayeh 1 day5 1 day4 1 day303 1 day20 1 Dawid 1 Dawe 1 Davranche 1 Dav-letov 1 Davini 1 Davie 1 Davide 1 Davanos 1 Daval 1 Daut 1 dauer-inducing 1 Daueret 1 Daube-Witherspoon 1 DAtransporter 1 dation 1 Datex 1 Dateki 1 dated 1 DataReview 1 DataProject 1 Datapoints 1 data-monitoring 1 data-mining 1 data-mine 1 databasing 1 data26 1 data18 1 data10 1 DAstorage 1 D-aspartate 1 Dasoula 1 Dasmahapatra 1 daseins 1 Daseinanalyse 1 dasatinib 1 Dasatinb 1 Dasari 1 Dart 1 Darrell 1 Darr 1 DAR-Pin 1 Darney 1 dark-through 1 darkening 1 dark-colored 1 darkand 1 darkadapted 1 Dargent-Molina 1 Dargemont 1 DARE 1 Darby 1 DAPT 1 Dapp 1 DAOA 1 Danziger 1 Dantas 1 Dannenbaum 1 Danneels 1 Dank 1 Danion 1 Danilenko 1 Danica 1 Dangwal 1 dangers 1 DAneurons 1 DAneuro 1 Danes 1 DANCER 1 dance 1 Danaee 1 Danad 1 Dams-O 1 Damratoski 1 damping 1 dampens 1 Dammers 1 Damman 1 Damink 1 Damier 1 Damiano 1 Damiani 1 Damberg 1 Damber 1 Dambach 1 Damasio 1 damage-induced 1 damagecomposition 1 Dalrymple-Alford 1 Dallas 1 Dalla 1 Dalkara 1 Dalgleish 1 Dale-Chall 1 Dalal 1 Dalai 1 Dail 1 DAIDS 1 Da-Hong 1 Dahlin 1 DAHANCA 1 Dagher 1 Daggett 1 Dagash 1 Daffy 1 DAF-16-driven 1 DAF-16-dependent 1 DAF16 1 Daeumer 1 Daegu 1 Dadu 1 Dadgostar 1 Dade 1 Dabelea 1 Dabbs 1 DAAO 1 D969 1 D962 1 D5637 1 D543 1 D537 1 D52-D61 1 D-50937 1 D4l 1 D4 1 d3590 1 D3571 1 D2-like 1 d2j 1 D257Amouse 1 D1X 1 d1j 1 D1306 1 D1033 1 D1027 1 d-1 1 D-07740 1 -D 1 Czy 1 Czerwieniec 1 Czernin 1 Czekalski 1 cyto-toxicity 1 Cytotox 1 cytospinning 1 cytospin 1 cyto-skeleton 1 cytosines 1 cytoprotectant 1 cytoplasmicIkBalpha 1 cyto-plasmic 1 Cytopathol 1 cytometry-based 1 Cytology 1 cytologic 1 cytokine-receptor 1 Cytogenet 1 cytochemokines 1 Cy-tochem 1 Cytocell 1 cytoarchitecture 1 Cytoarchitectural 1 cyto-and 1 cytes 1 CY-T 1 cystoscopically 1 cystoids 1 cystectomy 1 cystatin 1 cystathionine 1 cystathionase 1 cyst 1 Cys4 1 Cys3 1 Cys112Arg 1 Cyrulnik 1 Cyprus 1 CYP-mediated 1 CYP46A1-generated 1 CYP3A 1 CYP2R1 1 CYP2C9 1 CYP27A1-and 1 CYP27 1 CYP1A2 1 CYP11A 1 cynomolgus 1 Cyna 1 Cydulka 1 CycMSH 1 cyclooxygenase-2 1 cyclo-oxygenase 1 cyclize 1 cyclist 1 Cyclic-Peptide 1 -cyclic 1 cycle-ergom-eter 1 cycle-ergome-ter 1 cycledependent 1 cycled 1 cyclase 1 cyclam 1 cybrids 1 CyBorD 1 Cybex 1 cyanine 1 CyA 1 Cy5 1 Cy3 1 Cy2 1 CXCR1 1 CXC 1 CX9 1 CX3CR1GFP 1 CX3CR1-depen-dent 1 Cx36 1 CX 1 CWT 1 CVq 1 CVK 1 CVDs 1 CVA 1 CV4 1 Cuypers 1 Cu-Tz-Bn-NOTA 1 cut-ting 1 cut-point 1 cut-offs 1 cutoffs 1 cut-off-point 1 cut-off10 1 cuto 1 cuticle 1 Cuthill 1 cut2 1 custom-written 1 custom-made 1 customised 1 customary 1 custody 1 cusp 1 Cushman 1 Cury 1 curvilinear 1 curvelet 1 curved 1 Curtiss 1 Curti 1 curtain 1 curtailing 1 curtailed 1 cursors 1 cursor 1 Curry 1 Currin 1 Curriero 1 current-time 1 Current5 1 curls 1 curl 1 Curitiba 1 Cureton 1 curbside 1 Curatolo 1 curativere-section 1 curatively 1 curated 1 Curadei 1 curable 1 Curability 1 cura 1 cupula 1 Cupples 1 Cup 1 Cunnigham 1 cunhavaz 1 cumulatively 1 Cummington 1 culty 1 Cultura 1 cultivated 1 culmination 1 culminated 1 Cullen 1 Cull 1 Culig 1 CUL4 1 Cuipers 1 Cuesta 1 cuesand 1 Cuervo 1 Cuenca 1 Cuellar 1 Cucchiara 1 cuboidal 1 Cubbin 1 Cuartero 1 Cu2 1 ctr-search 1 CTQ2008-00755 1 CTor 1 Cto 1 Ctnnb1 1 CTM-associated 1 CTGFand 1 CTG 1 CTCTTGTGTATGGC 1 CTCAE-dysphagia 1 CTC 1 CT-and 1 CTA-3 1 CT750 1 ct2 1 C--T 1 C-T 1 C-statistics 1 CSIRO 1 CSIC-UMH 1 csE 1 CSD2007-00023 1 C-scans 1 CSbCSb 1 CSaCSa 1 CS4 1 CS-15 1 Cs-137 1 Crystallographic 1 crystallisation 1 cryovials 1 cryosectioning 1 Cryopreserved 1 cryomicrotomes 1 cryomicrotome 1 Cryer 1 Cruts 1 Crutcher 1 crush-resistant 1 crusher 1 Crump 1 CRUK 1 cruitment 1 cruciferous 1 CRPS-induced 1 CRPS1-related 1 CRPS 1 Croxford 1 Crowson 1 crowding 1 Croux 1 Croughan 1 CrouchMA 1 Crott 1 cross-trial 1 cross-talking 1 cross-tabulation 1 cross-tabulated 1 crosstabs 1 cross-subject 1 cross-seeding 1 crosssectional 1 cross-resistant 1 cross-react 1 cross-protective 1 cross-over 1 Cross-matching 1 crossmatching 1 cross-matched 1 crossmatched 1 Crossman 1 crosslinks 1 crosslinking 1 cross-linked 1 Crossland 1 crossings 1 Cross-hatching 1 Crossett 1 cross-cutting 1 cross-bridged 1 cross- 1 Croskerry 1 Crosbie 1 crops 1 Cropley 1 crop 1 cronological 1 Crone 1 Crompton 1 Crommelinck 1 Crome 1 Crohn 1 Croghan 1 Croft 1 Croce2 1 CRL-2540 1 Crizotinib 1 Crivello 1 critics 1 criticized 1 criteria-based 1 criteria23 1 Cristovo 1 Cristian 1 Cristalia 1 Crisanti 1 Crippa 1 Crino 1 Criminology 1 cricketer 1 Crichlow 1 Cribier 1 Crewther 1 Crews 1 Creu 1 cresyl 1 crest 1 Cress 1 Crescenzi 1 Crescentini 1 crescent 1 Crepaldi 1 Cremasco 1 Cremades 1 c-Rel 1 Creighton 1 Cre-ERT2 1 Creed 1 Creech 1 CREE 1 credit 1 credentials 1 creatures 1 creator 1 crease 1 Creac 1 CRD42012002737 1 CRC-specific 1 CRC-15R 1 craving 1 cratere 1 crater 1 crashed 1 Crapo 1 cranium 1 Craniomaxillofac 1 Craniofac 1 cranio-caudal 1 cranially 1 cramping 1 cramped 1 Cramp 1 Crammer 1 Cramer 1 Craighead 1 Cragg 1 craftsmanship 1 Craen 1 Cracking 1 Cracco 1 CR1 1 CQ 1 CPXin 1 CPX-HF 1 CPXa 1 cps 1 Cp-KepCt 1 CPI-U 1 cpid1404 1 CpG-methylation 1 CpG-binding 1 Cp-Ct 1 CPAD 1 CP-31398 1 CP10 1 Cox-type 1 COX-2 1 coworkers10 1 Cowcaddens 1 cow 1 Covy 1 Covinsky 1 Coviello 1 Covidien 1 Coviden 1 cover-slipped 1 Coverdell 1 covarying 1 covaries 1 cova-riates 1 co-variances 1 covariances 1 covariables 1 Covance 1 covalentlylinked 1 Covadonga 1 Couture 1 Coutts 1 Coutifaris 1 Courtney 1 courtesy 1 Courrier 1 Courchesne 1 Cour 1 coupes 1 coupe 1 country-specific 1 countless 1 counterstain 1 counters 1 Counterpoint 1 countered 1 counter-balanced 1 Counsell 1 counsel 1 Couns 1 Couillard-Despres 1 coughs 1 Coughlan 1 cough-induced 1 couen 1 Cottu 1 cotton-wool 1 Cottama 1 cotherapy 1 Cotch 1 Cost-utility 1 Cost-related 1 co-stratify 1 cost-of-illness 1 costliest 1 costing 1 costimulatory 1 Costill 1 Costerton 1 Coster 1 Costelli 1 Cost-efficacy 1 cost-conscious 1 cost-comparison 1 cost-benefit 1 Costar 1 Costanzo 1 Costantino 1 Cossette 1 cosponsored 1 Coso2 1 cosmid 1 Cosmetic 1 COSMED 1 Coskun 1 Co-segregation 1 Cosci 1 Cory-Slechta 1 Coryell 1 cortiso-d4 1 Cortina 1 cortico-striatal-pallidal-thalamic 1 corticostriatal 1 corticoster-one 1 corticosterone 1 corticosteroid-treated 1 corticosteroid-sparing 1 Corticoste-roids 1 cortico-spinal 1 cortico-peripheral 1 corticomotoneuronal 1 cortico-cortical 1 Corti 1 Cortez-Retamozzo 1 cortex41 1 cor-tex 1 Cortese 1 Cortes2 1 Cortellaro 1 cortectomies 1 Corte 1 Corsmit 1 Corry 1 corruption 1 corroborateresults 1 Corrie 1 correspond-ing 1 correlogram 1 correla-tions 1 correlational 1 correlatesof 1 Correia-Melo 1 corrective 1 cor-rection 1 corporating 1 corporate 1 Corpor 1 coronary-artery 1 coronaryartery 1 Corona 1 cornua 1 Cornu 1 Cornet 1 corners 1 corner 1 corneas 1 corneadetermining 1 Cormie 1 Cormack 1 Corle 1 Corkey 1 Coricelli 1 Corfas 1 CoreValve 1 core-needle 1 co-related 1 coregulating 1 coregistrations 1 co-registered 1 coregistered 1 Cordier 1 Cordero 1 Cordenonsi 1 Cordato 1 CORD-AEUS 1 Corbino 1 Corbin 1 Corberaet 1 Corao 1 cor 1 Coquoz 1 copyrighted 1 copying 1 copurfied 1 co-principal 1 coprecipitated 1 copolymers 1 Copolov 1 Coplan 1 Copits 1 Copenh 1 Copel 1 coped 1 coordiation 1 Coordenao 1 Coopers 1 CooperRF 1 Coopere 1 Coombes 1 Cools 1 cooled 1 cool-down 1 coolant 1 Cook18 1 co-occurring 1 co-occurrence 1 convolved 1 Convit 1 convinced 1 conviction 1 convicted 1 convey 1 converter 1 conversational 1 converges 1 convened 1 convective 1 convalescing 1 control-transduced 1 con-trols 1 controllable 1 controlindividuals 1 controlateral 1 con-trol 1 contributionsto 1 contributesto 1 contrast-enhancing 1 contralateral-ipsilateral 1 contra-lateral 1 contradicts 1 contractors 1 contraction-relaxation 1 contraction-activated 1 contours 1 contour-based 1 continuous-release 1 continuesto 1 continually 1 continual 1 continu 1 continously 1 contingent 1 Contin 1 CONTI 1 contextually 1 context-related 1 context-dependent 1 contested 1 con-tents 1 contended 1 contend 1 Contem-porary 1 contemporaneous 1 contemplates 1 Conte 1 contaminations 1 contaminants 1 con-tains 1 contagious 1 consumptions 1 con-sumption 1 consummate 1 Consultante 1 ConsultantdAllergan 1 consultancies 1 Consuegra-Garcia 1 constructing 1 constrictors 1 constrictive 1 constricted 1 constrict 1 constraint- 1 Constrains 1 constraining 1 constrain 1 constitutively 1 constituently 1 constipating 1 constantload 1 Constantinidou 1 Constantinides 1 constant-current 1 Constance 1 Consortiumon 1 consortia 1 Consonant-Vowel 1 consolidations 1 consolidation44 1 Consoli 1 consoles 1 Consitt 1 consistentwith 1 con-sistent 1 consistencyin 1 consistences 1 Consiglio 1 con-sidered 1 conserving 1 conserves 1 conserve 1 consequential 1 con-sequences 1 consequece 1 consentire 1 consentby 1 con-sent 1 consensus-endorsed 1 Con-sensus 1 consanguinity 1 cons 1 Conroy 1 Conraads 1 connotes 1 Conney 1 connexon 1 connexin 1 Conner-spady 1 Conners 1 Connelly 1 Connectomic 1 conjunctivitis 1 conjunctiva 1 conjugates 1 -conjugated 1 conjectures 1 conjecture 1 conical 1 congruent 1 Congest 1 confusing 1 confused 1 confuse 1 Confronting 1 confronted 1 con-founders 1 conforms 1 conformations 1 conformation-dependent 1 conformationally 1 confldence 1 conflation 1 confirmedby 1 confinedto 1 configuring 1 Configual 1 confidant 1 confict 1 conferring 1 Coney 1 Conerly 1 cone-rich 1 cone-related 1 cone-enriched 1 cone-dominated 1 conedensity 1 conduits 1 conductors 1 con-ducted 1 Condon 1 condition-specific 1 Condition-adapted 1 condenser 1 Concorde 1 CON-CORD 1 conclusive 1 Concilium 1 concernedonly 1 conceptualising 1 concentrics 1 concentration-time 1 concentrationsin 1 concentrationmay 1 concentration-effect 1 concentrates 1 concent 1 conceivable 1 Conceicao 1 concede 1 concave 1 computingPb 1 computes 1 computer-intensive 1 computer-evaluation 1 computer-delivered 1 Computations 1 Compton 1 compromises 1 compressione 1 compressing 1 compresses 1 compress 1 comprehensibility 1 compositions 1 compositional 1 composedof 1 component-based 1 complimentary 1 compliment 1 complied 1 complicity 1 complica-tions 1 -compliant 1 ComplianceRegulatoryInformation 1 complexityand 1 com-plexity 1 complexI 1 com-plex 1 CompleteTM 1 completes 1 completers 1 complements 1 complement-regulatory 1 complement-mediated 1 complement-containing 1 Comple-mentary 1 com-plaining 1 complaining 1 compiling 1 Competitividad 1 competitiveness 1 competition-related 1 competing-risks 1 competes 1 compensations 1 compensated 1 compassionate 1 compartmentation 1 compart-mentalization 1 compartmentalization 1 compartmental 1 comparisons21 1 Comparisonof 1 comparion 1 Comparedto 1 com-pare 1 comparably 1 compara-ble 1 Companjen 1 compactness 1 compactly 1 comopared 1 Como 1 com-muting 1 commute 1 community-residing 1 community-living 1 Communis 1 communicated 1 Com-mun 1 commonpolymorphism 1 commonplace 1 common-law 1 commonalities 1 commitments 1 commingled 1 commercialized 1 commercialization 1 commerce 1 commenting 1 commendationata 1 commendation 1 Commendably 1 commencing 1 commence 1 commemorative 1 comittee 1 Comit 1 Comijs 1 comforting 1 comers 1 Comella 1 Combustible 1 comb-like 1 combing 1 Combined-modality 1 combinedactions 1 com-bined 1 combinatorial 1 combinationsof 1 combating 1 Combate 1 Combarros 1 Comba 1 Comarcal 1 Colwell 1 Columbo 1 Colucci 1 colpopexy 1 Colotto 1 colostomy 1 colorful 1 colored 1 color-coded 1 colorcoded 1 colorblindness 1 Coloradoans 1 colon-specific 1 colonoscopy 1 colonoscopic 1 Colon-Emeric 1 Colom 1 Colognori 1 cological 1 Coloff 1 colocalizes 1 co-localized 1 co-localization 1 coloanal 1 coload 1 colloquially 1 colllaboration 1 Collison 1 Collinson 1 Collins5 1 collimation 1 collimated 1 Collette 1 Coller 1 Collen 1 College-Hill 1 college-aged 1 colleagues9 1 colleagues7 1 colleagues45 1 colleagues4 1 colleagues39 1 colleagues28 1 colleagues26 1 colleagues25 1 colleagues21 1 colleagues20 1 colleagues18 1 colleagues16 1 colleague 1 Collavin 1 Collard 1 collapses 1 Collantes 1 Collan 1 collagen-induced 1 collagenases 1 Collagenase-3 1 collaborated 1 collaborate 1 colitis-related 1 colistin-oxolinic 1 Colijn 1 Colford 1 Colesse 1 Colen 1 cold-signaling 1 cold-recipient 1 Colburn 1 Colbran 1 Colasse 1 Colagrande 1 Coker 1 Coit 1 coinvestigators 1 Coinjection 1 coining 1 Coindre 1 coincubation 1 coinciding 1 Coincidentally 1 coincidences 1 Coimmunoprecipitation 1 Coiera 1 coi 1 cohortof 1 cohortmiR-106a 1 Cohn 1 cohesion 1 coherencetomography 1 Cohan 1 cohabiting 1 Cogswell 1 cogs 1 cogovern 1 Cognitive-behaviour 1 cognitive-behavior 1 cognitive-affective 1 cognitiveabilities 1 cognitioneWMH 1 cognifactors 1 Cognet 1 Cognacq-Jay 1 Cogito 1 Coggon 1 cogent 1 Cog- 1 Coffill 1 Coffee 1 cofactoring 1 co-factor 1 coexpressed 1 coexists 1 co-existing 1 coexistent 1 Co-existence 1 coexistence 1 co-evolution 1 Coesfeld 1 coercion 1 coenzyme 1 Coenen-Schimke 1 Coen 1 coelomocyte 1 co-efficients 1 COE 1 Codon-Based 1 codirector 1 codify 1 codi 1 CodeSet 1 cocultures 1 cocultured 1 Cockrell 1 Cocito 1 Cochran-Mantel-Haenszel 1 Cochrane-Mantel-Haenszel 1 cochra-ne-handbook 1 Cochran-Armitage 1 Cocchi 1 Coburn-Litvak 1 Coburn 1 COBRE 1 Cobden 1 Cobain 1 COB 1 coauthor 1 coats 1 coating 1 Coatesworth 1 coanalgetic 1 Coalter 1 Coalson 1 coagulopathic 1 coagulated 1 Coagul 1 coactivator-1 1 co-activator 1 coactivator 1 coactivation 1 CoA 1 CO6RR020135-01 1 CNSastrocytosis 1 CNRS-Universite 1 cnica 1 CNIC-06 1 Cnattingius 1 CMS-PQRS 1 CMRP 1 CM-RMG 1 CMPP 1 CMO 1 c-Met 1 CME 1 CMACE 1 cluttered 1 clutter 1 clusterization 1 Clusterin 1 clumsiness 1 Cluitmans 1 Clugston 1 CLP 1 clozapine 1 Cloutier 1 Clouse 1 Cloughesy 1 Clough 1 cloudy 1 clouds 1 cloud- 1 clothing 1 clot 1 closures 1 Clostridia 1 closing 1 closes 1 close-out 1 close2 1 clonal-related 1 clodronic 1 clockwood 1 clock 1 CLL2 1 Cliver 1 ClinNorth 1 ClinJPain 1 clinique 1 ClinInvest 1 Clinimetric 1 clinico-path- 1 clinician-information-us-healthcare-settings 1 clinician-identifiable 1 clinician-assessed 1 clinician- 1 clinic-based 1 clinicaltrialsregister 1 clinical-quality 1 clinical-practice-improvement 1 clinicalpain 1 clinicaloutcomes 1 clinicalfeatures 1 clinicalempirical 1 clinicaland 1 clinica 1 clinic6 1 Clingman 1 clincial 1 climbers 1 Climatol 1 climates 1 climate-controlled 1 clilnical 1 clientsengaged 1 client-centered 1 clicked 1 CLFJ 1 Cleves 1 clever 1 cles 1 Clementel 1 Clemente 1 Clement 1 clefts 1 cleavageis 1 cleavage-embryo 1 cleats 1 Cleary 1 clears 1 Cleare 1 Clearanceof 1 Clean-Blot 1 clean 1 Clea 1 CLCN2 1 ClC-2 1 CLC 1 Clayton 1 Clayden 1 Clax 1 Clauss 1 Claudius 1 Claudia 1 classwise 1 class-related 1 classmates 1 classIPI3-kinases 1 classifies 1 classification3 1 Classen 1 class-effect 1 clasifier 1 clash 1 Clasen 1 Clarsen 1 Clarke-Pearson 1 clarifies 1 clarifications 1 clarification 1 Claret 1 Clareet 1 Clardy 1 Clanet 1 cland 1 Clancyet 1 claiming 1 Claesson 1 Claessen 1 Claassen 1 Claar 1 CL1 1 ckrath 1 ckle 1 c-Jun 1 CJMdG 1 CJG 1 CJEM 1 Cizik 1 Civitelli 1 civilizations 1 civilians 1 Civic 1 Civatte 1 CIV-101 1 Ciurana 1 Ciu 1 city-wide 1 city-centre 1 cits 1 citrated 1 citrate-based 1 citizens 1 cites 1 Citarella 1 cisterns 1 cisternae 1 Cirruscube 1 circumventing 1 circumvented 1 circumpapillary 1 circumferentially 1 circu-lation 1 circuitries 1 circled 1 Cir 1 cip 1 Cioroch 1 Ciof 1 cinka 1 cingulumotomy 1 cingulectomy 1 cingulated 1 cinematographical 1 Cineantropom 1 Cindy 1 Ciminello 1 Cillo 1 Ciliax 1 C-III 1 Cifuentes-Diaz 1 Ciesielski 1 cients 1 ciently 1 Cienc 1 Ciefincias 1 Cideciyan 1 CICR 1 Ciccone 1 Cicalese 1 Cibulskis 1 CIBERESP 1 Cibelli 1 Ciarlo 1 ciaries 1 Ciardiello 1 Ciardella 1 Cianchini 1 cia 1 Chytil 1 CHUV 1 Chusid 1 chu-reims 1 Churchward-Venne 1 Churchill-Livingstone 1 churches 1 Chungyee 1 Chu-makov 1 Chuckowree 1 chronotropy 1 chronification 1 chronicunderfunding 1 chronic-type 1 chronicillness 1 chronicfatigue 1 Chron 1 chromosome11q13 1 chromo-some 1 Chromogenic 1 chromo-gen 1 chromodomain 1 chromatography-electrospray 1 chromatographic 1 chromatograph 1 chromatin-enriched 1 chromatin-association 1 chromatin-associated 1 Christos 1 Christopoulos 1 Christoff 1 Christodoulou 1 Christmas 1 Christich 1 Christiane 1 christened 1 Christene 1 Christelle 1 Christal 1 Chrisp 1 Chriqui 1 Chowdhury 1 Choudhary 1 Chouaid 1 Choti 1 choroids 1 choroid-RPE 1 choroideremia 1 choroid-directed 1 choroidalvasculature 1 Chorneyko 1 choristomas 1 choriopillaris-equivalent 1 chorion 1 choriodecidual 1 choriocapillary 1 choriocapillaris- 1 chores 1 Choquet 1 chooses 1 choosea 1 Chooi 1 Choo 1 Chondroradionecrosis 1 chondropathy 1 chondroblasts 1 Chon 1 Chompret 1 Chomka 1 cholesterylester 1 cholesterol-poor 1 cholesterol-laden 1 cholesterol-independent 1 cholesterol-hydroxylating 1 cholesterol-fed 1 cholesterol-enriched 1 cholesterol-dependent 1 cholesterol-deficient 1 cholesterol-catabolizing 1 cholesterol-cardiovascular 1 cholesterol-bearing 1 -cholesterol 1 cholesterogenic 1 cholesterinsteatose 1 cholestatrienol 1 choledocholithiasis 1 chole-cystectomy 1 Choinie 1 Choi-Lundberg 1 chocolates 1 Chochlear 1 Chng 1 Chlouverakis 1 chlorpromazine 1 chloroquineretinopathy 1 Chklovskii 1 Chiung-Chyi 1 Chittle 1 Chisum 1 Chisolm 1 Chisholm 1 Chisari 1 Chirurg 1 Chiropr 1 chips 1 Chiovenda 1 Chintakindi 1 ChintagumpalaM 1 ChinS 1 Chinot 1 Ching 1 China-responsibilities 1 China36Chair 1 China21Centre 1 chiming 1 chimera 1 Chimenti 1 chills 1 chilled 1 childrenwho 1 Children-Third 1 chil-dren 1 ChildPsychology 1 childhood-onset 1 child-hood 1 Childers 1 child-centered 1 Chilcoat 1 Chieti 1 Chien 1 Chieffo 1 Chidley 1 chick 1 Chi-Chao 1 Chibnall 1 CHIAVE 1 Chia-Ter 1 Chiarello 1 Chiappelli 1 Chhabra 1 CHF 1 Chewning 1 Chevy 1 Chevrolet 1 Chevillet 1 ChevilleA 1 Cheville 1 Chevez-Barrios 1 Chetty 1 Chesworth 1 Chessell 1 Cheson 1 Chesluk 1 Chesler 1 Cheskin 1 Chesi 1 Chertow 1 Cheroutre 1 Cherla 1 Cherif 1 Chepeha 1 Cheong 1 Cheok 1 ChenX 1 Chenget 1 Chengdu 1 Chemtob 1 chemotherapy-related 1 chemotherapies 1 chemotherapeutics 1 chemotherapeutic 1 chemotaxin 1 chemosensitizing 1 chemosensi-tive 1 chemoresistance 1 chemoreflex 1 chemoreduction 1 chemo-radiotherapy 1 chemokine-controlled 1 chemo-kine 1 chemoirradiation 1 Chemo-IMRT 1 chemo-immunotherapy 1 chemoembolisation 1 chemoattraction 1 chemo 1 chemist 1 chemiluminescence 1 ChemiDoc 1 Chemerinski 1 chelator-modified 1 chelated 1 Cheifetz 1 Cheeran 1 Cheema 1 checkpoint 1 Checkoway 1 checklist-driven 1 check-list 1 checkerboard 1 Cheah 1 Che 1 Chdh- 1 Chazotte 1 Chazan 1 Chavoix 1 Chavira 1 Chavez-Valdez 1 Chavda 1 Chavarren 1 Chauvet 1 Chauvel 1 Chauvaud 1 Chaudhry 1 Chatterji 1 Chassin 1 chaser 1 Charybdis 1 chart-based 1 Charron 1 Charpak 1 Charo 1 Charnsan-gavej 1 Charnsangavej 1 Charneco 1 Charlton 1 Charlesworth 1 Charleston 1 CharlesF 1 Charite 1 Charit 1 Chariot 1 chargecoupled 1 Charbel 1 Charalambides 1 Charakida 1 characteristicsof 1 character-istics 1 character- 1 Chaperoning 1 chap 1 Chantala 1 Chantal 1 Chant 1 Chanraud 1 Chanques 1 channelprotein 1 channelopathies 1 channeling 1 Chan-Ling 1 Chang-Lin 1 Changeux 1 Changet 1 changesis 1 changes1 1 Chandrasekharappa 1 Chandran 1 Chandra 1 Chandler 1 Chanderashekhar 1 Chand 1 CHAMPLAIN 1 Championship 1 championed 1 Champely 1 Champaign 1 Champagne-Ardenne 1 Chamonix 1 Chambon 1 chamber-associated 1 Chalouni 1 challenger 1 Chalkley 1 Chakraverty 1 Chakravarti 1 Chakraborty 1 ChakrabortiT 1 ChakrabortiS 1 Chaitman 1 Chairperson-elect 1 Chae-Yong 1 Chad 1 Chacon-Camacho 1 Chabot 1 CH-5001 1 ch2 1 CH-1 1 ch1 1 cGy 1 CGRP 1 CGC 1 CG45 1 CG110 1 CFRSearch 1 Cfor 1 C-fiber 1 CFI 1 cfdocs 1 CFD3 1 cfcfr 1 CF3200 1 Cetiner 1 cetera 1 Cesur 1 Cesar 1 cervicomedullary 1 cervical-vaginal 1 Cervero 1 Cervantes 1 ceruloplasmin 1 Ceruelo 1 Certificate 1 Cerretelli 1 Cerra 1 Cerovecki 1 Ceroni 1 Cerone 1 Cerner 1 cerivisiae 1 Ceriani 1 cere-brovascular 1 cerebro-vascular 1 cere-brospinal 1 cerebromalacea 1 cerebrocer-ebellar 1 cereal 1 Cerdeno 1 cerclage 1 c-erbB-2 1 CEQ2000 1 ceptor 1 Cepko 1 Cepeda 1 Centurion 1 cents 1 centromeric 1 centrifugation 1 Cen-tri 1 central-to-peripheral 1 centralfatigue 1 centralauditory 1 centra 1 centile 1 center-point 1 center-involved 1 centeral 1 Centeno 1 cente-narian 1 centenaire 1 censoring 1 censor 1 Cenci 1 Cen 1 cements 1 cement 1 Cely 1 cellulose 1 cellularcations 1 Cellulaires 1 Cellulaire 1 Cellucci 1 Cell-type 1 CellStem 1 cellsmay 1 cellsin 1 cellsdie 1 cell-restricted 1 Cell-produced 1 cell-processing 1 cellloss 1 celllinesMDA-MB-361DYT2andBT474M1 1 cell-intrinsic 1 cell-bound 1 Cell9 1 Cell148 1 cell- 1 Celine 1 CELF-3 1 celebrate 1 Celas 1 cej 1 CEG 1 Cees 1 Cedric 1 Cedex 1 Cedazo-Minguez 1 Cecil 1 Ceccon 1 Ceballos-Baumann 1 ceases 1 cease 1 CEA-Saclay 1 cear4 1 CE001430 1 CE000620 1 CDX2P-NLS 1 CDSR 1 CDRs 1 CD-ROM 1 cdrh 1 CDR3 1 CDPs 1 CDN 1 CDKL5 1 CDFTX 1 CDFCT 1 Cdc48p 1 CD95L-induced 1 CD95L 1 CD8tT 1 CD7-nega-tive 1 CD7-negative 1 CD72 1 -CD7 1 CD56 1 CD55 1 CD5 1 CD45-133-31 1 CD44 1 CD40 1 -CD4 1 CD3-lymphocyte 1 CD38CD138 1 CD34-133 1 CD31 1 -CD3 1 CD28 1 CD27t 1 CD26 1 CD20-expressing 1 CD20-directed 1 CD206 1 CD200R 1 CD2 1 CD19-purified 1 CD14-negative 1 CD144 1 CD138low 1 CD11b-positive 1 CD11b 1 CD-1 1 CD1 1 CD09 1 CD008465 1 CD006927 1 CD005593 1 CD005465 1 CD005211 1 CD004433 1 CD003200 1 CD003162 1 CD002118 1 CD001058 1 ccur 1 CCTSA 1 CCTs 1 CCSG 1 CCRP 1 CCR1 1 CCP 1 CCND1 1 CCMSHwere 1 cclm 1 Ccl2-knockout 1 CCL21 1 CCC-1106 1 C-carriers 1 CBTRUS 1 CBTprogramme 1 cbp-1 1 CBP 1 CBL 1 cbioportal 1 cBIO 1 cbil 1 CBHSQ 1 cbf 1 CBbs 1 CBb-driven 1 CBb6w 1 CBb6 1 CBb5 1 CBb4-5i 1 CBb4 1 CBAS 1 CBa2w 1 CBa1-2i 1 CBa1 1 CB17-Prkdcscid 1 Cazeneuve 1 Cayman 1 cavitation 1 Cavett 1 caves 1 Caversaccio 1 cavernomas 1 cavernama 1 caveolae 1 Cavenagh 1 Caveliers 1 Cavelaars 1 caveats 1 Cavbeta 1 Cavazza 1 Cavanna 1 cavallerano 1 Ca-valle-Busquets 1 Cavalle-Busquets 1 Cavagnino 1 Cavacini 1 cautious 1 cautioned 1 cauterization 1 causingcrowdout 1 Causeway 1 causesmitochondrial 1 causesdopamine 1 causesdamage 1 causepathogenic 1 causemitochondrial 1 cause-effect 1 causean 1 causea 1 causallymediated 1 Caumo 1 cauliflower 1 Cauley 1 caught 1 Caudo-rostral 1 caudorostral 1 caudal-to-cephalad 1 caudally 1 caudal 1 Caucasianand 1 Cattano 1 cats 1 Catrucci 1 Catovsky 1 Catlin 1 cations 1 cathode 1 catheter-directed 1 catheter-associated 1 Catharina 1 caters 1 -catenin 1 catenary 1 categorising 1 categorisation 1 categorically 1 cated 1 catecholamine-stimulated 1 catecholamine-driven 1 cat-echolamine 1 catechol 1 catechins 1 Cate 1 catchment 1 catch 1 catastropizing 1 catastrophizes 1 catastrophized 1 catastrophize 1 catastrophising 1 Catania 1 Catana 1 catalyzing 1 -catalyzed 1 catalyze 1 catalyst 1 catalog 1 Cataldo 1 Catalana 1 Catalan 1 catabolize 1 catabolic 1 casual 1 Castorina 1 Castner 1 Castillo-Page 1 Castelo 1 Castellini 1 Castellarin 1 Castellano 1 Castelain 1 Castanon 1 Castaneda 1 Castana 1 Castaman 1 Castaldo 1 Castagna 1 Castaener 1 Casta 1 Cassou 1 Cassio 1 cassettes 1 Casscells 1 Cassarino 1 Cassano 1 Cassandrini 1 Cassady 1 Cass 1 Caspi 1 caspase-to 1 caspases 1 caspase-independent 1 caspase-8 1 caspase-3-mediated 1 caspase-3-cleaved 1 caspase-1 1 caspase 1 Casimirri 1 Casie 1 cash-back 1 Cash 1 casesof 1 casesE2 1 casesall 1 CaseS4 1 casereports 1 case-notes 1 casenotes 1 case-mix 1 case-matched 1 caseloads 1 case-controlled 1 CaScoring 1 Cascione 1 Cascio 1 Casbas 1 Casazza 1 Casas 1 Casari 1 Casanova 1 Casamitjana 1 Casals 1 Casalino 1 Casalini 1 Casale 1 Casal 1 Casagrande 1 Casadei 1 Casaburi 1 Casa 1 Caryn 1 carvings 1 Carven 1 carve 1 Cartron 1 cartridges 1 cartoon 1 cartons 1 cartilaginous 1 Carta 1 Carstens 1 Carsten 1 Carson1 1 Carrozzo 1 carrier-201 1 Carrideo 1 Carretero 1 Carrau 1 Carrato 1 Carrasquillo 1 Carracedo 1 Carpizo 1 Carpin-teria 1 Carpinteria 1 Carpino 1 Carpenteria 1 carp 1 carotidradial 1 carotenoid 1 Caroni 1 Caroline 1 Carola 1 Caro 1 Carnevale 1 Carnethon 1 carmustine 1 Carmine 1 Carmi 1 Carmelia 1 C-arm 1 Carlton 1 Carlisle 1 Carlisi 1 Carlin1 1 Carlier 1 Carless 1 Caribe 1 cargo 1 Carfagna 1 Carew 1 caretaker 1 caregivng 1 Caregaro 1 care-facilities 1 career-ending 1 Cardoso 1 cardiovasculardisease 1 cardiovascularand 1 Cardio-Thoracic 1 cardiomiopathy 1 Cardio-2CP 1 Cardinale 1 cardiacdilation 1 Cardenas-Turanzas 1 Cardellini 1 carcinosarcoma 1 Carcinoma1 1 car-cinoma 1 carcinoid 1 carcinogens 1 carcinogen-induced 1 carcino-genic 1 Carcino-genesis 1 carcinoembryonicantigen 1 carcinoembryonic 1 Carchman 1 carboxypeptidase-mediated 1 carboxymethyllysine 1 carboxyl-terminal 1 carboxy 1 car-boplatin 1 carbonyls 1 carbonylation 1 carbonyl-11C 1 carbonyl 1 Carbonneau 1 CarbonMetabolism 1 Carbone 1 carbonate 1 carbohydrateof 1 Carbohydrate- 1 carbinolamines 1 carbenicillin 1 carbamylation-dependent 1 Carbamylated-oxidized 1 Carbamyl-ated 1 carbamazepine 1 Carballo-Carbajal 1 Carballedo 1 Carazo 1 Carayon 1 Caraux 1 Carasi 1 carapaces 1 Caramia 1 Carafoli 1 Cara 1 Caputi 1 Capurso 1 Captions 1 Caprioli 1 CAPR-10-0295 1 Capponcelli 1 Cappola 1 Cappell 1 Caporale 1 Capocaccia 1 Capnomac 1 capitis 1 capitated 1 capitalize 1 capital 1 Capiris 1 Capintec 1 -Capetillo 1 Capello 1 Capelli 1 Capecchi 1 Capdevila 1 capacity30 1 Capaci 1 Caoili 1 Canzonieri 1 Canzoneri 1 Cantz 1 Canturk 1 Cantrill 1 Cantorias 1 Canto 1 -cantly 1 cans 1 Canoas 1 cannulated 1 cannulas 1 Canning 1 canned 1 cannabis 1 Cannabinoids 1 Canine 1 Canham 1 candidacy 1 Candiano 1 Candal-Couto 1 Candal 1 CanCORS 1 cancertopics 1 cancer-specifi 1 can-cers 1 cancerresearchuk 1 cancerrese 1 cancerous 1 cancernetwork 1 cancer-info 1 can-cerimagingarchive 1 cancer-identifying 1 cancergenome 1 Cancer-derived 1 cancerand 1 cancer4 1 cancer15 1 cancer- 1 cancellation 1 canceled 1 cance 1 Canavan 1 CanAm 1 Canalis 1 canaffect 1 Canadell 1 Canada15Department 1 CaNa2 1 Camps 1 cAMP-mediated 1 Campioni 1 Campello 1 Campath-1H 1 Campa 1 Cammen 1 Caminati 1 Camilo 1 Camicioli 1 Camelo 1 Camelid 1 Camchong 1 Cambier 1 Camb 1 Camarillo-Blancarte 1 Camargos 1 Camargo 1 CAMARADES 1 Camara 1 Calverley 1 Calvente 1 calvarial 1 Calvani 1 Calucci 1 Caltabiano 1 Calsyntenin-1 1 Calponin 1 calpain-and 1 Calpain-1-mediated 1 calo-ries 1 calorierestriction 1 calorie-dense 1 Calonje 1 Calo 1 -calmodulin 1 Calmbach 1 Calleros 1 Calleja 1 Calle 1 Callas 1 Cali-fornia 1 calibrations 1 calibers 1 Calhoun 1 calgranulin 1 calcup 1 calculator 1 calcium-water 1 calcium-sensitive 1 calciumis 1 calcium-induced 1 calcium-current 1 calciumchannels 1 calcify 1 calcified 1 Calcif 1 Calcaterra 1 calbindin 1 Calbet 1 Calapai 1 Calame 1 Calado 1 CAL-101 1 cake 1 Caiola 1 Caine 1 Cahoon 1 Cahalan 1 Caglioti 1 Caglieris 1 Cagle 1 Caffo 1 Caffeine0s 1 cafes 1 Cafer 1 Cafarelli 1 caesareans 1 cadherins 1 Cadherine 1 cadets 1 Cadet 1 -Cadenas 1 Cade 1 cactus-deficient 1 cact1 1 Caccappolo 1 cacancerjournal 1 CACACA-30 1 Cabrera 1 caBIG 1 Caberg 1 Cabanas 1 CA59827 1 Ca2-activated 1 CA152758 1 CA148302 1 CA134719 1 CA126809 1 CA078230 1 CA060553 1 -Ca 1 C967-77 1 C7orf10 1 C75BL 1 C756 1 C748 1 C6 1 C5a 1 C57Bl6Sv129 1 C5 1 C490 1 C4-7 1 C403 1 C366G 1 c3666 1 C2C12 1 C28-3E 1 C24 1 C20 1 C1si 1 C1q 1 C1-C6 1 C174Y 1 C1245AAL 1 C06 1 bZIP 1 BZ 1 Byung 1 bythe 1 byte 1 Bystryn 1 bypassing 1 bypasses 1 by-pass 1 Bynum 1 by-nc-sa 1 Bylund 1 Bylesjo 1 bygrowth-hormone-mediated 1 byfMRI 1 Byczkowski 1 byArendt 1 byareas 1 Byar 1 bya 1 BWH 1 b-weighted 1 Bwaka 1 BVMD-related 1 BVMDare 1 BVMD42 1 BVMD32 1 B-vitamins 1 b-values 1 bvalues 1 BV2 1 Buzzi 1 buzzer 1 Buzaid 1 Buysse 1 buys 1 Buvat 1 Buuse 1 Buunen 1 butyric 1 butto 1 Butterworth 1 Butterfield 1 butter 1 butnot 1 Butchar 1 Bussey-Jones 1 Bussel 1 Busse 1 Busoni 1 Busk 1 Bushong 1 Busca 1 Burwinkel 1 Burwell 1 Burt 1 Burstow 1 Burstein 1 BurroughsWellcome 1 Burre 1 burnt-out 1 Burnside 1 Burnham 1 Burmeister 1 Bur-lingame 1 Burlina 1 Burks 1 Burkhardt 1 Buring 1 burin 1 Burgmayer 1 Burgering 1 Burge 1 Burgdorf 1 Burgaleta 1 Burg 1 Burette 1 bureaucracy 1 bur-dens 1 burdened 1 Burdelya 1 Burd 1 Burchinal 1 Bupropion 1 buprenorphine 1 buoyant 1 Buonanno 1 Bunsaengjaroen 1 Bunel 1 Bundschuh 1 Bundoora 1 bundles 1 bundle 1 Bundgaard 1 bunch 1 Bumgarner 1 Bulysheva 1 Bulpitt 1 bullied 1 Bulletins 1 bulky 1 bulimia 1 bulband 1 Bul 1 built-in 1 buildup 1 Buijs 1 Buie 1 Bugnariu 1 bug 1 Buford 1 Bufo 1 Buffon 1 Buffington 1 Bufferd 1 Buettner 1 Buendia 1 Buenaver 1 Buechel 1 buds 1 budgets 1 budget-impact 1 budeso-nide 1 budding 1 Budczies 1 Budanov 1 bucks 1 buckling 1 Buckles 1 buckle 1 bucking 1 Buckett 1 Bucht 1 Buchser 1 Buchbinder 1 Buchbender 1 Buchan 1 Bucci 1 buccal 1 Buccafusca 1 BTZ-treated 1 BTZ-therapy 1 BTZ-rescue 1 BTZ-or 1 BTZ-binding 1 B-type 1 btaibapotiba 1 b-subunit 1 b-sheet 1 Bshara 1 bsecho 1 bsch 1 Brzezinski 1 Bryson 1 Brydon 1 Bryce 1 Bryar 1 Bryans 1 BRVO 1 Bruyne 1 Bruxellles 1 Bruunsgaard 1 Brussel 1 brush 1 Brunswick 1 Bruno 1 Brunner-Routledge 1 Brunn 1 Brunk 1 Brunetto 1 Brunet 1 Bruner 1 Brune 1 Brummelman 1 Brumagne 1 Brukner 1 Bruker 1 bruising 1 Bruins 1 Brugie 1 Brugge 1 Brugal 1 Brug 1 Bruera 1 Bruehl 1 Brueggemann 1 Brueckmann 1 Brudin 1 Bruchas 1 Brubaker 1 Broxterman 1 Browse 1 Brown-Vialetto-Van 1 Brownstein 1 Brownian 1 Brownell 1 Broux 1 Brouwers 1 Brouwer 1 Brousseau 1 Broussais 1 Broughtoun-Pipkin 1 Brott 1 brotic 1 Brothers 1 broth 1 Brophy 1 Brook 1 Bronstein 1 bronchoscopy 1 bronchopulmonary 1 bronchoconstriction 1 bronchoal-veolar 1 bronchoalveolar 1 bronchioloalveolar 1 Bromsman 1 Brompton 1 bromodeoxyuridine 1 bromide 1 Bromage 1 broken 1 broilers 1 Broide 1 Broggini 1 Brog 1 Broering 1 Broeren 1 Broek 1 Broe 1 Brodmann 1 Brodell 1 Brochier 1 broccoli 1 Broca 1 broblast 1 Broberg 1 broad-spectrum 1 broadinstitute 1 broaden 1 Broaddus 1 broad-brush 1 Broadbent 1 Brnabic 1 BRL 1 Brix 1 Britton 1 Brittis 1 Brittenham 1 Brittany 1 Britta 1 Brit 1 Bristow 1 Bristol-Myers 1 Brisslert 1 Briota 1 Briones 1 Brion 1 Brinton 1 Brinkmeyer 1 Brinkley 1 Brinkkoetter 1 Brink 1 Bringuier 1 Brindis 1 Brilot 1 Brilman 1 brilliant 1 Brilliance 1 Brighton 1 bright-field 1 brightest 1 brighter 1 Brighina 1 Briggs 1 Briganti 1 Brietbart 1 Brier 1 briefest 1 Bridgewater 1 Bridget 1 bridge-cyclization 1 Bricknell 1 Briceno 1 bric1936 1 bric 1 Briaud 1 Breydoet 1 Breydo 1 Brewery 1 Brewer 1 Breukelaar 1 Bretagnol 1 Bressman 1 Bresnick 1 Bresee 1 Bresciani 1 Brentegani 1 Brennen 1 Bremner 1 Bremme 1 Brembilla 1 Breken 1 Brekelmans 1 Brekel 1 Breizat 1 Breitk-reutz 1 Breitfelder 1 Breger 1 Brefel-Courbon 1 Breeze 1 Breeden 1 Bree 1 Breda 1 breathe 1 BreastScreen-based 1 breastfeed 1 breastfed 1 Breast-Cancer-Related 1 breast-cancer-information 1 breastcancercare 1 breakthroughs 1 break-through 1 break-points 1 break-point 1 breakout 1 Breake-field 1 breakdowns 1 bread 1 breaches 1 breached 1 Brea 1 BRCA-associated 1 BRC 1 Brazdova 1 Braz 1 Brawer 1 Braveman 1 Braus 1 Bratzke 1 Bratslavsky 1 Brant 1 Branje 1 brands 1 Brandner 1 Brandeis 1 Brandao 1 branched-chain 1 Bramon 1 Bramhall 1 Braly 1 brales 1 braking 1 brakes 1 braked 1 brain-wide 1 brainstorming 1 BrainResearch 1 brain-region-specific 1 brainneurons 1 brain-measuring 1 brain-aneurysm 1 Bragg 1 Braff 1 bradykinesia 1 Bradt 1 brackets 1 Bracken 1 brachii 1 braces 1 bracelets 1 Bracco 1 BPIwhich 1 BPH 1 BP-BESorDP-EES 1 BPA 1 BP230 1 Bozkurt 1 Bozi 1 Boyd-Kirkupet 1 Boyd-Kirkup 1 Boyden-chamber 1 Boychuk 1 Boyce 1 BoxO 1 Boxheimer 1 boxers 1 box-counting 1 bowels 1 Bowdle 1 Bowden 1 Bovy 1 Bovim 1 Bovbjerg 1 Bovaird 1 Bova 1 Bouwmeester 1 Bouwer 1 Bouvier-Colle 1 bouts 1 Boutellier 1 Bousset 1 Bourguiba 1 Bouregba 1 Bourdette 1 bouquet 1 bounding 1 boundina 1 boundIkBalpha 1 Boulvain 1 Boulos 1 Bouley 1 Boulevard 1 Boulet 1 Boulder 1 Boulay 1 Bouin 1 Bouhassira 1 Boudreau 1 Boudewijns 1 Bouckoms 1 Bouchet 1 Boucher 1 Bouaziz 1 Bottoni 1 bottom-income 1 Bottino 1 Botteron 1 Botsford 1 bothIkBalpha 1 bothersomeness 1 bothers 1 Bothell 1 Botero 1 Botelho 1 Bot 1 Bostrom 1 Bostatzopoulou 1 Bossola 1 Bosshardt 1 Bossaerts 1 Bosker 1 Bosio 1 Boscoe 1 Boscia 1 Boschetto 1 Boscarino 1 Bos 1 Bortsov 1 Borthwick 1 bortezomib-adapted 1 Bortel 1 Borss 1 Borsbo 1 borrows 1 Borresen-Dale 1 Borrell 1 Borras 1 Borowski 1 Borniquel 1 borninfants 1 Bornfeldt 1 Borncke 1 Borisov 1 Borisch 1 Boris 1 boric 1 Borgnakke 1 Borgloh 1 Borghuis 1 Borggrefe 1 Borgese 1 Borges 1 Borgeaud 1 Boreta 1 bored 1 bore 1 Borduin 1 Bordelon 1 Bordage 1 Borchelt 1 Boras 1 Bora 1 Bor 1 Booze 1 booths 1 Boonzaier 1 Boonsararuxsapong 1 Boomsma 1 Bookmarks 1 bookmark 1 book-length 1 bookending 1 Booken 1 Bonzini 1 Bonuccelli 1 Bonney 1 Bonnal 1 Bonke 1 Bonilla 1 Boni 1 Bonhomme 1 Bonham 1 Bonhage 1 Bongers 1 Boneschi 1 bone-marrow-derived 1 Bonelli 1 Bonekamp 1 Bondulich 1 Bonato 1 Bonati-Pellie 1 Bonardi 1 Bonaccorsi 1 Bonaccio 1 Bompiani 1 Bommer 1 Bombrys 1 bomber 1 bomb 1 Bolvig 1 boluses 1 Bolte 1 bolsters 1 bolster 1 Bolshakov 1 Bollore 1 Bollen 1 Bollati 1 Bolijn 1 Bolger 1 Boles 1 Bokarewa 1 Bojanowski 1 Bojani 1 Boivin 1 Boismier 1 Boise 1 Boirie 1 boiling 1 Bohmer 1 Bohlooly 1 Bohlen 1 Bogot 1 Bogner 1 Boggio 1 Boggild 1 Bogen 1 Bogat 1 Bogaerts 1 Boffelli 1 Boezen 1 Boeve 1 Boets 1 Boes 1 Boersma 1 Boerman 1 Boeh-ringer 1 bodyweight 1 body-like 1 bodybuilding-type 1 bodybuilding- 1 Bodyak 1 Bodmer 1 boding 1 bodiescases 1 Bockisch 1 Bochum 1 Boccetta 1 Boboshko 1 Bobisse 1 Bobes 1 BoBE 1 Boas 1 BNII 1 BNB 1 B-MYB 1 BMT 1 BMP-2 1 BMP 1 BMJPGL 1 BMIs 1 BMI1 1 BMG 1 BMCwith 1 BMCMed 1 BMBF 1 BMB 1 BMA 1 BM1302 1 Blyth 1 Bluthenthal 1 Blusztajn 1 blushing 1 blush 1 blurry 1 blurriness 1 blur 1 Blundell 1 Blumgartet 1 Blumenthal 1 Blumenkranz 1 Blumen 1 Blume 1 bluish 1 blueyellow 1 Bluemke 1 blue-light-induced 1 Bluebook 1 blown 1 Blower 1 blow 1 Blount 1 Blouin 1 blot-ting 1 Bloomberg 1 bloodstains 1 blood-pressure-related 1 blood-pool 1 blood-oxygen-level 1 blood-eye 1 blooderetina 1 bloodeaqueous 1 blood-derived 1 blood12 1 Blonska 1 Blomstrand 1 BlomgrenK 1 Blomberg 1 Blohmer 1 blog 1 Bloemfontein 1 Bloemena 1 Blodi 1 Blodgett 1 -blockers 1 blockers 1 Blocker 1 Bloch 1 Blissmer 1 Bliss 1 blindto 1 blindly 1 Blinder 1 Blimline 1 b-like 1 Blijham 1 Blignaut 1 Blesa 1 BlennowK 1 Blennow 1 blends 1 blended 1 Bleie 1 Bleich 1 bleed 1 Bleavins 1 Bleam 1 bleached 1 Bldg 1 Blazquez 1 Blazoski 1 Blazer 1 blasts 1 blastomeres 1 blastocyst-embryo 1 Blasi 1 Blasch 1 Blanpied 1 Blankson 1 blanks 1 Blankinship 1 blanket 1 Blankenship 1 Blankenhain 1 Blanes 1 Blanck 1 Blancho 1 Blanchet 1 Blanch 1 Blancato 1 blamed 1 Blakely 1 Blake 1 Blajchman 1 Blaizot 1 Blair 1 Blain 1 Blaich 1 Blaeser 1 Blader 1 Blackwood 1 Blackstone 1 Blackstock 1 Blackshaw 1 blacks 1 Blackinton 1 Blackhall 1 Blackett 1 Blacher 1 Bjorntorp 1 Bjork 1 Bjk 1 Bjerring 1 Bjellerup 1 Bjaalie 1 bja3121 1 Bizzi 1 Bizheva 1 Bixo 1 Bitu 1 Bittner 1 Bittles2 1 Bittles 1 bitter 1 bitstream 1 Bito 1 Bitner 1 bithorax 1 bisyllabic 1 bisulphite 1 bis-Tris 1 Bissonnette 1 bisphosphonate-associated 1 bisphos-phonate 1 bismuth 1 Bisi 1 bisected 1 bis-chloroethylnitrosourea 1 Bisceglio 1 Bisceglie 1 birthday 1 birt 1 Birnie 1 Birneyetal 1 Birney 1 Birnbaumer 1 Birmingham-based 1 Birkmeyer 1 Birkhauser 1 Birinder 1 birefringent 1 birefringence 1 Birditt 1 BIRCWH 1 Birchler 1 Birbeck 1 Biran 1 biphasic 1 bipedal 1 bipartite 1 bipa 1 BiP 1 Bioxytech 1 Biowissenschaften 1 bio-transformations 1 biotinylatedN-terminal 1 biotin-tagged 1 biotin-labeling 1 Biotin-conjugated 1 biotherapeutic 1 Biother 1 Biotext 1 biotechs 1 biotechnological 1 biosyn-thesis 1 Biostsat 1 Biosphere 1 Biospec 1 BioSource 1 BIOSIS 1 biosignature 1 Biosen 1 Bioscan 1 bioruptor 1 bioreceptor 1 Bioptigendevice 1 biopsychosocial 1 biopsied 1 Bio-Plex 1 Biophysik 1 Biophot 1 Biophosphonate-related 1 BION 1 Biomolecular 1 Biomolecolari 1 Biomol 1 bio-microscopic 1 biomicroscopic 1 Biometric 1 biometal 1 Biomedica 1 biomechanically 1 bio-marker 1 Bioluminescent 1 biologicalrelevance 1 bio-logical 1 biolimus 1 bio-informatics 1 Bioinforma 1 bioimpedance 1 Biography 1 biofilms 1 biofeedback 1 bioethicists 1 Bioessays35 1 bioengineered 1 bioelectromagnetic 1 Bioelectromagnet 1 biodiversity 1 Biodivers 1 Biodegradable-polymer 1 bioconjugation 1 bioconjugates 1 Biocon-jug 1 Biocommun 1 Biochimie 1 bioavailable 1 bioassay 1 Bioanalysis 1 Bioanal 1 Bioallied 1 bioactivity 1 Bio21 1 bio 1 Bin-swanger 1 binning 1 Bini2 1 Bingham 1 Bingel 1 Bindoff 1 Bindingof 1 binding-defective 1 -binding 1 bind-ing 1 binders 1 Binder 1 binaurally 1 binaural 1 binarized 1 Binah 1 Bina 1 bimolecular 1 bimodal 1 bimanual 1 Bim 1 bills 1 billed 1 Bill-Axelson 1 Bilker 1 bilingual 1 bile-like 1 Bilbe 1 bilateralmacular 1 bilabial 1 Bik 1 Bijttebier 1 Bijnen 1 Bijlenga 1 bIII-tubulin-labelled 1 bIII-tubulin 1 BII 1 Biggio 1 big-five 1 bifurcated 1 bifurcate 1 bi-functional 1 bifida 1 Biesanz 1 Bieryla 1 Bierma-Zeinstra 1 Biering-Sorensen 1 Bienvenu 1 Biedrzycki 1 Biedler 1 Biederman 1 Bie 1 Bido 1 Bidner 1 bidirectionally 1 Biddinger 1 bicycling 1 bi-consonant 1 Bicknell 1 Bickerstaff 1 Bichi 1 Biboulet 1 bibliographies 1 BIBLIOGRAFIA 1 Biasucci 1 biasedyfor 1 Bi-212 1 bi- 1 Bhupinder 1 Bhringer 1 BHQ 1 Bhogal 1 Bhmt- 1 Bhidayasiri 1 Bhawan 1 Bharioke 1 Bharaj 1 Bhangoo 1 Bhakta 1 Bhagwagar 1 Bhagat 1 Bhabra 1 BFU2009-09074 1 BFNE-II 1 BFNE 1 BFI-2011 1 bFaculty 1 b-factor 1 Bezrukov 1 Bezlyak 1 Bezjak 1 Beyth 1 Beyreuther 1 Beyene 1 Beye 1 Bevers 1 beveled 1 bevacizuamb 1 Beuste 1 Beumont 1 between-treatment 1 between-subgroup 1 between-sex 1 between-session 1 betweenParkinson 1 betweenIkBalpha 1 betweenANGPTL4 1 between2008and 1 between18 1 bet-ween 1 between- 1 Betts 1 Bettini 1 better-stage 1 Bettencourt-Schueller 1 Bettencourt 1 betsurf 1 Betran 1 Betr 1 Bethell 1 betel 1 Betchen 1 beta-tocopherol 1 beta-subunit 1 beta-structure 1 beta-sheet 1 beta-protein 1 beta-particles 1 Beta-particle-emitting 1 beta-napthoflavone 1 betamelanocyte 1 beta-glucoronidase 1 beta-emitters 1 beta-cleaved 1 beta-chemokines 1 beta-blockers 1 betablocker 1 beta-blockade 1 Beta-amyloid-induced 1 beta-amyloid-dependent 1 beta-adrenergic 1 beta-5 1 beta-2 1 beta1 1 BET2 1 Bestvitelliform 1 best-recognised 1 best-practice 1 Bestmacular 1 best-annotated 1 Besta 1 BEST1gene 1 Bessia 1 Bessesen 1 Besserglick 1 Bessell 1 Besse 1 Besoli 1 Berzins 1 Bertrand 1 Bertran 1 Bertram 1 Bertoldo 1 Bertina 1 Berthold 1 Bertheau 1 Bertelson 1 Bertario 1 Bert 1 BersonEL 1 Berrino 1 Berrini 1 Berntsen 1 Bernreuter 1 Bernier-Buzzanga 1 Bernier 1 Bern-hardi 1 Bernhardi 1 Bernhard 1 Bernard-Valnet 1 Bernards 1 Bernardo 1 Bernardini 1 Bernardin 1 Bernal-Mizrachi 1 Bernacki 1 Bernabei 1 Berlo 1 Berlin-Buch 1 Berlex 1 Berl 1 Berkovic 1 Berkhout 1 Berkers 1 Berk 1 Berindan-Neagoe 1 Bergstresser 1 Bergstrand 1 Bergsman 1 Bergsagel 1 Bergin 1 Bergholm 1 Berghella 1 Berghe 1 Berghd 1 Berggren 1 Berge 1 Bereznai 1 Beresford 1 Berens 1 Berenholtz 1 Berendschot 1 Bereaved 1 Berdugo 1 Berckel 1 Berberat 1 Berardelli 1 benzoyl 1 benzodi-azepines 1 benzidine 1 Benzamides 1 benzamide-based 1 benzalkoniumchloride 1 Ben-Yehuda 1 Benwell 1 Benvenuti 1 Bentley 1 Benthem 1 Bental 1 B-ENT 1 Benson 1 Benshoff 1 Ben-Shachar 1 Ben-Shabat 1 Benos 1 benoemen 1 Benninger 1 Benninck 1 Bennetet 1 Benjamins 1 Ben-Isaac 1 Benhard 1 Benham 1 Benger 1 Beneken 1 Beneka 1 Beneifits 1 benefitted 1 beneficiary 1 beneficially 1 Benedek 1 ben-e 1 Bendtzen 1 Bendoret 1 Benders 1 Benderet 1 Bendell 1 Bend 1 Benchmarks 1 Benavides 1 Benavente-Perez 1 Benary 1 Benarroch 1 bemuscle 1 bemade 1 belying 1 Beltrame 1 belt 1 below-average 1 Beloozerova 1 Belmonte 1 belly 1 Bellucci 1 Bellora 1 Bello 1 Belliotti 1 Bellinzona 1 Bellinger 1 Bellgowan 1 Belleroche 1 Beller 1 Bellemans 1 Bellavita 1 Bellamy 1 Belizaire 1 Belivanis 1 Belitz 1 believing 1 believer 1 Belgium8Deutsches 1 Belgium3Working 1 Belgium2Chair 1 Belgin 1 Belg 1 Belforte 1 belferi 1 Beley 1 Belenguer 1 BelelliD 1 Belanger 1 Belander 1 Belair 1 Bekawi 1 Bejarano 1 Beitrage 1 Beitr 1 beirregular 1 Beinborn 1 Beilina 1 Beil 1 Beijersbergen 1 beidi 1 bei 1 Behring 1 behoove 1 Behnke 1 Behndig 1 Behe 1 Behbehani 1 BehaviourResearch 1 Behaviorala 1 behaving 1 Behari 1 Behandlungszentrum 1 Beham-Schmid 1 Beham 1 beginnings 1 Beghyn 1 beggar 1 Befort 1 beforesymptomatic 1 beforehand 1 beet 1 beer 1 beenreported 1 beenfound 1 beenconfirmed 1 Beem 1 Beelen 1 bee-keepers 1 bedown 1 bedone 1 Bedogni 1 Bediako 1 Bedi 1 Bedell 1 Bedard 1 Beckwith 1 Beck-Sickinger 1 Beckerman 1 Bechtel 1 Becerra 1 Bebchuk 1 Beaverton 1 Beausejour 1 Beaupre 1 Beaumont 1 Beaulieu 1 Beatus 1 Beattie 1 Beatrijs 1 Beatrice 1 beat 1 Bearss 1 Bearman 1 Beardon 1 Bearden 1 Beard 1 beanshaped 1 Beamer 1 Bealet 1 beaker 1 bead-based 1 bDNA 1 BD9 1 BD61 1 BCsin 1 BCR-regulated 1 BCR 1 Bcl-XL 1 Bcl-2 1 Bckstrom 1 B-cells 1 Bcells 1 B-cell-activating 1 BCDecker 1 BCCs 1 BCBC 1 b-catenin-mediated 1 b-Carotene 1 BCA1-1KT 1 BBS 1 bb9-chap4 1 bb9 1 Bazzana 1 Bazmi 1 Bazarian 1 Baysal 1 Bayman 1 Baylor 1 Bayliss 1 Bayesian-based 1 Bayesian6 1 bay 1 Baxter-Jones 1 Bax 1 B-Aware 1 Baust 1 Bauminger 1 Bauknecht 1 Baudrillard 1 Bauby 1 Batzler 1 battle 1 Battistutta 1 Battino 1 Batteux 1 Battaglia 1 Batlle 1 Batjer 1 Batchelder 1 Basun 1 Bastek 1 Bassett 1 Basser 1 Bassel-Duby 1 Basque 1 basophils 1 Basophilic 1 basolaterally-secreted 1 basolaterally 1 Baskurt 1 Baskett 1 basket 1 basic-leucine 1 Basford 1 base-line 1 Baselga 1 base-case 1 Bascom 1 Basco 1 Basci 1 Basch 1 basalt 1 basally-directed 1 basalis 1 basal- 1 Bartz 1 Bartram 1 Barton-Davis 1 Bartolucci 1 Bartolomeo 1 Bartley 1 Bartholomew 1 Barthelet 1 Bartel 1 Barsotti 1 Barsky 1 Bar-Sagi 1 Barrows 1 Barrington 1 Barringer 1 bar-rier 1 Barrie 1 Barri 1 Barres 1 Barrell 1 barrel 1 Barreira 1 Barre 1 Barral 1 Barr 1 Bar-Oz 1 Bar-Or 1 Barone 1 Barofsky 1 Barnwell 1 Bar-Nun 1 Barnum 1 Barnoya 1 Barnoy 1 Barnhart 1 Bar-Nathan 1 Barnard 1 Barlow 1 Barleben 1 barkil 1 Barkhof 1 Barkat 1 Barja 1 barium 1 baring 1 Barille 1 Bargmann 1 Baretton 1 Bareither 1 Baredes 1 Bardoni 1 Bardin 1 Bardien 1 Bardach 1 Barclay1 1 Barbosa 1 Barbieri 1 barbell 1 Barbeau 1 Barbay 1 Barbato 1 Barbaro 1 Barbagli 1 Baran 1 Baral 1 Baraka 1 Baracos 1 Baquie 1 Baptista 1 bApplied 1 bapi 1 BAO-HNS 1 Bao 1 Bantly 1 Bantick 1 Banta-Green 1 Banta 1 Bansal 1 BanoD 1 banned 1 Banna 1 Bann 1 Bankson 1 Bankiewicz 1 Bankier 1 Banisadr 1 Banion 1 Bani 1 Bangsbo 1 Bangladesh 1 Bangert 1 Bangash 1 Bangalore 1 Bang 1 Banffy 1 band-widths 1 band-like 1 Bandi 1 Bandell-Hoekstra 1 Bandeen-Roche 1 Banati 1 Banaszkiewicz 1 bananas 1 banana 1 Bam 1 Baltic 1 Baltes 1 Balter 1 Baltensperger 1 Baltazar 1 Balsom 1 Balsano 1 Bal-Price 1 Baloch 1 Balm 1 Ballini 1 Ballinger 1 ballet 1 Ballester 1 Ballesta 1 Balla 1 Baliki 1 Balija 1 Balev 1 baldness 1 Balch 1 Balboni 1 BalbiM 1 Balbi 1 Balb 1 Balasubramanian 1 Balas 1 balances 1 balance7 1 Balan 1 Baladandayuthapani 1 Balaclava 1 Bakkers 1 Bakir 1 Bakhshi 1 Bakay 1 BAK 1 Bajraszewski 1 Bajorat 1 Baize 1 baits 1 Baine 1 Bainbridge 1 Bain 1 Bailliet 1 Baillieres 1 Baillargeon 1 Baider 1 Baicker 1 Bai 1 Bahlis 1 Bagutti 1 Bagnoli 1 Bagiella 1 Baghurst 1 Bagheri 1 BAFF 1 Baez 1 Baeyens 1 Baetselier 1 Baert-Desurmont 1 Baer-iswyl 1 Baele 1 Baehr 1 Baecker 1 Badrick 1 Badoux 1 badly 1 Badley 1 Badger 1 Baden 1 Badea 1 Baddini 1 Badcock 1 Badawi 1 Badarudeen 1 baculo-viral 1 Bactivity 1 Bactivation 1 bacteriology 1 Bacquer 1 Bacon 1 Backwards 1 backward-masking 1 backup 1 back-to-back 1 backstitched 1 Backscatters 1 backs 1 backprojections 1 back-leakage 1 backing 1 Backer 1 backend 1 backcrossed 1 backcourt 1 backboard 1 backache 1 bacillary 1 Bachman 1 Bachi 1 Bachevalier 1 Bachelor 1 Bache 1 Bachasson 1 BACH2 1 Baccus 1 Baccarini 1 BacaW 1 Babraham 1 Babot 1 Babcock 1 Babb 1 Baase 1 Baar 1 Baan 1 BA9500 1 BA2000 1 B-9000 1 b7 1 B59 1 b542 1 B54 1 B52 1 B5002 1 B50 1 b5 1 B-48 1 b4170 1 b4 1 b3513 1 B-3000 1 B3 1 B2M 1 B265 1 B23f 1 b2 1 B-18 1 B17 1 B120 1 B100 1 Azzarelli 1 azoxymethane-induced 1 Azorsa 1 Aznar 1 Azinhaga 1 Azienda 1 azi 1 Azhar 1 Azevedo 1 AzenSP 1 AZD6244 1 Azargashb 1 Ayuso 1 AYM 1 Ayling 1 aYefim 1 Ayanian 1 Ayalon 1 Ayalasomayajula 1 AY9944-treated 1 Axworthy 1 axosomatic 1 axon-initiated 1 Axmann 1 axisso-called 1 Axioskop 1 Axioplan 1 Axelson 1 AxCs 1 AX 1 awt315 1 awry 1 awards 1 Awan 1 awakened 1 awaits 1 await 1 Awad 1 avulsion 1 AVTEC 1 Avruch 1 AVR 1 avP3 1 AVP 1 AvornJ 1 Avolio 1 Avner 1 Avissar-Whiting 1 avin 1 Avila 1 avidly 1 avidity 1 avidin-biotin 1 aviation 1 avians 1 Aveyard 1 avert 1 Aversive 1 aversion 1 averagedthe 1 Aventis 1 Aveline 1 Avedis 1 avascularity 1 Avant 1 Avance 1 Avancats 1 avail-able 1 avail-ability 1 AVAglio 1 Avadhani 1 aux 1 Auvynet 1 autumn 1 Autran 1 autosomal-recessive 1 auto-regulation 1 autoregulation 1 auto-regulate 1 autoreactive 1 Autoquant 1 autopsy-confirmed 1 autopsies 1 auto-populated 1 autophosphorylation 1 autophagypathway 1 au-tophagy 1 Automatomated 1 automati-cally 1 auto-mated 1 autolysis 1 auto-injector 1 autoinjector 1 Autoinhibitory 1 Autoimmun 1 auto-fluorescence 1 Autodesk 1 Autocrine 1 autocorrelate 1 autoclaved 1 Auto-chemical 1 autoantigens 1 autoantibody-associated 1 auto-antibodies 1 autoactivates 1 auto- 1 autistic-like 1 authorsof 1 authors2 1 authorizes 1 authorizations 1 Authoritative 1 authored 1 author21 1 Authentically 1 Autere 1 Australia45 1 Australas 1 Aus 1 Aury-Landas 1 auricle 1 aurally 1 aural 1 Aulmann 1 Aulicino 1 Aukiwski 1 Augustsson 1 Augustinus 1 Augustine 1 Auges 1 Auger-emitters 1 Auger-electron-emitting 1 Augenstein 1 auge 1 Aufderheide 1 Auer 1 Auenbruggerplatz 1 Audo 1 auditory-motor 1 auditoryERPs 1 auditory-cortex 1 audition 1 audited 1 audiovisual 1 audiorecorded 1 audiometry 1 audiological 1 Audiologia 1 audiences 1 aub 1 AU2008 1 AU200012533B2 1 Atzeni 1 Attribution-NonCommercial-Share 1 attributing 1 attracts 1 attractor 1 attractions 1 attract 1 attitude3 1 ATTICA 1 attic 1 Attia 1 atthe 1 attenuation-correction 1 attenu-ation 1 attenders 1 attendants 1 attendances 1 Atten 1 Attebo 1 Attali 1 attachments 1 Attaching 1 attach 1 Atsushi 1 Atsou 1 atropine 1 atrocities 1 atrialfibrillation 1 Atrash 1 aTransgenic 1 atracurium 1 ATPlevels 1 ATP5B 1 ATP2A1 1 atotal 1 atopical 1 ATOPFLASH 1 atop 1 atonia 1 atmospheric 1 atmosphere 1 atlas-based 1 Atlante 1 Atkins-like 1 atinitial 1 athymic 1 Athlone 1 athletics 1 Athiraman 1 aTH-GAL4 1 athersclerosis 1 atherothrombosis 1 athero-sclerotic 1 atherosclerosis-prone 1 Atherosclerosis2032 1 athero-sclerosis 1 Atheroscle-rosis 1 atheroma 1 a-therapy 1 Athene 1 Athanas-siadou 1 Atg9a 1 atg9 1 aTf 1 Atema 1 atelectasis 1 Atef 1 ate 1 atdiagnosis 1 Atchabahian 1 ataxic 1 Atassi 1 Atar 1 Atamna 1 Atallah 1 Atalar 1 Atadzhanov 1 at5 1 at4weeksofage 1 at1 1 Asystematic 1 a-synuclein-dependent 1 asynchrony 1 asymptotically 1 asymptote 1 aswell 1 asusedinpreviousstudies 1 astute 1 astudy 1 astrogliosis 1 astroglia 1 astrocytomas 1 astrocytoma 1 Astrocyte-derived 1 Astorino 1 Astin 1 Asthenia 1 aStephane 1 astato-4-guanidino-methylbenzoate 1 Astatine-211-labeled 1 associating 1 associatedwith 1 Associated-protein 1 -associated 1 associ-ated 1 assists 1 assisting 1 Assistencial 1 assimilation 1 assimilating 1 assignable 1 Assia 1 Asshownin 1 asset 1 Assessment19 1 assess-ment 1 assessedby 1 assertion 1 assert 1 Assersohn 1 Asselt 1 Asseler 1 Asseldonk 1 assassination 1 Assaf 1 Assael 1 ass 1 aspT4a 1 Aspland 1 aspirin 1 aspires 1 aspirates 1 Aspetar 1 Asperger 1 asparagine 1 Asp281Gly 1 Asp175 1 Ason-line 1 as-of-yet 1 as-needed 1 aSnca 1 Asmus 1 Asmann 1 aslifespanextending 1 Asis 1 ASIPP 1 Asioli 1 as-in 1 Asimilar 1 Ashworth 1 Ashton-Miller 1 Ashtiani 1 Ashraf 1 ashorter 1 Ashok 1 Ashmore 1 Ashley 1 Ashe 1 Asghar 1 ASGC-RA 1 Asgari 1 ASG 1 aset 1 ASES 1 asepsis 1 A-sepharose 1 Asensio-Juan 1 asendogenousneuro 1 -ase 1 ASDs 1 ASD9 1 ascribe 1 ascollagen 1 ASCL4 1 Ascl2 1 Ascione 1 Asci 1 Aschwanden 1 Aschoff 1 Aschenbach 1 Asch 1 ascertainment 1 Ascenzib 1 ascent 1 ascending 1 ascaroside 1 ASB 1 Asawavichianginda 1 Asan 1 Asahara 1 Asaf 1 asaccp 1 AS703026 1 aryl 1 Arvind 1 Arvid 1 Aruna 1 Arulkumaran 1 artists 1 artifact-free 1 articulated 1 articles4 1 article16 1 artial 1 arti 1 Arthurs 1 Arthur 1 arthrotomy 1 Arthrosc 1 arthroplasties 1 arthropathies 1 arthralgias 1 arthralgia 1 arthoplasty 1 arteriosus 1 Arterio-sclerosis 1 Arteriosclerosis 1 arteriopathy 1 arterioles 1 arteriole 1 Artemis 1 Artech 1 Arte 1 Artal 1 ArslanoluS 1 Arslanian 1 Arruda 1 Arrowheads 1 arrowand 1 arrives 1 arrived 1 Arrington 1 Arriaga 1 arrhythmias 1 ArrayExpress 1 -array 1 arranging 1 arrangements 1 Arq 1 around-the-clock 1 Arora29 1 Aroor 1 Aronen 1 aromatization 1 aromatase 1 Arola-Arnal 1 Aro 1 Arnup 1 Arnulf 1 Arnsten 1 Arnstadt-Ilmenau 1 Arnoux 1 Arnone 1 Arnheim 1 Ar-nett 1 Arnaud 1 Arnau 1 Arnaboldi 1 Army 1 Armin 1 ArmerJM 1 Armer 1 armd 1 armchair 1 Armanini 1 Armand 1 Arlt 1 Arlinghaus 1 Arking 1 Ark 1 Ariza 1 aristogenesis 1 Arinami 1 Arimilli 1 Arick 1 Arias-Carrion 1 Ariana 1 Ariadna 1 Aria 1 Argyro 1 ArgyleTM 1 Argov 1 Argonaute2 1 argminKi 1 arginine-glycine-aspartic 1 arginine 1 Arg-Gly-Asp-linked 1 Arg-Gly-Asp 1 Arg30Lys 1 Arg136Cys 1 Arg1205His 1 Arg 1 Arey 1 Arewe 1 Aretaieio 1 Areskog 1 Ares 1 arepredictors 1 Areportofa 1 arents 1 Arends 1 Arend 1 arenas 1 Arenaissance 1 are-in-the-world 1 areindividually 1 areimperative 1 areference 1 AREDS-related 1 AREDS2 1 Aredia 1 arecorrelated 1 Areces1 1 areattributable 1 areassociated 1 areaneurons 1 Arean 1 areadopamine 1 Ardle 1 Ardissino 1 Ardicoglu 1 Ardayfio 1 Arcy 1 arctangent 1 arcs 1 Arciniegas 1 Arcieri 1 archuk 1 ArchPathol 1 architects 1 archetypal 1 Arcement 1 Arbous 1 arbour 1 arbors 1 arboreal 1 arbitrarily 1 Arbel-Ornath 1 Arbab-Zadeh 1 Arazi 1 Arawaka 1 Arasu 1 Aras 1 Arango 1 Aranda 1 Arancio 1 Aragues 1 Arachidonate 1 Arabia20Center 1 Ara 1 AR3 1 AR-2000 1 AR1 1 AR057001 1 AR053505 1 Aquatic 1 Aquarius 1 aquaporin 1 aquanatal 1 AQR 1 Aqeilan 1 AQ4 1 Apunt 1 aPTT 1 Apter 1 Apte 1 apsychiatrist 1 aps12-pcp 1 aprotinin 1 aproteinin 1 Apropos 1 apreviously 1 apre-existing 1 apraxia 1 apps 1 approximates 1 approximately7 1 approximately4 1 approve 1 approachable 1 Apprent 1 appreciative 1 appreciation 1 appreciably 1 appraised 1 appositive 1 appositions 1 apposed 1 apportionment 1 apportioning 1 application-specific 1 applicationsinheart 1 applicationem 1 apples 1 Appleby 1 applanation 1 Apperley 1 Appenzeller 1 Appendix1 1 Appelman 1 app-drug-summary 1 apparitions 1 APP1024226 1 APP1024201 1 APP1020981 1 APP1010723 1 APP1003903 1 aporetic 1 apoptosis-corrected 1 apoprotein 1 apoplexy 1 apo-lipoproteins 1 apolipoproteine 1 apoli-poprotein 1 apoint 1 Apogenix 1 APOE-smoking 1 APOE-related 1 apoE-null 1 apoE-immunoreactive 1 APOEgenetic 1 apoEecontaining 1 apoE-associated 1 APOEand 1 ApoE4 1 ApoB100 1 ApoA-I 1 APOA5 1 APOA2 1 APOA1BP 1 APO-1 1 apo 1 apnoea-hypopnoea 1 apnoea 1 apmr 1 Aplio 1 Aplicada 1 apicitis 1 Apicella 1 aphasic 1 apharmacological 1 Apgar 1 apes 1 apertures 1 Aperfeioamento 1 Apcmin 1 apatient 1 a-particle 1 AP-1 1 Aout 1 Aouad 1 aos 1 aortae 1 AOP 1 AON 1 aol 1 AO 1 Anzio 1 Anzai 1 any-where 1 anytime 1 ANY-Maze 1 anxiousyand 1 anxiousin 1 anxiety-inspiring 1 anxietydisorder 1 anxietyand 1 anxieties 1 Anwar 1 anujarve84 1 Anuclearexport 1 Anttila 1 ANT-specific 1 Antsaklis 1 Antoun 1 Antony 1 Antonipillai 1 Antonini 1 Antonia 1 Antoni 1 antonellabassia 1 Antoneli 1 Antonarakis 1 Antoine 1 Antman 1 antivascular 1 anti-ubiquitin 1 anti-tyrosine 1 anti-tumour 1 anti-tumorigenic 1 anti-tumor 1 anti-TNF- 1 anti-thymocyte 1 anti-Thy 1 antitargets 1 anti-SUMO2 1 anti-SUMO1 1 antiseptic 1 anti-sense 1 antire-troviral 1 an-tipyrine 1 Antipy-rine 1 anti-psychotic 1 antipsychotic 1 anti-phospho-S32-36-IkBalpha 1 Antion 1 antinuclear 1 Anti-NMDA-receptor 1 antineuronal 1 anti-neuroinflammatory 1 antineuroinflammatory 1 anti-MOG 1 anti-miR-six 1 anti-miR-scramble 1 anti-miR 1 antimatter 1 anti-matrix 1 anti-lymphoma 1 antiluminal 1 anti-leukaemia 1 antiionized 1 antiinter-leukin 1 anti-IL-1beta 1 anti-HIV 1 anti-histone 1 antihista-mine 1 antihelixthat 1 antiglyceraldehyde-3-phosphate 1 antiglyceraldehyde 1 anti-glial 1 antiglial 1 anti-glaucoma 1 anti-GFAP 1 antigen-TCR 1 antigen-specific 1 antigen-expressing 1 antigen-experienced 1 antigen-binding 1 antigen-activated 1 antigen-1 1 antiGDNF 1 anti-gamma 1 anti-fibrinogen 1 antifade 1 AntieVascular 1 antie-smooth 1 anti-epiligrin 1 Anti-epileptics 1 anti-epileptic 1 antiepidermal 1 Anti-Doping 1 antidepressive 1 antide-pressants 1 anticorrelated 1 anticonvulsive 1 Anticonvulsants 1 anti-convulsant 1 anticoagulants 1 anti-CNC1 1 anticipatory 1 anticholinergic 1 anti-CD45 1 anti-CD31 1 anti-CD-20 1 anti-CD133 1 anti-cancer 1 anticalponin 1 anti-BrdU 1 anti-bone 1 antibody-coated 1 Antibody-aided 1 anti-biotics 1 anti-beta-actin 1 antibacterial 1 anti-apoptotic 1 antiapoptotic 1 anti-anxiety 1 antianxiety 1 anti-ANT 1 antiandrogens 1 antiandrogen 1 anti-amyloid-Beta 1 antiaging 1 anti- 1 anthracycline-taxane 1 anthor 1 Anthea 1 anteroposterior 1 anterogradely 1 antedates 1 antecedent 1 Antcliff 1 antagonizedby 1 antagonized 1 antagonistic 1 antagonism 1 antagonises 1 A-NT 1 Anstey 1 Ansorge 1 Ansley1 1 Ansley 1 Ansermino 1 Ansell 1 Anseel 1 Anschutz 1 ANR-12-BSV4-001-01-TargetPD 1 ANR 1 anorexic 1 anonymously 1 anoma 1 anoikis 1 Anoeshka 1 anode 1 Annunzio 1 Annunziato 1 Anns 1 Announcements 1 announcement 1 annotations 1 annotated 1 annotate 1 Anno 1 AnnInternMed 1 annihilation 1 Annihilating 1 annihilates 1 Annibale 1 Annett 1 Annerino 1 Annelot 1 Annear 1 Annabelle 1 ANKRD11 1 ankles 1 Ankle-dorsiflexion 1 Ankers 1 Ankele 1 Ankel 1 Anjou 1 ani-sotropy 1 anion 1 anIOL 1 anInphenix 1 Animas 1 animals33 1 animalmodel 1 Animale 1 AnimalCare 1 Anichtchik 1 anhydrous 1 anhour 1 Anheim 1 anhaptoglobinemia 1 Angquist 1 Angot 1 angle-independence 1 angled 1 angiotensinII 1 angiotensinaldosterone 1 angio-regressive 1 angiopoietin-1 1 angiomata 1 Angiographyand 1 angiographically 1 angiograph2 1 angiogenicprivilege 1 angio-genesis 1 Angels 1 Angelos 1 Angelman 1 Angelis 1 Angelini 1 angel 1 Angastiniotis 1 Anew 1 aneurysmas 1 anesthetist 1 anesthesia-induced 1 anesthesia-awareness-registry 1 anerroneous 1 anergy 1 anelectrophysiological 1 anelectron 1 Anekonda 1 Anegon 1 andWang 1 andtrauma 1 andtools 1 andTherapy 1 andstroke 1 andspecifically 1 andSlack 1 andSharpless 1 andScorrano 1 andRTEL1 1 andrs7412 1 Androl 1 androgens 1 androgen-deprivation 1 Andriy 1 Andriole 1 Andrieux 1 Andrieu-Soler 1 Andriamampandry 1 Andrezieux-Boutheon 1 Andreyeva 1 Andren 1 Anderton 1 Andersson-Lundman 1 Andermann 1 and4 1 Ancuta 1 ancient 1 anchored 1 anchorage-independent 1 ANCHOR 1 ancestral 1 Ancel 1 Anbinder 1 Anas-tasopoulos 1 Anastacio 1 Anar 1 ana-plerotic 1 Anandatheerthavarada 1 analyzedirect 1 Analytics 1 Analytically 1 analysts 1 analysisin 1 analysis44 1 Analy-sis 1 analphaof 1 analogue-to-digital 1 Analogously 1 analogize 1 analogies 1 analgetics 1 Anaggressive 1 anaesthetic-surgical 1 anaesthesiologists 1 Anaerobe 1 Amyvid 1 amyloidosis 1 amyloid-binding 1 Amyloid-beta-induced 1 -amyloid 1 amy-loid 1 amylin 1 amygdalo-hip-pocampal 1 AMW 1 Amultimodal 1 Amultidisciplinary 1 Amu 1 Amtmann 1 AMT 1 -a-MSH4-11-NH2 1 Amresco 1 amputations 1 Ampuero 1 Amplisilence 1 amplifying 1 amplifications 1 Amplicor 1 AMPK-mTOR-Ulk1 1 Ampio 1 amphiphilic 1 amphibians 1 Amphia 1 amphetamine-induced 1 AmpFiSTRs 1 Amouyel 1 amouse 1 Amott 1 Amorim 1 amore 1 Amon 1 amodel 1 Amoako 1 AMO 1 amnion 1 amniocentesis 1 amnestic 1 Ammonis 1 Ammon 1 am-mation 1 amm 1 AmJ 1 Amissah-Arthur 1 aminolevulinic 1 Amino-bisphosphonates 1 aminobisphosphonates 1 aminobisphosphonate 1 amines 1 amine 1 AMIE 1 amides 1 Amicon 1 Amichetti 1 amiable 1 Amgen 1 americanpainsociety 1 americannewsreport 1 AmericanJournal 1 American-born 1 American-academy-of-hospice-palliative-medicine 1 America21 1 Amer- 1 amending 1 amelogenin 1 Amelio 1 a-melanotropic 1 a-melanocyte-stimulating 1 AMD-related 1 AMD-like 1 amchen 1 amc 1 Ambulance 1 Ambul 1 Ambs 1 Ambrosi 1 Ambros 1 Amboni 1 ambivalence 1 ambitious 1 ambition 1 Amber 1 amazed 1 Amatched 1 amass 1 amases 1 Amaro 1 Amaria 1 AMA-PCPI 1 Aman-tadine 1 Amans 1 Amanda 1 Aman 1 Amami 1 Amalia 1 Amacrine-to-amacrine 1 AmAcad 1 Amabile 1 ama1 1 Alzhiemer 1 Alzheimer-related 1 Alzheimer-degenerated 1 Alvestad 1 Alvaro 1 Alvarez-Saavedra 1 Alvares 1 Alvarado 1 Alv 1 aluminum 1 Altunel 1 Altukroni 1 Altshuler 1 altro 1 Altmann 1 Al-though 1 Althoff 1 Althaia 1 alternates 1 alternated 1 Altern 1 alteredcontractile 1 alterations11 1 Altendorf 1 Altekruse 1 Altaweel 1 Altamirano 1 Altaie 1 alta 1 ALSPAC 1 alsosuggested1 1 alsopresent 1 alsoIkBalpha 1 Alsheik 1 alsession 1 Alseidi 1 Alsanafi 1 Alroy 1 Alred 1 Al-Rashedy 1 Alquen 1 Alpini 1 alpha-tubulin 1 alpha-tocopherol 1 alpha-synuclein-harboring 1 alpha-synucleingene 1 alpha-synuclein-deleted 1 alpha-synucleindecreases 1 alpha-synucleincan 1 alpha-synuclein-based 1 Alpha-SynucleinA53T-A30P 1 alpha-sy-nuclein 1 alphasynuclein 1 alpha-reduction 1 alpha-reductase 1 Alpha-Radiation 1 alpha-particle-emitting 1 alphanumeric 1 AlphaMed 1 alpha-like 1 alphalevel 1 Alpha-fe-toprotein 1 alpha-emitters 1 alpha-emitter 1 alpha-deficient 1 alpha-actinin 1 alpha-4-beta-1 1 alpha1D 1 alpha-1 1 -alpha 1 alpha- 1 Alpes 1 Alpert 1 Alperovitch 1 Alpern 1 Alparslan 1 Alonso-Coello 1 alonepromote 1 Alois 1 al-Obeidi 1 Al-Obeeidi 1 Al-Nawas 1 Al-Mondhiry 1 Almomani 1 ALMM 1 Almenet 1 Almelo 1 Al-Mahmood 1 Allyn 1 allude 1 All-transretinoic 1 all-transretinal 1 Allsop 1 Allred 1 all-payer 1 AllP 1 alloxan-treated 1 alloxan-and 1 allowable 1 allotted 1 all-or-nothing 1 all-or-none 1 alloreactive 1 alloP-type 1 allophyco-cyanin 1 alloimmunization 1 Allocating 1 allocate 1 alloaggressive 1 Allman 1 all-important 1 Allikmets 1 allies 1 alleviation 1 allergies 1 Allerg 1 AllenM 1 Allegro 1 Allday 1 Allcock 1 allcause 1 Allbert 1 Allavena 1 Allard 1 all4subjects 1 alkyne 1 alkylating 1 ALK-positive 1 alkene 1 Alkan 1 alkalosis 1 alkaline 1 alkali 1 ALK 1 Alitalo 1 Alison 1 Alireza 1 aliquid 1 A-line 1 Alimirah 1 Ali-mera 1 alignments 1 alienated 1 Alici 1 Alice 1 Alic 1 Aliberti 1 ALH 1 algyrus 1 algorithm-based 1 algorithm5 1 algorithm1 1 algometry 1 algometer 1 Algeciras-Schimnich 1 algebra 1 ALG13 1 alg-1 1 Alfthan 1 Alfred-Krupp-Krankenhaus 1 alfound 1 Alfonso 1 AlFaisal 1 alexithymia 1 Alexia 1 Alexandrowicz 1 AlexaFluor680 1 Alexa-633 1 Al-exa-488 1 Alexa-488 1 alevy 1 alethal 1 Alessi 1 Alessandrini 1 Alessandri 1 Alessandra 1 Alesco 1 Alesci 1 alerts 1 alerted 1 alendronate-related 1 alendronate9 1 Alendro-nate 1 Alekseenko 1 Al-Ejeh 1 Alejandro 1 Aldington 1 ALDH1L1 1 Alderson 1 aldehydes 1 Aldave 1 Alda 1 alcoholic 1 Alco 1 Alcalde 1 Alcalay 1 Alcal 1 Albuquerque 1 albumin-to-creatinine 1 Albrecht 1 Albouy 1 Albor 1 Albitar 1 AlbinR 1 albescens 1 Alberts 1 Alberti 1 Alberino 1 Alberi 1 Alberg 1 Albano 1 Alavian 1 Alauddin 1 Alastair 1 Alaska 1 Al-Asari 1 ALAS1 1 alarmingly 1 alarming 1 Alarcon 1 alar 1 Alameda 1 Al-Allawi 1 Alagbe 1 AlafuzoffI 1 Aladjem 1 Alabama 1 Ala53Thralpha-synuclein 1 Ala-53 1 Ala30Pro 1 Ala12 1 al9 1 al8 1 al5 1 al47 1 al46 1 al45 1 al42 1 al41 1 al37 1 al33 1 al31 1 al25 1 al23 1 al21 1 al17 1 al15 1 al14 1 al13 1 al11 1 al10 1 Al- 1 Akyol 1 AKR1D1 1 Akkin 1 AkkG 1 AKK 1 Akira 1 akinetic 1 A-kinase 1 Akili 1 Akiba 1 aki 1 Akhtar 1 Akhlaghi 1 Akesson 1 Akella 1 Akcay 1 Akbas 1 Akbarian 1 Akbari 1 Akassoglou 1 Akane 1 Akaike 1 ajog 1 ajo 1 Ajiro 1 AJAP1 1 Aja-Fernandez 1 Aizenstein 1 Aizawa 1 Aix-Marseille 1 A-IV 1 aisles 1 Aisen 1 airliners 1 aired 1 Aird 1 Airborne 1 Airan 1 A-induced 1 AIN-76A 1 Aik 1 AIHW 1 AIGMUELLER 1 Aiea 1 AIDS-associated 1 AID-CNCR1459 1 AICR 1 Aicher 1 AIC 1 aibili 1 AI-2010 1 AI096109 1 AI087415 1 AI069994 1 AI043477 1 Ahuja 1 Ahtianen 1 Ahsun 1 Ahrlund-Richter 1 AHR 1 AHOPCA 1 Ahnelt 1 Ahmedzai 1 AhmedRL 1 Ahmann 1 Ahmaidi 1 Ahlijanian 1 Ahlbeck 1 Ahlawat 1 Ahistopathologic 1 ahelically 1 Ahearn 1 AhCreApcfl 1 AHA-GWTG 1 AHAF 1 Agustin 1 Agusti 1 Agust 1 Aguilar 1 Aguideto 1 Aguglia 1 AGT 1 agrees 1 agree-ment 1 Agr 1 Agostino-Pearson 1 Agostino2 1 agonist-mediated 1 agonist-induced 1 Ago1 1 Agnihotri 1 AGL2010-22319-C03-03 1 agire 1 agingresearch 1 Aging-induced 1 agingin 1 agingheart 1 aging-disease 1 Aging-dependent 1 Aging-Aged 1 Aging32 1 aging26 1 ag-gregation 1 aggravate 1 Aggoun 1 Aggelakis 1 Aggarwal 1 -AGGAAGCATGTGGGAAATGCAG-3 1 AGFAC 1 age-scaled 1 agesat 1 Age-Related-Eye-Disease-Study-Research-Group 1 agents6 1 age-normal 1 agene 1 agendas 1 Agence 1 agematched 1 AgeingRes 1 ageing-related 1 ageingpopulation 1 ageingphenotype 1 ageingin 1 AgeingDev 1 ageing-associated 1 age-homogenous 1 aged-mice 1 Age-differences 1 aged-based 1 aged58 1 age-based 1 age-at 1 age-appropriate 1 age-and 1 ageand 1 ageadjusted 1 age-1 1 age1 1 AgCl 1 AGAUR 1 Agatston 1 Agata 1 agarose 1 aga-nirsen 1 Agami 1 AG05401 1 AG040278 1 AG038481 1 AG034087 1 AG031155 1 AG029412-01 1 AG026720 1 AG017502 1 AG017139 1 AG008796 1 A-G 1 after-rotation 1 afterhyper-polarizations 1 afterhyperpolarizations 1 afterhyper-polarization 1 afterheartbeat 1 afterexercise 1 after-effects 1 After12 1 Afrikaans 1 African-Americans 1 Afr 1 AFM4 1 aflatoxin 1 afinding 1 Afinbindera 1 Afinbinder 1 affordeda 1 affluent 1 affluence 1 Afflliated 1 affixing 1 affixed 1 affine 1 Affiliate 1 affects2to4 1 affectlongevity 1 Afari 1 Afaq 1 AF1979 1 aex-3 1 aetiologies 1 Aesthet 1 aesthesiometer 1 Aeschbach 1 Aertsens 1 Aerts 1 aerosol-generating 1 Aeronautical 1 Aerobictype 1 aerobics 1 aerobically 1 aerated 1 AEM 1 AED-treated 1 advising 1 advises 1 advertising 1 advertisements 1 advancedage 1 Aduckathil 1 adsorption 1 Adrion 1 Adriana 1 Adriamycin 1 Adriaan 1 Adrenoreceptor 1 adrenodoxin 1 adrenocortical 1 adrenals 1 adramatic 1 ADR 1 ADPYadenosine 1 ADP-stimulated 1 adopts 1 ado-lescents 1 adolescent-generated 1 adn 1 adminis 1 ADM 1 Adli 1 Adlaf 1 ADL 1 Adkins 1 adjudicated 1 adjective 1 adissociative 1 adipogenesis 1 adipocyte 1 Adhikari 1 adherent 1 ADHD-related 1 ADG 1 ADF 1 adenovirus-delivered 1 adenoviral 1 adenosine-induced 1 adenomas 1 adenoma-carcinoma 1 adenoids 1 adeno-carcinoma 1 adenoassociated 1 adenectomy 1 Adelstein 1 Adelson 1 Ade 1 adduct 1 addressable 1 addi-tional 1 addi 1 AD-converters 1 ADCoand 1 ADCi0 1 Aday 1 Adaui 1 adaptor 1 adaptively 1 adaption 1 adapter 1 adapta-tion 1 Adamska 1 Adamovich 1 Adamis 1 Adamina 1 Adamik 1 Adame 1 Adalsteinsson 1 ADAI-IB-2013-02 1 adage 1 AD-affected 1 adaa 1 acyl-transferase 1 acyltransferase 1 acyl-CoA 1 acyclovir 1 ac-Website 1 acutezonal 1 acute-phase 1 acutemyocardial 1 acumulative 1 acuities 1 ACU-4429 1 ACTRN12611000858998 1 actomyosin 1 activity-matched 1 activity-based 1 ac-tivity 1 activ-ity 1 activitiesof 1 activin 1 active-site 1 activemotif 1 activator-binding 1 activa-tion 1 -activated 1 action1 1 actinic 1 actigraphy 1 Actavis 1 Act3 1 Act2 1 acsm-essr 1 acsjournals 1 Ac-Ser1-Tyr2-Ser3-Nle4-Glu5-His6-D-Phe7-Arg8-Trp9-Cys10-Lys11-Pro12-Val13-NH2 1 Ac-Ser1-Tyr2-Ser3-Met4-Glu5-His6-Phe7-Arg8-Trp9-Gly10-Lys11-Pro12-Val13-NH2 1 acrylamide 1 acromions 1 acromion 1 acr-2 1 acquires 1 acquiredencephalocele 1 Acquir 1 Acqua 1 ACP 1 acoustics 1 ACOs 1 Aconservative 1 acongenital 1 aconcomitant 1 acomposite 1 ACOMP 1 ACO-contracted 1 aclinicopathologic 1 aclinician 1 acknow 1 Ackerson 1 Ackermans 1 Acin 1 AcidsRes 1 acid-guided 1 acidebased 1 acid-dependent 1 acid-coated 1 acid-changing 1 acid-based 1 acid-amplification 1 acialregion 1 Achten 1 achronic 1 aching 1 Achille 1 Achieva 1 Acher 1 Acheampong 1 Achatz 1 Acharya 1 acetyltransferase 1 acetyl-CoA 1 acetylases 1 acetonitrile 1 ace-tonide 1 acetaminophen 1 ACE 1 Ac-dLys2-Re 1 Accutest 1 accumulative 1 accu-mulation 1 accumula 1 Acculturation 1 ACCT 1 accruing 1 accrued 1 ACCP 1 Acconci 1 Accomplishments 1 accompanies 1 accommodations 1 accommodated 1 acclerated 1 Accili 1 accidentally 1 ACCF 1 accessprevalencedata 1 accessory 1 accessioned 1 accessdata 1 accentuates 1 accel-erometry 1 accelerometry 1 accelerometers 1 accelerometer 1 ACCE 1 acause 1 ACAT 1 acanthosis 1 acantholysis 1 Acanthamoeba 1 AC-15 1 abyss 1 Abul 1 Abu-Isa 1 Abu-Hanna 1 abstractor 1 abstractly 1 abstraction 1 absorptive 1 absorbances 1 absorb 1 absolute-count 1 abscissa 1 abs 1 abrogating 1 abrogates 1 abroad 1 Abrishani 1 Abrishami 1 abridging 1 abridges 1 Abreu-Goodger 1 Abramson 1 Abramovet 1 Abramov 1 AbramoffMD 1 Abrahm 1 Abrahamsen 1 Abrahamse 1 Abrahams 1 above-stated 1 above-discussed 1 above-described 1 Abou-Setta 1 Abounader 1 abortions 1 abolishes 1 abolish 1 abnormalitiesin 1 Abnorm 1 Ablynx 1 ablating 1 Abi-Said 1 Abiria 1 Abingdon 1 abinary 1 abilityeWMH 1 Abil 1 Abigail 1 abide 1 Abian-Vicen2 1 Abhayaratna 1 AbFRONTIER 1 Abeysiri 1 Abeta-treated 1 Abetastimulates 1 Abeta-mediated 1 abetalipoproteinemia 1 abetalipoproteinaemia 1 Abeta1-42 1 Aberdeen 1 Abej 1 abehavioral 1 Abdul-Wahab 1 Abdullatif 1 Abdul-Ghani 1 abducted 1 abdominoperineal 1 abdominis 1 Abdolell 1 Abdel-Moty 1 Abdelmohsenet 1 Abdel-Malek 1 Abdellatif 1 Abdelaziz 1 Abdehou 1 AbD 1 abcr4 1 abca 1 Abboudi 1 Abbondanzo 1 Abbas-Terki 1 Abalos 1 AB81023 1 ab6672 1 AB5405 1 Ab40 1 ab15077 1 AAVV 1 AAV-mediated 1 AAV-hSNCA 1 AAV-alpha-synucleinis 1 AAV-alpha-synuclein 1 AAV 1 Aarons 1 AAOS 1 aao 1 Aan 1 Aalto 1 aak-2 1 AAK2 1 Aaesth 1 AACR 1 Aach 1 Aaberg 1 AA5 1 aa1-124 1 AA11 1 AA1 1 A8344G 1 A7 1 a549 1 A53ThSNCA140 1 A53ThSNCA 1 A532 1 A5 1 a4pi 1 A4301 1 A428 1 A35 1 A33-based 1 A30P-mutated 1 A30P-induced 1 A30PhSNCA140 1 A3 1 A2E-microglia 1 A2E-lipofuscin 1 A2E-free 1 A2E-fed 1 A2E-dependent 1 A2E-con-taining 1 A2E-associated 1 a2-d 1 A2A 1 A268 1 a250 1 A23 1 A22284 1 a2014 1 A2- 1 a1-subunits 1 A188G 1 A181 1 A18052 1 A178 1 A177 1 A176 1 A173 1 a1530 1 A1305 1 A1260 1 A116 1 A115 1 A-11055 1 A11055 1 A-11034 1 A-11032 1 A-11012 1 A-11001 1 A102065-37 1 A070001 1 a006692 1 9-yr 1 9-year-old 1 9-point 1 9p21 1 9-month 1 9-mm 1 9mm 1 9McArdle 1 9HN 1 9e3 1 9-e25 1 9-e15 1 9e1 1 9cm 1 9B 1 9A 1 99mTechnetium-Labeled 1 99mTc-tricarbonyl 1 99mTc-MAG2-NDP 1 99mTc-labelled 1 99mTc-human 1 99mTc-HSA 1 99mTc- 1 99e124 1 9971-9976 1 995-1004 1 995-1002 1 9951 1 9946 1 994-1005 1 992-997 1 9927693 1 9927222 1 99214 1 991S 1 99-127 1 991-1 1 99-109 1 99-107 1 99-106 1 99-104 1 990S 1 990-996 1 9905-9911 1 990234 1 990-1 1 98e104 1 98-center 1 9896 1 9-881-9-887 1 987th 1 987-94 1 9871003 1 987084 1 98-507 1 984-988 1 9831 1 983 1 982Y8 1 982-92 1 9827 1 98-105 1 98105 1 98-100 1 98-0 1 9799-9804 1 979-985 1 979-89 1 978-86 1 978-84 1 978-3-642-05025-1 1 977-84 1 9773769 1 9-77-1000 1 976e985 1 975-980 1 975-84 1 973Y90 1 9730 1 972-4-8514103 1 972-4-8295202 1 97239-3098 1 9721 1 972 1 971-988 1 971-94 1 9715 1 97-107 1 97-104 1 97-101 1 970-984 1 9700RB 1 969-73 1 969 1 968-977 1 968-974 1 9679884 1 967-978 1 967-77 1 9673 1 967 1 9668623 1 965-976 1 9658 1 9653 1 9650 1 9649 1 9648 1 963-972 1 9629301 1 9624 1 961-967 1 9619 1 96-117 1 96-107 1 96-104 1 96-101 1 9608 1 9603539 1 96020-220 1 -96 1 9593 1 958-62 1 958308 1 9-56-9-58 1 956-63 1 95615 1 955-966 1 953-958 1 953-9 1 952Y60 1 95-108 1 95-105 1 95103 1 950e1100 1 9-5 1 94e99 1 94e9 1 94-97 1 94-9 1 948-954 1 9488 1 9482300 1 9480-9491 1 94805 1 9457895 1 945-53 1 945-07-502 1 94507212 1 94506553 1 945 1 9440 1 9437 1 9434 1 94305 1 94304-1290 1 94303 1 943 1 942-953 1 941-948 1 941282 1 94-126 1 94-109 1 94-101 1 9-4-100 1 941 1 9407 1 940-6207 1 940 1 93x 1 939-945 1 939-944 1 93991704 1 93991105 1 939751 1 938-44 1 938 1 937-952 1 937-946 1 936-944 1 9-35-9-46 1 933-925 1 932-949 1 9319 1 93-136 1 93-118 1 93-1 1 9302 1 93-0 1 -92to 1 92adults 1 929-931 1 9-299 1 92-99 1 92-97 1 929-37 1 -929 1 928-935 1 927-936 1 927573 1 9264 1 9250 1 924-8 1 9248 1 9246 1 924 1 -9236 1 92-313 1 9230 1 922-8 1 9228 1 9224 1 9211767 1 92-105 1 92-103 1 92093-0375 1 92093 1 92037 1 92-02 1 9200 1 91-year-old 1 91e111 1 919Y50 1 919-922 1 919-27 1 9186 1 9179097 1 9-17 1 916479 1 915803 1 9-15 1 914-920 1 9139 1 9-13 1 9128 1 9120 1 9-12 1 912 1 9117 1 91-103 1 9107-9116 1 9100 1 -91 1 90Y-labeled 1 90Y-based 1 90s 1 90-day 1 9089709 1 908-914 1 9089 1 9066 1 90610-000 1 905-911 1 904s-8s 1 903025 1 9022281 1 90095-6951 1 900-916 1 9005 1 90017 1 9000 1 9- 1 8years 1 8-year-old 1 8-year 1 8UL1TR000055 1 8ST 1 8speech 1 8S 1 8q21 1 8q 1 8-Oxo-7 1 8-oxo-2 1 8-month 1 8month 1 8-mm-thick 1 8-mL 1 8min 1 8Gy 1 8e11 1 8-dihydroguanine 1 8Department 1 8D 1 8-connected 1 8Computational 1 8-cm 1 8cm 1 8-based 1 8AF 1 89Zr-immunoPET 1 89Zr4 1 89Y 1 8997 1 89-93 1 8983338 1 898 1 897-903 1 8973 1 8969 1 8968 1 895 1 893-1 1 892-900 1 892-898 1 8916-8924 1 89-103 1 89-101 1 890-921 1 89-0 1 8899819 1 889-894 1 88-98 1 88-95 1 8883 1 887-896 1 887-891 1 8875- 1 88618372 1 88618339 1 884e888 1 884-6 1 883-890 1 881-90 1 8807 1 880-2 1 87th 1 879Y82 1 879-880 1 879-86 1 8798461 1 8797 1 87-96 1 87-91 1 8780Y4 1 877-886 1 877-883 1 87-781 1 8760-8769- 1 874348-overview 1 874 1 873Y9 1 873-880 1 873-876 1 872e877 1 871-877 1 87131 1 871 1 870-947 1 870-879 1 870-873 1 8701084 1 86Y-D 1 86Y- 1 86Y 1 8699 1 86-96 1 86-95 1 868-81 1 868 1 866 1 8656247 1 8649 1 8647966 1 863-878 1 8637-40 1 863720 1 863 1 861869 1 861-868 1 8614-8620 1 86-10 1 8602 1 85Y90 1 859Y67 1 859-5-8604 1 85-94 1 85-93 1 858e865 1 85-8 1 857-63 1 856 1 854-9 1 853-855 1 853-61 1 853-0 1 852754 1 85259 1 851-860 1 85-110 1 85-103 1 8508 1 85004 1 -85 1 8-5 1 84e100 1 849-855 1 84-90 1 848-851 1 848 1 847-850 1 8476 1 8473487 1 84698 1 8469 1 8461-8466 1 845-851 1 844-851 1 844 1 843-849 1 843-50 1 842-847 1 841-852 1 841-842 1 84132 1 8-41 1 840-852 1 839-848 1 8390210 1 8390180 1 83-89 1 838-842 1 83-87 1 8381-8394 1 837-845 1 836-838 1 835-42 1 835 1 834-842 1 834-840 1 833-838 1 8327 1 831e836 1 8318 1 8316-8322 1 8315 1 8314-8318 1 830-836 1 8306 1 82Y90 1 8295 1 829-35 1 8284 1 828-34 1 827-35 1 826-32 1 826 1 825-834 1 825-830 1 824-831 1 8242 1 823-9 1 823-828 1 8-23 1 822Y31 1 8224 1 8222-8229 1 8220-8228 1 8-22 1 821Y7 1 8215 1 821-42 1 821-4 1 8203 1 82-0 1 81e83 1 819e829 1 819-831 1 819-824 1 8198 1 819-35 1 81-91 1 8189 1 8187 1 8182 1 81-8 1 815-822 1 8151-8155 1 813Y9 1 813-825 1 813-20 1 8131 1 812-818 1 81271921 1 8-11th 1 811-820 1 8118 1 81101339 1 81-100 1 8108-8116 1 81071092 1 8107 1 8-10- 1 80-year-old 1 80s 1 80or 1 80mm 1 80-kDa 1 80-87 1 8081 1 8077-8084 1 806e815 1 8062 1 805Y10 1 805-8 1 8057 1 8052 1 8046 1 8045 1 8043 1 803-810 1 8036 1 802-813 1 802-808 1 801-805 1 80-111 1 80-100 1 800e 1 800710 1 -8 1 7which 1 7-triyl 1 7-triazonane-1 1 7These 1 7Pathology 1 7p14 1 7NH 1 7N 1 7M 1 7LF 1 7-kb 1 7K 1 7J 1 7-item 1 7inone 1 7H2O 1 7H 1 7genes 1 7G 1 7e19 1 7e143 1 7e11 1 7-D-phenylalanine-a-melanocyte-stimulating 1 7-D-Phenylalanine 1 7-Dehydrocholesterol-derived 1 7Chair 1 7Be 1 7Bb 1 7and 1 7AL 1 7Af 1 7A1 1 79Y94 1 79e131 1 7998-8003 1 79-93 1 79-92 1 798-804 1 79-84 1 79-82 1 7982 1 798 1 797-802 1 796-806 1 7965150 1 -796 1 795-803 1 795-801 1 795-7 1 7954 1 7950 1 794-809 1 794-804 1 793-803 1 793-801 1 792-5 1 7925 1 791-801 1 791-8 1 791-6 1 791 1 790-2 1 79-0 1 7-9 1 7890A 1 78-81 1 7878 1 7871 1 786-9 1 786-796 1 786 1 785Y93 1 785-793 1 7848 1 7846672 1 78249 1 7821-7840 1 7811 1 781 1 780-787 1 778Y86 1 77-86 1 77-83 1 7774-7778 1 7764 1 776 1 775-nm 1 775-781 1 775352 1 775 1 773-85 1 773-82 1 772-8 1 772-778 1 771e781 1 771-779 1 7711-7715 1 7709-7717 1 7708 1 77030 1 77- 1 76-kDa 1 76e94 1 76e 1 76-and 1 769-71 1 7691039 1 768e777 1 768-774 1 76-81 1 7680359 1 767-781 1 766-772 1 766-767 1 766-73 1 7665 1 765e772 1 765-8 1 765-77 1 765-72 1 765 1 764-9 1 7646 1 7639-45 1 763-769 1 763-768 1 76-338 1 762-770 1 762-768 1 762-767 1 761Y7 1 761-775 1 76-0 1 760 1 75-year-old 1 75S 1 75-millisecond 1 75-C 1 759-67 1 758-763 1 758-65 1 7586 1 7570 1 7560533 1 7545 1 7540 1 753-778 1 753-7 1 751Y66 1 7519 1 751-772 1 751-760 1 751-752 1 75-12 1 7510-7519 1 750-758 1 750-753 1 7500- 1 7500 1 7498 1 748-754 1 748-753 1 748-54 1 748-50 1 747-754 1 747-51 1 746-756 1 745-751-741 1 745-751 1 7454 1 7452698 1 744-748 1 7441 1 -744 1 7439 1 7438 1 743-755 1 743-753 1 743 1 742-753 1 741-7 1 7413 1 74-103 1 7401-7406 1 7401 1 73Y1 1 739-746 1 739-745 1 7395-7400 1 739297 1 738-746 1 738-744 1 73-81 1 73-8 1 738 1 737-743 1 7372 1 736-40 1 735-765 1 7357 1 733748 1 733-744 1 733-743 1 732-741 1 7321 1 731-741 1 731-739 1 731-738 1 731-734 1 731-732 1 731-7 1 7312 1 73104 1 7310 1 7309356 1 730-7 1 7305 1 7300 1 729-742 1 729-35 1 728-731 1 728-36 1 72-74 1 725-731 1 7247-7260 1 724-729 1 724-726 1 7243 1 723Y35 1 7238- 1 723-744 1 722-733 1 722-728 1 7223 1 7222 1 72202 1 721-735 1 721-727 1 7216 1 7212 1 720Y7 1 72076 1 720-729 1 720-30 1 71kDa 1 718e722 1 717-732 1 7175 1 7168 1 7150 1 7-15 1 7148 1 714-719 1 7140 1 713-727 1 713-721 1 713-717 1 71287 1 712-721 1 7-12 1 7118 1 711-722 1 711-25 1 7109 1 7-108 1 70-year-old 1 70th 1 70-min 1 70-kg 1 70e89 1 709e711 1 7098 1 709-715 1 7097 1 708e719 1 708-715 1 70-78 1 7074 1 7065 1 7063747 1 706 1 705-717 1 7055 1 704045 1 703-713 1 703-711 1 703-706 1 7026-7033 1 7022 1 701-8 1 70179-7 1 701-710 1 7016 1 701464 1 701391 1 7013 1 700cones 1 70-0 1 6Y52 1 6vectors 1 6These 1 6-tetrahydropyridine-lesioned 1 6-tetrahydropyridine-induced 1 6-tetrachloro-3alpha 1 6syllables 1 6-syllablenonwords 1 6RJ 1 6q16 1 6pg 1 6-or 1 6-OHDA 1 6Number 1 6-mo 1 6Lung 1 6K 1 6JB 1 6-item 1 6-hydroxydopamine 1 6h 1 6-Gt 1 6G 1 6F 1 6exons 1 6events 1 6-diamino-2-phenylindole 1 6Dermatology 1 6cells 1 6Cd 1 6BT 1 6-and 1 6alpha-diphenyl-glycoluril 1 69e77 1 6998 1 6990 1 698-704 1 698-703 1 698-702 1 6987 1 6982 1 69-80 1 697-709 1 697-698 1 69-73 1 6973 1 696-706 1 6962 1 695-706 1 695-704 1 695-702 1 694-700 1 693-699 1 692-698 1 692-694 1 -69 1 6-9 1 68Y75 1 68Ge 1 68Ga-NOTA-anti-HER2 1 68Ga-DOTA-NAPamide 1 689e692 1 689-698 1 6892 1 6882992 1 6881 1 687-93 1 687-708 1 68-74 1 68-73 1 68-70 1 6861 1 686 1 6858-62 1 685-692 1 685-691 1 6853 1 6848 1 6827 1 682-4 1 681-95 1 681806 1 681-694 1 6814 1 680LT 1 6807-6829- 1 680-684 1 6804 1 -68 1 67-year 1 67Ga-DOTA-NAPamide 1 679-86 1 679-686 1 6796 1 6789857 1 6789 1 67820 1 67-81 1 67-79 1 6777774 1 677-686 1 6776-6783 1 67-73 1 67-72 1 6768-6777 1 675-84 1 675-81 1 675-705 1 6749 1 674-682 1 674-680 1 6741 1 673S-677S 1 673-679 1 6735 1 6730 1 672-8 1 -672 1 671-681 1 6716482 1 67-115 1 6711 1 6708 1 6704 1 6-70 1 669Y82 1 669Y81 1 66992000 1 669-76 1 669-692 1 6690 1 668-674 1 66-81 1 6680 1 667-77 1 66-72 1 6666 1 6664 1 665-75 1 664Y72 1 6642-8 1 663Y84 1 6638 1 663-75 1 6627 1 662-673 1 661-671 1 66100 1 660S 1 6608041 1 6-6 1 65-year-olds 1 659-678 1 659-668 1 6589 1 6580 1 657-664 1 657-659 1 65-70 1 6569-6582 1 65-69 1 6569 1 6564 1 655-671 1 6548-6553 1 652C- 1 652-655 1 652-654 1 65201 1 64-slice 1 64Ni 1 64-detector 1 64Cu-labled 1 64Cu-DOTA-Re 1 64Cu-DOTA-NAPamide 1 64Cu-D 1 64CuCl2 1 64Cu-and 1 64-91 1 648-651 1 6473 1 64-71 1 64-66 1 64-6 1 645 1 643-648 1 6428 1 64261Ie64311I 1 6425 1 641651 1 641-5 1 641-4 1 641 1 640-644 1 640-6 1 6405 1 6400 1 63Y5 1 63e125 1 639-e653 1 63-86 1 63-81 1 637e-645 1 63-73 1 6373 1 6365 1 635-645 1 635-41 1 6352-8 1 634-637 1 -633-conjugated 1 632-644 1 632-636 1 6326 1 6324 1 631Y4 1 6315 1 631-40 1 63110 1 6307 1 630-642 1 630434 1 630402 1 6302 1 63-0 1 62-HU 1 629-634 1 6287 1 628-640 1 628542 1 628-33 1 628-32 1 627Y34 1 627-633 1 627-37 1 62-71 1 626e632 1 626e35 1 625-632 1 6245-52 1 622-631 1 622-629 1 62249 1 621-636 1 621-628 1 6212 1 62-1 1 620fiverdin 1 620-635 1 6200 1 619-647 1 6195 1 61868 1 618-625 1 618-19 1 61-80 1 61-74 1 617-358-3386 1 617-353-4767 1 61-69 1 6168 1 616-620 1 6-16 1 6159 1 615-622 1 614-617 1 6145 1 6143 1 6140 1 613-620 1 613-615 1 6130 1 612-616 1 6121-6139 1 611Y6 1 611-8 1 611-619 1 611-617 1 611- 1 610787 1 6-10 1 610 1 60-year-old 1 60-s 1 60s 1 60-minute 1 60-min 1 60mg 1 60-HU 1 60e80 1 609e621 1 608478 1 60-82 1 60-80 1 608 1 607A0502 1 607895 1 607854 1 607-614 1 60-71 1 60-70 1 60-7 1 6068507 1 60-66 1 6062-6071 1 60612 1 60611-3008 1 60611 1 -606 1 605-9 1 605-613 1 60525-0 1 605-13 1 604-875-3860 1 604-875-3819 1 6044 1 6034 1 6032-voxel 1 6029 1 6021 1 6018-6027 1 6014 1 600-ps 1 600mCi 1 6008-6025 1 600-7 1 6001 1 60-0 1 5-yr 1 5-week 1 5UL1RR025780 1 5trials 1 5TranslationalCancer 1 5-tesla 1 5te 1 5T 1 5Suppl 1 5-second 1 5s-13s 1 5region 1 5R25CA081137 1 5R01AI31046 1 5R01AI086134 1 5-parameter 1 5P01AI45897 1 5Number 1 5-mm-thick 1 5-mL 1 5mL 1 5minutes 1 5min 1 5-methyl-tetrahydrofolate 1 5-methyltetrahydro-folate 1 5MBq 1 5-lm-thick 1 5lM 1 5Knight 1 5K23AG024229 1 5K07CA104128 1 5-iodo-3-pyridinecarboxylate 1 5-hour 1 5h 1 5Gene 1 5-fluoro-uracil 1 5-fluorouracil 1 5F7GGC-SGMIB 1 5F7GGC-125 1 5F7GGC-123 1 5-Di-t-butyl-1 1 5-diphe-nyltetrazolium 1 5-dimethylthiazol-2-yl 1 5DD 1 5-CD14 1 5c6 1 5beta-steroids 1 5beta-reductase 1 5alpha-tetrahydrodeoxy-corticosterone 1 5alpha-reduction 1 5alpha-reduced 1 5A-C 1 59th 1 598-605 1 5980 1 597-613 1 597-607 1 5976 1 5975C 1 5971858 1 59-70 1 59-68 1 59-64 1 595-616 1 595-614 1 595-606 1 595-605 1 5954 1 594-603 1 593-9 1 59-3-654 1 593-607 1 5936 1 5934-5943 1 5-9 1 58-kDa 1 58e63 1 589-92 1 5897-5905 1 589-598 1 589-594 1 589- 1 588-594 1 587-96 1 587-93 1 587-92 1 5875 1 58-71 1 58-70 1 58-68 1 5866 1 58-65 1 58-64 1 58-63 1 5862m 1 5862-5871 1 5862 1 585Y92 1 583-8 1 583-591 1 5833 1 582-588 1 58-1950-0-014 1 581-6 1 581-3 1 5806 1 5802 1 5800 1 57-year-old 1 579-84 1 5797 1 5795 1 57-77 1 57-65 1 5765 1 5761-5767 1 57-60 1 5756 1 575-579 1 5754-8 1 5750 1 574-81 1 5747 1 574-579 1 574-578 1 5742 1 -574 1 573-600 1 573-580 1 5734 1 572-82 1 572-574 1 571-86 1 5717 1 571-580 1 571-574 1 5712-5717 1 570-9 1 570850 1 -57 1 56e61 1 569-77 1 569-580 1 568807 1 568-77 1 568605 1 568-574 1 5676 1 567-572 1 567-568 1 -567 1 5667 1 56-66 1 56-65 1 5663 1 56-61 1 5661 1 56-60 1 565Y70 1 565-9 1 565-574 1 565-568 1 565069 1 5649-58 1 5647 1 564-572 1 5645 1 563-567 1 563-566 1 5635 1 562Y7 1 5628-5632 1 5627289 1 5626 1 562-570 1 562-568 1 562-3 1 5623 1 5618 1 5616-21 1 5609-5613 1 560-582 1 5601 1 560- 1 5-6 1 55-year-old 1 5591 1 5586 1 558-564 1 557Y69 1 557Y66 1 5578 1 557-68 1 557-560 1 55-69 1 5567 1 556-60 1 55-60 1 555-61 1 555-567 1 554-555 1 55455 1 553-600 1 5536 1 553-564 1 5535-5542 1 5533-5543 1 5529 1 552-577 1 552-557 1 5524 1 551-559 1 551-5 1 551-3 1 5504 1 55038 1 54patients 1 549e564 1 549-561 1 5495-5504 1 5495- 1 5493 1 5487 1 547e559 1 5479 1 5476 1 54-64 1 545-552 1 545-551 1 545-550 1 5446 1 5442 1 543-550 1 543-548 1 54278 1 541-7 1 541-60 1 541-558 1 5-40 1 -54 1 53e79 1 53C 1 539-e542 1 539-42 1 538Y53 1 538-543 1 5375 1 53705 1 536-9 1 53-64 1 5363-5366 1 5363 1 5362 1 53-61 1 53-60 1 535-8 1 535-7 1 53-56 1 535-562 1 535-546 1 5354 1 5348 1 5347-5358 1 534-40 1 53400 1 533-540 1 533-538 1 5334 1 5330 1 532-3 1 53226 1 5322 1 -532 1 5-31 1 530534 1 530-532 1 5-30 1 53-0 1 530- 1 52ms 1 5299-5309 1 5299 1 529-541 1 5293-5300 1 529311 1 5-29 1 52-9 1 528-533 1 5-28 1 528 1 527-535 1 5271 1 52-68 1 5-26 1 52-57 1 525-530 1 525-33 1 5-25 1 52-5 1 524-530 1 523-533 1 523-532 1 522-527 1 5-22 1 5219 1 521-528 1 521-524 1 5213 1 5209 1 520-8 1 5201 1 51-year-old 1 51A 1 5192Y200 1 5-19 1 519- 1 5186-5191 1 518-624 1 5-18 1 517-535 1 5171 1 5167 1 5166 1 5165-5178 1 51-63 1 5158 1 515-7 1 51-56 1 51-54 1 5150 1 514-8 1 5148 1 5147 1 5135 1 513-31 1 513-23 1 512-528 1 512-517 1 5125 1 5121 1 5-12 1 511-keV 1 511-523 1 5-11 1 510lm 1 51095 1 5106-5129- 1 510-4 1 510298 1 510148 1 5100 1 50-year-old 1 50th 1 50-TATCCGGAGGGCTCGC-CATGCTGCT-30 1 50s 1 50-ms 1 50-m 1 50-ggcttggacagaacttaccg-30 1 50e70 1 50e20 1 50e1 1 50-ctttgtgcggaggcattg-30 1 50-cttctgcttgatgatcatctc-30 1 50-CTGTGTAGCCTAGTTTAGAGCAACCAT 1 50-CCTCTCTGAACAGTTCATGTTTGATGGTGA-3 1 50-CCAGCTTTTAGGCA 1 50AMP- 1 5097 1 509-527 1 5095 1 5091 1 508992 1 508-935-3450 1 507e514 1 50-7 1 506-508 1 505-517 1 505-512 1 505-14 1 505-13 1 505-11 1 504-512 1 5044 1 5042 1 503-507 1 5019 1 501-7 1 501-526 1 5014 1 500-to 1 500ll 1 500-fold 1 500-9 1 5003 1 5000m 1 50-0 1 5-0 1 4-yr 1 4University 1 4Unit 1 4U 1 4Total 1 4The 1 4syllable 1 4subjects 1 4s 1 4q22 1 4q 1 4psncosbDa 1 4Professor 1 4patients 1 4nT 1 4-Norleucine 1 4N0 1 4-mm-group 1 4mm2 1 4mM 1 4MBq 1 4Mammalian 1 4M 1 4ll 1 4L8 1 4J 1 4-item 1 4-iodobenzoate 1 4I 1 4-hydroxyalkenals 1 4-HNE 1 4-h 1 4-guanidinomethyl-3-iodobenzoic 1 4-guanidinomethyl-3- 1 4-guanidinomethyl 1 4-gamma 1 4Gamma 1 4ENT 1 4E-BP1 1 4e5 1 4e14 1 4D-F 1 4-day 1 4Cognitive 1 4-class 1 4-chambered 1 4-C 1 4Blood 1 4-benzohydroqui-none 1 4-and 1 4-aminobenzyl 1 4A-C 1 49Y0 1 49ShHor 1 49ES 1 499-525 1 499-511 1 497Y506 1 497-523 1 497-500 1 4974 1 496-505 1 49-65 1 496-499 1 49-61 1 49-59 1 4957-4966 1 49-57 1 49-51 1 494Y502 1 494-97 1 494-9 1 4949 1 494-503 1 49-4-500 1 -494 1 493Y9 1 493-6 1 493-508 1 493-498 1 49334 1 4930 1 493 1 492-509 1 492-502 1 4919 1 4918-28 1 4916 1 491-500 1 491-499 1 491-496 1 4907 1 4904 1 -49 1 48-bit 1 489-98 1 4895 1 4890-025-K 1 488-489 1 4875-4883 1 487-493 1 486-96 1 4867 1 486-489 1 48-60 1 485-93 1 485-8 1 485-496 1 48-54 1 4852Y62 1 4847 1 484-496 1 4839 1 4835 1 483-493 1 4832 1 482-91 1 482-495 1 48202 1 48190-011 1 4817 1 481-489 1 4814334 1 481-3 1 48109 1 4808 1 480-7 1 480-508 1 4800 1 47-year-old 1 47We 1 47R 1 47NSAIDs 1 47n 1 47ES 1 479-491 1 479-486 1 4785-4791 1 477Y84 1 477-485 1 4770 1 4767 1 476-506 1 4762 1 4760 1 4756 1 4755 1 4754-4765 1 4750 1 47-49- 1 4749 1 474-80 1 4748 1 4747 1 4743 1 4737 1 473-482 1 473-477 1 4734 1 47292-47298 1 471-495 1 471-479 1 471-474 1 4713 1 47100 1 470-477 1 470-474 1 47-0 1 -47 1 46-year-old 1 46Y51 1 46r 1 4-6-fold 1 46e52 1 4696-4708 1 469-472 1 4692 1 4687 1 468-475 1 4681 1 4678-4684 1 467-75 1 467-481 1 466-472 1 4664-4669 1 4663-4670 1 4662cases 1 4658 1 465-69 1 46548 1 465-472 1 46541 1 46-54 1 46-53 1 46-51 1 46-50 1 464-and 1 4649 1 464-8 1 4648 1 464-570 1 464-473 1 464-0776 1 463-84 1 46366 1 46363 1 463-471 1 462-468 1 462-465 1 4619 1 461-469 1 4-6-1 1 460-468 1 460-467 1 4604-5 1 4603-4 1 4600 1 4-5-year 1 45uml 1 45mg 1 45-kb 1 4595 1 459-464 1 4587 1 458139 1 458 1 45-77 1 457-62 1 457-472 1 4571-4579 1 456-64 1 456-464 1 456-463 1 456-457 1 455632 1 455-459 1 454-465 1 454-458 1 454-456 1 4535 1 453-461 1 4528 1 451e459 1 4516 1 451-467 1 451-452 1 4513 1 450-mm 1 450332 1 4500mg 1 450052 1 -450 1 44-year-old 1 449e454 1 44959 1 44-9 1 4481 1 4480 1 44-8 1 4477 1 447201 1 446-52 1 446-51 1 4464 1 4460 1 44-55 1 4453 1 44-46 1 4446 1 444-50 1 444-453 1 444-450 1 4443 1 443-9 1 4439 1 443-8 1 443-50 1 443-458 1 4433-4436 1 4430 1 4428 1 442-455 1 4422 1 441-6 1 441-450 1 441-448 1 441-443 1 44121 1 44106 1 4405-13 1 4404 1 44-0141-331-8824 1 44-0141-331-3005 1 44-0 1 439-e456 1 4396 1 439-455 1 439-446 1 439-444 1 439-431-432 1 438e445 1 438-442 1 437-449 1 437-44 1 4-37 1 436-443 1 436-438 1 436-40 1 4362 1 435Y6 1 4357 1 435-449 1 435-40 1 43-52 1 434e439 1 43-48 1 43-47 1 434-442 1 434-439 1 434437 1 434-41 1 4339-4345 1 433-440 1 433-439 1 433-438 1 43-316-385-81320 1 43-316-385-13355 1 4327 1 4326 1 4325 1 431e437 1 4318 1 431-435 1 431-42 1 4314 1 43-1 1 430-42 1 4300 1 -43 1 42-Section 1 42-month 1 42-97 1 429-435 1 428e7 1 4285 1 428-429 1 428-37 1 427kDa 1 427e2 1 427e1 1 4277 1 427-432 1 427-37 1 426e436 1 426-431 1 426 1 42-57 1 4252 1 4245-4250 1 4245 1 424-31 1 4243 1 423-429 1 423-38 1 423-30 1 4231 1 422-428 1 4224 1 421-5 1 421-428 1 421-427 1 421-2 1 420Y5 1 4200 1 -42 1 4-2 1 41Thickness 1 41st 1 41R 1 41e55 1 4199 1 4198-4214 1 419-425 1 4194 1 419-27 1 418Y22 1 4188-419-3 1 41845 1 418-420 1 41821 1 -4180 1 417-8 1 417-426 1 417-423 1 417-419 1 4172 1 4166-4176 1 416-425 1 416-22 1 4162 1 41-60 1 4160 1 415-9 1 41-57 1 4157 1 415-425 1 415425 1 415-422 1 41-53 1 4151-4158 1 4148 1 4146 1 4145 1 414-422 1 414-421 1 4144 1 4137-4144 1 413735 1 413-425 1 412-648-9587 1 412-648-1342 1 4126-4136 1 412-427 1 4115-4128 1 411-437 1 411-431 1 4110 1 410Y2 1 4108 1 4106-4114 1 410-23 1 4100-4103 1 410011 1 4-10 1 -41 1 4-1 1 40-year-old 1 40or 1 40mm 1 40-mL 1 40-min 1 40min 1 40ll 1 40-km 1 40-fold 1 4095 1 409-18 1 4085 1 408-422 1 408-31 1 4083 1 4082 1 4079 1 4078 1 4076 1 4073 1 4071 1 4069 1 4067 1 4066 1 4064 1 4061-4073 1 405Y17 1 405Y11 1 405-415 1 405-412 1 405-410 1 405-13 1 40-51 1 4051 1 40-47 1 404-12 1 40400 1 4036 1 4032 1 4029- 1 4027 1 402408 1 402-406 1 40-2200 1 401-409 1 4014 1 4013-4018 1 40125 1 401162 1 401101 1 4010 1 4009 1 4008-4013 1 4007-20 1 4006-4034 1 400-500 1 4005 1 400-402 1 4001-4011 1 40- 1 3years 1 3x10 1 3V4 1 3untranslatedregion 1 3University 1 3Unit 1 3-tesla 1 3-syllables 1 3-Substituted 1 3-set 1 3-segment 1 3-scan 1 3Research 1 3rdyear 1 3Professor 1 3Polytechnic 1 3-point 1 3-PCand 1 3-oxo-4-ene 1 3Number 1 3-neuron 1 3mm3 1 3mm 1 3-minute 1 3min 1 3L-type 1 3-lm-thick 1 3-labeled 1 3-kinases 1 3JP 1 -3-isobutyl-g-aminobutyric 1 -3-isobutylgaba 1 3-iodobenzoyl 1 3-iodobenzoate 1 3International 1 3-in-1 1 3-I-iodobenzoyl 1 3-hydroxy-3-methyl-glutaryl-CoA 1 3H4 1 3G 1 3Experimental 1 3e6 1 3D-volumetric 1 3DQ-Advanced 1 3D-OP-OSEM 1 3distinct 1 3-diphosphoglycerate 1 3DiabetOmics 1 3D-FBP 1 3D-conformal 1 3-day 1 3Current 1 3-column 1 3cm 1 3Center 1 3but 1 3BG 1 3alpha-hydroxy-5alpha-pregnane-20-one 1 3alpha 1 3AFC 1 3ADC0 1 39Onceall 1 39-mm2 1 3999 1 3997-4005 1 3997 1 39959-67 1 399-404 1 3994 1 398e410 1 3989 1 398-411 1 3980 1 39-74-39-80 1 397-424 1 397-405 1 -396 1 3-95-yr 1 395Y400 1 3955 1 39-5-409- 1 395-407 1 395-400 1 3950 1 3947 1 394-400 1 3944 1 3943-3954 1 3942 1 39403947 1 39-4 1 393-9 1 393-552 1 393-422 1 393-405 1 39-3-402 1 393-402 1 393-399 1 3931-3944 1 3931 1 392-9 1 3927 1 3925 1 391-405 1 391-404 1 391-401 1 391-398 1 3909-3918 1 390-422 1 390-420 1 3-900051-07-0 1 38-year-old 1 38year 1 38th 1 389e398 1 389-95 1 389-94 1 389-93 1 389-414 1 389-395 1 388Y94 1 388-389 1 387-405 1 386-393 1 3862 1 3858 1 3857 1 38-56 1 385-414 1 385-409 1 385-405 1 385-396 1 384-92 1 38-47 1 3847 1 3846-3852 1 38-44 1 38-43 1 38-40 1 383-9 1 383-392 1 3831-3843 1 382-90 1 3829 1 38-2850 1 3827-3836 1 381-91 1 3819 1 381-391 1 381-387 1 3811 1 3807 1 380-382 1 3803 1 3801-3804 1 -38 1 37-year-old 1 37Y41 1 37-month 1 37-MBq 1 37e42 1 379-82 1 379-404 1 378e402 1 378Cin8 1 378C 1 378-386 1 378-379 1 3782 1 3776 1 377-406 1 377-386 1 3770 1 377- 1 3769 1 3768 1 376-382 1 3762 1 375-81 1 37573 1 3756 1 375418 1 375-413 1 374Y80 1 37-47 1 37-46 1 374-383 1 374-381 1 37-43 1 37-40 1 373a-4a 1 37-39 1 373-6 1 3735 1 3731 1 37-3 1 372-6 1 3725 1 372-381 1 37232-2675 1 37232 1 372-3 1 3723 1 3719 1 371-401 1 371-372 1 3713 1 3711-3718 1 3710 1 3709 1 370-379 1 -37 1 36We 1 36A 1 369Y76 1 369-74 1 3693-8 1 369-373 1 369-1-3702 1 368-78 1 368-77 1 3684e3693 1 3682 1 368- 1 3679-90 1 367-374 1 367-370 1 3670-3673 1 3662-3668 1 365e375 1 365-372 1 365-370 1 3653-3659 1 36-51 1 3651 1 3650 1 3648 1 36-47 1 3646 1 3645 1 36-43 1 36424 1 36-42 1 36415 1 363e370 1 3639 1 363-7 1 3635 1 363-372 1 3633 1 362e372 1 362-7 1 36258-36267 1 362368 1 36-22 1 3621-3631 1 361Y7 1 361e370 1 361-366 1 3612-3624 1 360-372 1 360-363 1 3603 1 3600-3611 1 -36 1 35gene 1 35e41 1 35e37 1 3597-3604 1 3589 1 3584 1 3583-3589 1 3582-3589 1 3582 1 3581-3586 1 357e370 1 3577 1 3573817 1 357-364 1 356-8 1 355Y62 1 355-77 1 35-57 1 355-68 1 355-61 1 3554 1 355-379- 1 355-359 1 35-51 1 3550 1 354Y60 1 35-47 1 35-44 1 35-42 1 3541 1 353-8 1 3535 1 353-360 1 353-359 1 3533-3544 1 3532 1 3531-3538 1 35294 1 3529-3538 1 352-5 1 352-356 1 352-355 1 3519 1 351-7 1 351-60 1 3513 1 35121 1 3512 1 35118 1 35104 1 3509 1 3508 1 350-7 1 350-62 1 3504 1 350-364 1 3503 1 3500-9100 1 3500- 1 3500 1 34e40 1 3496 1 349-59 1 3494 1 349-358 1 3490 1 348Y52 1 3489 1 348-368 1 348-352 1 3482 1 347-serine 1 347e353 1 3477 1 347-53 1 34749 1 34741 1 34613471 1 345Y53 1 3454-m 1 3454 1 345-348 1 3451 1 3450 1 344Y50 1 34498 1 34493 1 34484-34493 1 344-352 1 344-349 1 3441 1 3440-3450 1 343-68 1 34-36 1 342e349 1 34271 1 342-348 1 3418 1 341-7 1 341-61 1 341-352 1 3412 1 34-1 1 34096 1 3409 1 3407 1 340-344 1 3401 1 3400 1 -34 1 33rd 1 3399-3413 1 339-54 1 339-47 1 339-354 1 339-345 1 33933400 1 3391 1 338Y46 1 3387 1 3379-3386 1 3378 1 3377 1 3375 1 3374545 1 337-350 1 337-346 1 3373-3385 1 3372-3380 1 336e342 1 3366-3375 1 336-349 1 336-343 1 3362 1 3358-3365 1 3358- 1 335-341 1 335-2012 1 334-341 1 334-339 1 33-41 1 3336 1 33342 1 333-41 1 33340 1 333340 1 33-3-26-91-83-00 1 33-3-26-91-80-55 1 3-332 1 3329 1 33288 1 332-49 1 3317 1 331-6 1 3316 1 331-338 1 331-336 1 331-335 1 3313-3320 1 3312 1 3310 1 330g 1 3308010 1 3306 1 330-58 1 330-337 1 33013310 1 33-0 1 32-year-old 1 32Y7 1 32-item 1 32However 1 32-bit 1 3299 1 3298 1 329-39 1 329-343 1 3290 1 3289 1 32889 1 32877 1 3286 1 328-344 1 328-34 1 327e333 1 3278-3296 1 3277 1 327-40 1 3274 1 327-30 1 3269 1 3268 1 326-329 1 3262 1 32618 1 3-25-8 1 3257 1 3256 1 3255 1 325-338 1 325-333 1 3251-3256 1 3251 1 3249 1 3248 1 32-46 1 3245- 1 3244 1 324-341 1 324-31 1 3243 1 3242 1 3241 1 32-38 1 32-36 1 3235 1 323-343 1 323-332 1 3230 1 322-8 1 3228 1 3225-3237 1 322-326 1 3220 1 3219 1 3217 1 3214 1 321-329 1 321-328 1 3213 1 3-211At-astato-4-guanidino-methylbenzoate 1 321075 1 321041 1 320Y7 1 -320b 1 320-9 1 3209 1 3201 1 320030-127538 1 320030127538 1 32-0 1 3-2 1 31y-0 1 31-month-old 1 31-gauge 1 31e60 1 31e36 1 3199 1 319-328 1 319- 1 3188 1 3187-3193 1 3184 1 318-324 1 318-22 1 31-8 1 3179 1 3177 1 3176 1 31753 1 31746 1 317-332 1 317-325 1 3171 1 3170 1 3169 1 316-329 1 3159- 1 315-321 1 315024 1 31-48 1 3144 1 3143-3421 1 314-321 1 3-14 1 313e320 1 313-6 1 313-319 1 313-318 1 313-20 1 3130 1 3-13 1 3126-3134 1 3-125 1 31237 1 311Y7 1 3119-3128 1 3118 1 3115-3120 1 311-335 1 311-322 1 311-319 1 311-316 1 3111 1 3110 1 310Y4 1 31096 1 3107 1 310-5 1 3102-3109 1 -31 1 30-year 1 30UTR-targeted 1 30UTR-directed 1 30th 1 30-September 1 30President 1 30-plex 1 30-mm-diameter 1 30mg 1 30-kb 1 30HU 1 30-gauge 1 30-fold 1 30e35 1 30-diaminoazobenzidine 1 30degree 1 30-and 1 309-e323 1 3098-3108 1 3098 1 3095 1 309-316 1 309-315 1 3093 1 309-29 1 3092 1 309-19 1 30-9 1 3085-3097 1 3084 1 308-313 1 3083 1 3082 1 307e 1 3079 1 3078-3084 1 3074 1 307-309 1 3073 1 30-72 1 3068 1 30-67 1 306-313 1 3056 1 3055-3065 1 305-326 1 305-312 1 305-311 1 305-309 1 3049703 1 3048-56 1 304-311 1 3041-3046 1 30391 1 30384 1 3038-3051 1 303-7 1 30-35 1 30341 1 303-310 1 30329 1 302905 1 302-8 1 3027-3039 1 3022 1 3020 1 301e314 1 3017 1 3016 1 3015 1 3014 1 301-338 1 301-308 1 3012-3023 1 -301 1 300e500 1 3009 1 3006-3008 1 300-400 1 3004 1 3003 1 3002 1 30017 1 3000rpm 1 3000-greengrocers-lost-in-last-decade 1 30009 1 3000-548 1 30001 1 30000 1 30- 1 2-yr 1 2-year-old 1 2-y 1 2XU 1 2x2 1 2x 1 2weeks 1 2ways 1 2vref 1 2vector 1 2University 1 2-tissue 1 2The 1 2T9 1 2-syllable 1 2Section 1 2-row 1 2-related 1 2R01EB003543-05 1 2promoter 1 2-positive 1 2-pill 1 2-phase 1 2PET 1 2Performance 1 2Pacific 1 2of 1 2Number 1 2nT 1 2-nitrobenzoic 1 2nen1T 1 2ne 1 2N 1 2mmwith 1 2-mm-diameter 1 2min 1 2Medical 1 2MBq 1 2M9 1 2-m 1 2L2C 1 2-kmwalktest 1 2k13 1 2k11Results 1 2K 1 2In 1 2ICERs 1 2However 1 2H2O 1 2-h 1 2groups 1 2G 1 2From 1 2Florey 1 2e3 1 2D-TTE 1 2-dimensional 1 2Developmental 1 2Despite 1 2Departments 1 2-Deoxy-2- 1 2Dental 1 2-days 1 2D-and 1 2-d 1 2CR-UK 1 2-component 1 2College 1 2-cm 1 2Center 1 2Camilo 1 2allele 1 2Ablynx 1 29-year 1 29Y31 1 29S-48S 1 2998 1 2994 1 2993-2996 1 299-306 1 2992 1 2991 1 2989 1 2988-2995 1 2985-92 1 2985783 1 2985 1 2984 1 2979Y86 1 2977- 1 2976 1 2974 1 297-304 1 297-303 1 297-302 1 2971 1 29-7 1 2969 1 29683-29688 1 2967-2969 1 2966 1 296-311 1 296-303 1 2962-2975 1 29-6 1 29-59-e29-64 1 2954 1 295-310 1 295-306 1 295-304 1 295-302 1 295-301 1 2949 1 2948-2955 1 2946-52 1 2943 1 293Y9 1 29-38 1 293-8 1 29-35 1 2935 1 29-3-300 1 29-33 1 2931e2935 1 29-31 1 293- 1 2928 1 29267-29280 1 292-304 1 292-296 1 2920-2928 1 2914 1 2913Y9 1 2912 1 2908 1 2907 1 2906 1 290-299 1 290-292 1 2902 1 2901-2911 1 2900 1 28th 1 28ng 1 28e31 1 28-day 1 28C 1 2894 1 289396 1 289-296 1 288-92 1 2889 1 2888 1 2886-2892 1 2884 1 2883-2891 1 287Y93 1 2879 1 2875 1 287-317 1 2873 1 2871 1 28692 1 2868 1 2867 1 2861-2867 1 2859-2869 1 2859 1 2858 1 285-7 1 285-6 1 2854 1 2853 1 285-291 1 284-99 1 2849-2854 1 2848 1 2847-2862 1 28467 1 28463 1 2845 1 2843Y52 1 284-330 1 284-289 1 28-42 1 2841860903061683 1 2839 1 2838620 1 28-37 1 283-6 1 2836 1 283-309 1 28-33 1 2833- 1 2833 1 283-293 1 283-291 1 2831-2838 1 2831 1 28-30 1 282-92 1 2829 1 2827 1 2825 1 2824 1 2822-2829 1 2821-9 1 2820 1 281Y93 1 281-9 1 2817 1 2815Y9 1 2814 1 2813 1 2812Y7 1 281-29-7 1 281-289 1 281-287 1 2812 1 2810 1 2809-2821 1 2809-2815 1 2809 1 28081 1 2807 1 2806 1 2805 1 2804981 1 280-287 1 280-281 1 2802-2804 1 -280 1 27-year-old 1 27mm 1 27medical 1 27gauge 1 27e29 1 279e282 1 279-91 1 2799 1 2796 1 2794- 1 2793-2806 1 279-285 1 2791 1 2782 1 277-83 1 277-82 1 277-290 1 277-286 1 277-285 1 277-283 1 27705 1 2769 1 276-82 1 276-81 1 2767-2782 1 2767 1 2765 1 2763 1 276-291 1 2762 1 2761 1 2760 1 27599-7570 1 2759 1 2755-64 1 27522761 1 2751Y9 1 274a 1 2749 1 27467 1 2746 1 27443 1 27441 1 2744 1 27-43 1 274281 1 2740-2750 1 27-39 1 2736 1 27-33 1 273-278 1 2732 1 2730-2735 1 27-29 1 2729 1 2719 1 2716-2725 1 2715 1 2714 1 2713-2733 1 271-283 1 271-277 1 2712 1 27-107 1 2708 1 2707-14 1 2704 1 2700-2 1 27-0 1 26Sortm9 1 26-hydroxylase 1 26e38 1 26e28 1 26e10 1 26AreviewbyCheema 1 2699 1 2693-702 1 2693 1 269-283 1 2691-2709 1 268-9 1 2686 1 2684-94 1 2680 1 267e281 1 2679-e2688 1 2679-2685 1 2675 1 2674-8 1 267-274 1 267-272 1 2671-2678 1 2670 1 266e271 1 2667 1 2666 1 2665 1 266-274 1 265-74 1 2654 1 265-29-3 1 265-278 1 265-276 1 265-274 1 265-267 1 2651 1 26506 1 2650 1 2646-2653 1 2642954 1 264-283 1 2641-6 1 2641 1 263e311 1 263-77 1 2635 1 26-33 1 263-276 1 263-273 1 263-271 1 263-270 1 263-266 1 26-32 1 2631-9 1 26318 1 2631-2639 1 26-31 1 2627 1 26253-26261 1 2622-2632 1 -262 1 261-bp 1 2619e2625 1 26-196 1 2619-26 1 261-269 1 261-266 1 2-610 1 260Y311 1 2609 1 26071-22072 1 2604 1 260-272 1 260-268 1 2600 1 -26 1 2-6 1 25thY75th 1 25mm 1 25-minute 1 25llof 1 25-hydroxylase 1 25-hydroxy 1 25-dihydroxyvitamin 1 25-cm 1 259Y68 1 259Y66 1 259-67 1 2593165 1 259-262 1 2591-2607 1 2590 1 2588Y605 1 258-62 1 2585 1 258-264 1 2581 1 25802589 1 2580 1 2578 1 257-67 1 257-63 1 2576-2586 1 2576 1 257-269- 1 257-264 1 2571 1 2570 1 256-color 1 2569-2579 1 2566 1 2563 1 255Y8 1 2559 1 2558 1 2557 1 2556 1 2555-61 1 2555512 1 2555 1 255-269 1 255-256 1 25-52 1 2551 1 25-50 1 2549-57 1 25461297 1 2545 1 2541 1 2538 1 253-64 1 253-63 1 2536-2547 1 25-36 1 25356 1 2535-2542 1 25-35 1 2534 1 253-264 1 253-262 1 253-260 1 253-258 1 25-32 1 2532- 1 25-29 1 2528-39 1 25-27 1 25-2430 1 252-255 1 2522 1 251Y8 1 2519 1 251-76 1 25-150 1 251-4 1 25-130 1 251-255 1 250-8 1 2507 1 2505003 1 2505001 1 2505 1 2503-9 1 250-259 1 250201000018C 1 24Y31 1 24S 1 24-point 1 24-kg 1 24-hydroxylation 1 24-gauge 1 24depth 1 2499 1 2497-2509 1 2497 1 249-55 1 249-50 1 2495 1 24944 1 249-254 1 2489 1 2487-93 1 2487- 1 2486-2497 1 2484 1 248-254 1 2480-2488 1 2478 1 2477-2483 1 247-52 1 2474 1 247-306 1 24682 1 2464 1 2463 1 246-252 1 246-250 1 245Y69 1 245Y55 1 24591756 1 2459 1 2455 1 2454 1 2452Watson 1 245-253 1 245-248 1 2452 1 2451 1 24-48 1 2446 1 2445-54 1 2443 1 243Y51 1 243e254 1 243-8 1 2438 1 2437 1 2434950 1 2434-2441 1 2433 1 243-256 1 243-251 1 2432 1 2431 1 24-30 1 24-28 1 24-27 1 2427 1 24269 1 24262 1 2425 1 2423-2432 1 242-250 1 242-244 1 2421 1 2419375 1 2419 1 2418 1 241711 1 2413 1 241-248 1 241-247 1 2412-2414 1 24121 1 2412 1 24117 1 2411 1 2410Y7 1 2410Y4 1 2410 1 -241 1 2408-2416 1 2408-16 1 2404-2410 1 2403362 1 2403-2415 1 240-3 1 2403 1 24- 1 23Y30 1 23e74 1 2397964 1 2397 1 23960 1 2396 1 2395 1 2394 1 2393S-2400S 1 239-259 1 239-255 1 239-243 1 2391404 1 2391-2402 1 2390 1 238e243 1 2388 1 2385-2400 1 2381e2394 1 23-8 1 2378 1 23770741 1 2376 1 2373-80 1 23736-23754 1 237-264 1 237-239 1 2370-2375 1 -237 1 2366-76 1 2364 1 236-243 1 2360 1 2358- 1 2358 1 2357 1 235-56 1 23556 1 235-42 1 23542 1 2353-8 1 235-239 1 235-237 1 -235 1 23487015 1 2347915 1 2345-52 1 2345-2352 1 2343 1 234-238 1 234-2005-370011C 1 2341 1 2339-2348 1 23385273 1 2337-46 1 2334816 1 2334 1 23336270 1 23336226 1 233-240 1 233-239 1 2329 1 23275 1 23271 1 232600 1 23260 1 2324 1 23227 1 232-243 1 2319 1 2316-22 1 23159171 1 2315 1 2314 1 2313Y8 1 231-236 1 2311-2322 1 2307 1 2306 1 2305 1 2304 1 23034020 1 2302 1 2301-2306 1 2301 1 2300 1 23-0 1 23- 1 22R-hydroxycholesterol 1 22R-dihyroxycholesterol 1 22R 1 2-2individuals 1 2-2-Hb 1 2-2genotype 1 22-gauge 1 22g 1 22e24 1 229e238 1 22981-22988 1 2297740 1 2296-2314 1 22961 1 2295 1 2294 1 229-36 1 229-257 1 22908 1 228-38 1 2283-2301 1 22831-22838 1 2283 1 228-236 1 2281-2288 1 22810088 1 2280-2290 1 2278Y82 1 22760445 1 22737190 1 2273 1 227-246 1 227-230 1 22717142 1 2271-2277 1 22689807 1 22655 1 2264-2273 1 2264 1 226-244 1 2261Y74 1 2260-2267 1 225Y37 1 22592 1 22584 1 2258-2259 1 225-8 1 22570331 1 225-64 1 2256-2266 1 2256 1 2255 1 225-232 1 224Ra 1 224e232 1 2249-59 1 2249 1 2245 1 2244-2250 1 224-38 1 2243-53 1 22434639 1 2243-2251 1 22431676 1 224-239 1 22414-22425 1 22413 1 2241-2262 1 22411831 1 22406 1 22403-22413 1 2239-2248 1 2237-49 1 2237 1 2235-2241 1 2235 1 22338098 1 2232 1 22-31 1 2231 1 222e229 1 2229 1 2228 1 22262-22277 1 2226 1 2225 1 2221 1 -222 1 221per 1 2218-2223 1 22173842 1 2214 1 221-225 1 221-223 1 2211 1 22108094 1 2210 1 2208-2219 1 22080324 1 22071706 1 22053899 1 22035958 1 2203-2206 1 2203 1 2202-2210 1 2202 1 21-month 1 21mm 1 21e24 1 21e2 1 21-derived 1 21Catalan 1 2199-208 1 21967609 1 2195-2222 1 2195-2207 1 21938-21942 1 21933986 1 21-93 1 2193 1 219-24 1 219-226 1 21912398 1 21878621 1 21877749 1 2187-2198 1 2186751 1 21862724 1 2186-2191 1 2185 1 21829 1 218-224 1 217A 1 21790294 1 2178-2184 1 2177 1 21764796 1 21757653 1 2175-2188 1 2175 1 21749361 1 21747945 1 21747291 1 217-31 1 217-233 1 217-220 1 2168 1 2166 1 2164-2171 1 2163 1 2162535 1 216-222 1 21605817 1 -216 1 2158-2177 1 2158 1 215-746-4488 1 2157 1 2156e2161 1 21569519 1 215-573-7173 1 2154 1 21532169 1 2152 1 2149-2157 1 2149 1 2148-50 1 21478264 1 21475195 1 2146 1 2144-2149 1 21442098 1 21441817 1 21422323 1 21421727 1 21411618 1 2140 1 21-4 1 213Y9 1 213Y7 1 21-39 1 21328671 1 21-32 1 2131-2135 1 213015 1 212Pb-labeled 1 21293-21307 1 2128 1 2127 1 21242 1 21222 1 212-214 1 21210114 1 211Y8 1 211At-labeled 1 21190973 1 21174007 1 2114 1 2113-2117 1 211-28 1 2112 1 2110 1 210e215 1 210961 1 2109-2123 1 21091537 1 2108-2129 1 2108 1 2107 1 21059658 1 2105-2108 1 210-225 1 210-2 1 2101-2107 1 21-0 1 20z 1 20-year 1 20xg 1 20with 1 20-to 1 20Thistrial 1 20th-century 1 20special 1 20Sheet 1 20revised 1 20report 1 20on 1 20needs 1 20-min 1 20mandates 1 20lg 1 20-km 1 20-item 1 20intox 1 20informat 1 20FS 1 20form 1 20for 1 20Fact 1 20e30 1 20Disorder 1 20Delivery 1 20-day 1 20-cm 1 20children 1 20brie 1 20Anxiety 1 -20a 1 20a 1 209e218 1 209-e217 1 2098 1 20972103 1 2097-102 1 2096-2106 1 2095-2104 1 2095 1 2094507 1 2094 1 20936711 1 2093-2098 1 2093 1 209-219 1 209-218 1 209-213 1 209-17 1 209-13 1 2091-2106 1 208Y13 1 2089-2096 1 20892 1 2088-2093 1 20871495 1 2087 1 2086-94 1 20862423 1 2083-2089 1 20818875 1 208-13 1 208048 1 2080 1 2079 1 2077-2088 1 2076 1 2075-2080 1 2075 1 2074 1 207-34 1 2073-2099 1 20727041 1 20726 1 20724529 1 207-221 1 207-215 1 207-212 1 2072 1 20710 1 2071 1 2069-2077 1 2069 1 2064-9 1 2064-2089 1 20638297 1 20635943 1 20624989 1 206-24 1 2057 1 20554737 1 2055 1 205-27 1 205-228 1 205-217 1 205-213 1 205-211 1 2052 1 20518 1 20516-20534 1 20-5 1 2049-58 1 2049- 1 2048-57 1 2048-2051 1 2047 1 204-6 1 20452975 1 204-211 1 204-209 1 204-208 1 2042 1 20415560 1 20415480 1 20413-20422 1 2041-2048 1 20410913 1 203Pb-labeled 1 203Pb 1 20392884 1 2039-2045 1 20391522 1 20388508 1 2038 1 2037-2051 1 20371621 1 20371614 1 203-7 1 2035-2042 1 20-35 1 2032-2044 1 203-214 1 203-211 1 203-206 1 2031 1 20-30 1 202e218 1 20-27 1 2027 1 2025-33 1 2022-2031 1 20220206 1 2022 1 2021-2025 1 202-11 1 2021 1 20203061 1 20-2 1 201e211 1 2019-36 1 20185811 1 20177011 1 2015e2028 1 2015-2020 1 2014update 1 2014-annual-meeting 1 2013zzts101 1 2013Available 1 2013Accepted 1 2013-3948 1 2013-2075 1 2013-2016 1 2013-1941 1 2013-1766 1 2013-1717 1 20130422 1 20126381 1 20124480 1 20122014 1 20122013 1 201-211 1 201210 1 2012- 1 2011JQ014 1 20112013 1 2011-12 1 20110162110026 1 201-10 1 20107 1 2010-2014 1 20102014 1 2010-11 1 2010061 1 201004 1 200Y5 1 200W 1 200nt 1 200-millisecond 1 200-fold 1 200e300 1 200e20 1 2009-2014 1 20092013 1 2009-02 1 200873285 1 20084 1 2008-2017 1 2008-2010 1 200804 1 2007-present 1 2007CB512300 1 2007BAI17B05 1 20076 1 2007-2011 1 2007-2009 1 2006-2010 1 2005e2008 1 20055876 1 2005-2015 1 2004-present 1 20048208 1 20045562 1 20042525 1 2003-8 1 20031795 1 2003-12 1 2003-0434 1 20028830 1 200-227 1 2002-2006 1 2002-2003 1 200213 1 200-207 1 2001Y2008 1 2001e2007 1 2001b 1 20014 1 2001-2010 1 20012005 1 20010915 1 2000796565 1 2000-2012 1 2000-2005 1 200- 1 1yt 1 1yn 1 1-year-old 1 1Y4 1 1X 1 1vs 1 1-unit 1 1-um 1 1-to-2 1 1-time 1 1That 1 1t49 1 1Studies 1 1-step 1 1Signal 1 1Section 1 1-s 1 1s 1 1Research 1 1ratioto 1 1R43CA11492 1 1R01DK-077510 1 1R01 1 1q32 1 1Program 1 1-pill 1 1-phosphate 1 1-Ph 1 1p36 1 1p32 1 1p13 1 1-P 1 1of 1 1n 1 1Multiple 1 1-month 1 1Medical 1 1Mathematical 1 1-M 1 1lg 1 1-kHz 1 1kg 1 1K12HD052191 1 1K 1 1is 1 1-infected 1 1IKN 1 1-hz 1 1Hao 1 1e4in 1 1e4 1 1-dimensional 1 1Departments 1 1Dental 1 1-compartment 1 1-cm 1 1carbon 1 1Biochemistry 1 1Based 1 1Band 1 1Assistant 1 1-arm 1 1-amino-4-guanidobutane 1 1alpha 1 1A8 1 1A100 1 -1a 1 19th-centurynet-work 1 19th-century 1 19S 1 19Medical 1 19F 1 19e26 1 19Department 1 19C 1 19bp 1 -19b 1 19A 1 1999e2002 1 19-9-9-b 1 19-9-9-a 1 1999-2009 1 1999-2008 1 1999-2004 1 1999-2002 1 19-9-9- 1 1998-2006 1 1998-2005 1 1997-2000 1 19965709 1 1996-2011 1 19958894 1 19952321 1 19-9-5 1 1994-2005 1 1992-2004 1 199-218 1 199-209 1 199-208 1 199-204 1 199-202 1 19-9-2 1 1991-1998 1 19-9-1 1 1988628 1 1988-2009 1 1988-1994 1 19-88 1 19-87 1 1984-87 1 19-84 1 19837749 1 1983-1993 1 1983-1989 1 19-83 1 198-209 1 1981-1989 1 19-81 1 1980-82 1 19808019 1 19804533 1 1980-2008 1 1980-1997 1 1980-1986 1 19-80 1 1977-2007 1 19759116 1 19758188 1 19755679 1 1975-2004 1 19-75 1 19-74b 1 19-74a 1 1972-1976 1 197-208 1 197-206 1 197-200 1 19-72 1 197-199 1 19719372 1 1971-1975 1 19-70 1 196e204 1 19697389 1 19690041 1 19-69- 1 19686595 1 19-68 1 19-66 1 19659435 1 19651999 1 19647173 1 19646743 1 1963-73 1 1960-1994 1 19593156 1 1958 1 19571282 1 19552406 1 1954-1962 1 19520291 1 195-201 1 195-198 1 19519383 1 19506114 1 19502112 1 1949 1 1948-9 1 1945-56 1 1945 1 1943-1948 1 19-43 1 194-201 1 194-198 1 194-196 1 19416252 1 1938 1 19357707 1 1935-1989 1 19-34 1 1933 1 19324272 1 19321473 1 193-214 1 19-31 1 19308659 1 19-3 1 192e202 1 1929 1 19282839 1 19-28 1 1927 1 19-25 1 19249635 1 1924 1 19232103 1 192-202 1 192-198 1 192-197 1 1920s 1 1920-1928 1 19-20 1 191Y225 1 191Y200 1 19197558 1 1919 1 19188531 1 19167960 1 1915-1924 1 19150053 1 191-4 1 19128820 1 191-205 1 191-195 1 19116320 1 1911 1 19091888 1 1908-13 1 1908 1 19079893 1 1904-1914 1 1903 1 1902-7 1 19020323 1 190-193 1 19017593 1 1900 1 19- 1 18-yr 1 18-to 1 18th 1 18S 1 18It 1 18h 1 18F-PFB 1 18F-peptide 1 18F-para-fluorobenzoate 1 18-fold 1 18F-fluorobenzoate 1 18F-fluorination 1 18F-fiuorodeoxyglucose 1 18F-FB-NAPamide 1 18F-FBA-Lys11 1 18FDG 1 18-F 1 18F- 1 18D 1 18C 1 18B 1 -18a 1 18A 1 189e198 1 189-99 1 18997196 1 18997194 1 1895 1 1893-900 1 18930961 1 1893 1 1892-1903 1 1890 1 188Y96 1 188W 1 18867-18870 1 1886 1 18840786 1 1883Y90 1 1883-95 1 1883-1890 1 1883 1 18826 1 188-200 1 1882 1 18817 1 18801471 1 187Y204 1 18798613 1 187-95 1 1879447 1 1879-1886 1 1879 1 18789089 1 18787013 1 18779291 1 18779284 1 1877-91 1 1875-1891 1 1874 1 187-204 1 187-198 1 187-192 1 1871 1 1870 1 186e194 1 18687777 1 1868 1 1865Y70 1 1865-72 1 1864-1876 1 1863 1 186-196 1 186-192 1 186-191 1 18614511 1 1861-1872 1 1860 1 18599520 1 18594815 1 18593-18601 1 1859-1959 1 1857-1865 1 18563177 1 1852-1860 1 185-201 1 185-194 1 185-188 1 18512710 1 1851 1 1850- 1 18498552 1 1849-1861 1 1848 1 1847-55 1 1844Y9 1 1844-1854 1 1843-50 1 18424601 1 1842-1851 1 18-4-2002 1 184-191 1 1841-50 1 18413404 1 1841 1 18-40 1 183Y90 1 183Y9 1 183Y8 1 183Y7 1 1839Y46 1 1839 1 1838 1 1837-1847 1 1837 1 1836 1 18356 1 18351 1 18339444 1 1833 1 18325915 1 183-215 1 183-214 1 1832- 1 1832 1 18318882 1 18-31 1 1831 1 1830 1 18287273 1 18273720 1 18270681 1 1827 1 1826 1 1825-32 1 18250115 1 1825 1 18242584 1 18-24 1 1823Y7 1 18239174 1 18236042 1 1823 1 18227709 1 18-22 1 182-197 1 182-189 1 182-187 1 182-185 1 1821-8 1 18212285 1 18-21 1 18202747 1 18200064 1 18197608 1 18195335 1 18183429 1 1817-26 1 1817-1824 1 1816 1 18158948 1 1815-823 1 18153-18160 1 1815 1 1814-9 1 1814 1 181-190 1 181-187 1 1811-1820 1 1811 1 1810 1 1809 1 18087004 1 1807 1 18064-014 1 18050385 1 18050222 1 18038-240 1 1803-8 1 18032779 1 18021893 1 18021271 1 180-195 1 180-182 1 180-181 1 18015 1 1801-1808 1 -18 1 17th 1 17-segment 1 17p13 1 17e31 1 17D 1 17C 1 17-beta-estradiol 1 17Band 1 17Aand 1 17998097 1 1799-804 1 179-94 1 17992276 1 1799-1809 1 179-85 1 17982157 1 1795 1 17938C47-1372-636C-DDC920BA66CBEBE2 1 17929 1 179-190 1 179-186 1 17914 1 1791-1794 1 17906740 1 1790 1 178-86 1 1788 1 17873575 1 1784 1 17823525 1 1781 1 1780 1 177Lunanobodies 1 177Lu-DOTARe 1 177Lu-DOTA0 1 177Lu- 1 1776Y82 1 17763598 1 1775-1781 1 1775 1 1774 1 1772-1783 1 1772-1779 1 177-182 1 1771 1 17709956 1 176-9 1 17687130 1 17686825 1 1768 1 17678943 1 1767-1779 1 1767 1 17658 1 17651039 1 17649 1 17644541 1 1763 1 17629908 1 1762-1769 1 176-181 1 175ra29 1 17596155 1 17588738 1 1758 1 1755-8794 1 17553047 1 17550777 1 1755- 1 1754 1 1753- 1 1753 1 1752 1 175-190 1 175-182 1 1751 1 17504880 1 1750 1 1749-1755 1 17490963 1 1749 1 174-85 1 174-80 1 174-7 1 17456783 1 1743 1 174-191 1 174-180 1 174-179 1 174-173 1 1741-7 1 17406587 1 17401100 1 173Y82 1 17360153 1 17355229 1 17348700 1 17342112 1 1734-1744 1 173-185 1 17314970 1 1731-1743 1 1731-1735 1 17309999 1 17309939 1 1730-1737 1 172-patient 1 17299196 1 17-29 1 17287129 1 1728-1738 1 1728-1733 1 1727 1 17263791 1 1726 1 1725-89 1 1725-1789 1 1724-1731 1 17223877 1 1722 1 172-181 1 17210714 1 17204701 1 17204700 1 1720-30 1 1720 1 17199602 1 17187052 1 171-8 1 1717 1 1716-24 1 1716-20 1 1716- 1 1715 1 1714 1 1713 1 1712 1 171-180 1 171-179 1 171-175 1 17116835 1 170e177 1 17099194 1 17095717 1 1709-1725 1 1708Y13 1 1708 1 1707e1716 1 1707 1 17065638 1 1706 1 1705-1715 1 17051322 1 1704-1713 1 1704 1 1703-1712 1 170-177 1 170-175 1 1701 1 17004984 1 17-0 1 -17 1 1-7 1 16-yr 1 16-year-olds 1 16-year-old 1 16p13 1 16-month 1 16Gb0042 1 16Depart-ment 1 16controls 1 16-bit 1 169Y84 1 1699-1706 1 1699 1 1698 1 169-77 1 169-74 1 169-73 1 1696 1 1695-1703 1 16947627 1 16946190 1 1693 1 1692-9 1 1692-700 1 1692-1698 1 169-208 1 169-174 1 1691 1 16894 1 16884 1 1688 1 168600 1 1686 1 1685-95 1 1685-1695 1 1685 1 1684e1691 1 16848419 1 16835399 1 16832001 1 1683-1692 1 1683 1 16829692 1 1682 1 1681Y7 1 168-174 1 16816108 1 1681 1 16804070 1 1680-3 1 1680 1 168- 1 167Y83 1 167-77 1 167-76 1 1677 1 1676- 1 16755268 1 16735454 1 16714097 1 1671 1 -167 1 167- 1 166Y73 1 166Ho 1 1668 1 16673 1 16670765 1 1667 1 1666-1677 1 1666-1675 1 1666 1 16652376 1 1665-1670 1 16642650 1 1664 1 16631082 1 1663 1 16600945 1 165Y72 1 165Y71 1 1658 1 1657-62 1 16570024 1 1656e1660 1 1654-60 1 16542 1 1654 1 16537 1 1653337 1 165-171 1 1651 1 1650-1665 1 1649-1658 1 1649-1655 1 16491133 1 16490841 1 1649 1 1648-54 1 16472 1 16466997 1 1646 1 16459265 1 1645 1 16447239 1 16443 1 1642 1 1641-8 1 164-176 1 164-171 1 16399150 1 16394266 1 1638-1645 1 1638 1 1637-1659 1 1637-1645 1 163-71 1 1636 1 16359823 1 1635-41 1 16352668 1 1635-1639 1 1635 1 1634-42 1 16343026 1 1634 1 16330726 1 16330576 1 1633 1 163170 1 1631-48 1 1631-1648 1 1631 1 16300 1 1629Y31 1 16296 1 16290269 1 16284651 1 1627-1635 1 1627-1630 1 1627 1 1625-1633 1 1624 1 16236726 1 16228 1 1622 1 1621-8 1 16218 1 162-172 1 162170 1 16-21 1 16-20 1 161Y168 1 161-fold 1 1619-1625 1 1619 1 16182882 1 1618216187 1 1618 1 16166805 1 1616-24 1 1616-1625 1 161-6 1 16154288 1 1615-21 1 16142737 1 1614 1 16125-16138 1 1612 1 161-173 1 161-168 1 16112445 1 1611 1 160-fold 1 1609-1619 1 1607-1614 1 16061880 1 1606-15 1 160-5 1 1604 1 1603 1 1602-8 1 16025-16030 1 16023 1 1602-1606 1 16018 1 16003 1 1-600 1 16-0 1 -16 1 1-6 1 15th 1 15q13 1 15O-water 1 15O-positron-emission 1 15O 1 15ng 1 15Itisalso 1 15-fold 1 15Department 1 15-day-old 1 15998 1 15994969 1 15987473 1 1598-607 1 15982579 1 15977211 1 1597-603 1 1597-1598 1 1597 1 1596 1 15937315 1 1592-1599 1 159-191 1 159-170 1 15910175 1 1591 1 1590S-1596S 1 15902306 1 1590-1603 1 1590 1 158Y63 1 158e165 1 158e163 1 158A 1 1588-1597 1 1588-1594 1 15874146728 1 1587 1 15864276 1 1585-1595 1 1584-1591 1 1583- 1 1583 1 15828837 1 15826822 1 15820616 1 158-167 1 158-165 1 1581-1587 1 1581 1 1580-1588 1 1580-1581 1 15777247 1 15775-15786 1 1577-1585 1 1577 1 1576 1 1575 1 1574 1 15738954 1 1-573-882-6099 1 1-573-882-5635 1 15738055 1 1573-1578 1 1572-1577 1 15720203 1 1572 1 157-174 1 157-172 1 157-165 1 157-161 1 15711815 1 15709970 1 15709914 1 1570-1574 1 1570 1 156Y66 1 15699478 1 15694227 1 15692-700 1 1567 1 15632042 1 15630090 1 1562 1 156-166 1 1561-5 1 1561 1 1559-e1563 1 1558490 1 1557-62 1 15576057 1 1557 1 155-62 1 1556 1 15557509 1 15537682 1 15524 1 155-161 1 1551 1 15502083 1 1550-1556 1 1550 1 1-55 1 1549 1 1548-1556 1 154-80 1 154-8 1 15471839 1 154-7 1 15464393 1 1545-52 1 15443 1 1544-1550 1 1544 1 1541632 1 154-162 1 154-155 1 1541 1 1540800 1 153Y160 1 153B 1 1539- 1 1539 1 1538 1 1537-40 1 153-63 1 1536-1542 1 1536-1541 1 15361-15368 1 1535-58 1 1534-1536 1 15336 1 15334472 1 1533 1 1532-8 1 1532-6 1 1532-1536 1 1531Y40 1 1531-8 1 15317 1 15312 1 1530-42 1 1530-1532 1 1529Y36 1 15299056 1 15294 1 1529 1 15-28 1 15262693 1 15261 1 15-256 1 15254578 1 1525 1 15234930 1 15231679 1 1523-1525 1 1523 1 15-22 1 152-168 1 152-160 1 15213044 1 1520-1525 1 152002026 1 15-20 1 15195788 1 1519-1535 1 1519-1522 1 1517-1525 1 151-7 1 1516 1 15149-15169 1 1514-20 1 1514 1 1512 1 1511-9 1 151-160 1 151-157 1 15111519 1 15107844 1 1510-1517 1 1510 1 150mg 1 150e154 1 1509-1524 1 1504-1513 1 1504 1 1502Y10 1 1502 1 150-152 1 1501-1510 1 1501-1502 1 1501 1 1500-6 1 150012 1 150007 1 1-50 1 14-year-old 1 14-year 1 14-week 1 14q32 1 14NICE 1 14-month 1 14-gauge 1 14-day 1 14and 1 149Y59 1 149Pm 1 1499-505 1 1499 1 1498 1 14973076 1 14966267 1 149-59 1 1494-6 1 1494 1 1491-4 1 1490-1505 1 1490-1495 1 1-49 1 1487-1492 1 148-59 1 148-56 1 1484 1 14-8331 1 1483 1 1482 1 148-158 1 1481-1488 1 14805-14812 1 1480-1489 1 147B 1 147-67 1 147-51 1 1475 1 1474 1 14734683 1 1472 1 147-150 1 1471-2407-6-273 1 1471-2202 1 14703-8 1 1470 1 146e150 1 14682-14687 1 1467 1 146-57 1 1464-6 1 1464-1472 1 1463- 1 146-152 1 146-150 1 14609-14613 1 -146 1 -145and 1 145-and 1 145-9 1 1458 1 14578303 1 1456-9 1 145-519 1 1453-1458 1 14530467 1 14529 1 14524 1 1452-1456 1 1452 1 14-513-63 1 1451 1 1448-53 1 1447-54 1 14463-14480 1 1445 1 1444 1 1442-50 1 144-25 1 1441-53 1 1441-1454 1 1441-1447 1 -144 1 143e162 1 1439-1441 1 143-9 1 1437-72 1 1437-1442 1 1437 1 1436Y41 1 1436 1 1435-1446 1 1435-1438 1 1433-40 1 1432-7 1 1432-1436 1 1432 1 1431Y41 1 143-153 1 143-150 1 1431-1439 1 1431 1 142e148 1 1428-32 1 14275 1 14-27 1 1426 1 142-54 1 1425-1427 1 1425 1 1424 1 14238 1 1423-1436 1 14229 1 1422-30 1 1422 1 142-149 1 142-148 1 1421-1429 1 1421-1425 1 1420 1 141e147 1 141e146 1 1419-1433 1 1419-1431 1 14-19 1 14-18 1 1418 1 1417-24 1 1417-1425 1 14169 1 14160 1 141-6 1 1415-1422 1 1415 1 14143 1 14138 1 1413-1420 1 14131311 1 1412 1 1411-8 1 141-155 1 141-143 1 1411-1422 1 1411 1 1410-1414 1 140-to 1 140e148 1 1407-1416 1 1407 1 1406-0408-CT-20481 1 1405-22 1 140-50 1 1404 1 1403-9 1 14030385 1 14030361 1 140-150 1 140-148 1 1400Y4 1 1-40 1 13-year 1 13These 1 13th 1 13q14 1 13-item 1 13Give 1 13e22 1 13992 1 1399 1 13987 1 1396 1 1395-402 1 1395-1407 1 1395 1 1394 1 1392-1400 1 1392-1399 1 1-392 1 139086 1 1387 1 1385-1392 1 138-48 1 138-188 1 138-148 1 1-38 1 137Y142 1 1379 1 1377-1386 1 1377-1384 1 1377 1 13761067 1 1376 1 1375-1397 1 1375-1381 1 137-45 1 137-43 1 1374-1377 1 1374 1 137-152 1 137-148 1 137-140 1 1370-4 1 136and 1 1368-1375 1 1365-2648 1 1363 1 13624-13636 1 1362-4 1 1362-1371 1 136-141 1 13-6 1 135e152 1 135e141 1 1359-63 1 1359-1361 1 -1357 1 1357 1 1356-1362 1 135-57 1 1354-1367 1 1354-1357 1 13519 1 13518 1 1351-7 1 1350-1367 1 134e139 1 13493104 1 1348016 1 134-8 1 1347-1370 1 1347 1 13469 1 1346 1 13454 1 1345-1352 1 134-42 1 134-149 1 134-141 1 13413-13419 1 1341-1381 1 1341-1347 1 1341 1 1340 1 133e135 1 133945 1 1339-1351 1 1339-1346 1 1-338 1 1337-1339 1 1337 1 13367-75 1 13361344 1 133-6 1 133-51 1 133-40 1 1333-41 1 1333-1349 1 1333 1 1332 1 1331-9 1 13313-13318 1 13-31 1 13305-13310 1 13295 1 1329-32 1 13292-13297 1 13290 1 1329 1 132862 1 13-28 1 1325670 1 132-5 1 1324-43 1 1323Y32 1 1323-27 1 1323-1332 1 13-22 1 132-156 1 132-144 1 1321-1333 1 131I-Tyr2 1 131I-labeled 1 131I-iodobenzoate 1 131I-IB-Mal-D-GEEEK 1 131e143 1 1319-1333 1 1318-1332 1 131-8 1 1317-1329 1 13-17 1 13167 1 1315 1 131-49 1 131-46 1 13143621461 1 1314-22 1 13-14 1 1314 1 131-137 1 1310-8 1 1310-20 1 1310-1315 1 130e147 1 -130a 1 1309 1 1307-16 1 1307-1314 1 1306- 1 13059 1 13058 1 13053 1 130-50 1 13040 1 13032 1 13027 1 1302 1 13015 1 13-0142 1 1301-1308 1 13010 1 130-1 1 13001 1 1-30 1 12-year 1 12-wk-old 1 12weeks 1 12th 1 12-O-tetradecanoylphorbol-13-acetate-induced 1 12o 1 12-nm 1 12-mm 1 12-fold 1 12Escola 1 12-dimensional 1 12-bit 1 12B 1 12A 1 129Sv 1 1299-1301 1 12975461 1 1297-300 1 1297 1 129-5-3101 1 1295-303 1 1295-301 1 12946657 1 12942 1 12941762 1 12940 1 129-39 1 12937 1 12925395 1 12920303 1 129-143 1 129-135 1 1291-1302 1 1291-1297 1 1290-9 1 12909 1 12902420 1 12901 1 1-29 1 128-slice 1 128-channel 1 12896 1 1289 1 1288 1 1287-93 1 1287-1293 1 12861015 1 1286 1 12852 1 1285 1 12845 1 1283-7 1 12834-12839 1 12814-8 1 1281 1 1280s 1 12804 1 -128 1 12794060 1 1279-1286 1 1279-1284 1 1279 1 12788299 1 1278 1 12776 1 12767391 1 12763 1 1276-1283 1 1276 1 12758-12763 1 1275-1286 1 12751285 1 12750308 1 12742 1 1274-1279 1 1274 1 1272 1 127-136 1 127-133 1 127-131 1 1269-1284 1 1267 1 1266-71 1 1264-1270 1 1264 1 12639 1 126-30 1 12627 1 1262-1273 1 12621007 1 1262 1 1261-71 1 1261-1268 1 1261 1 -126 1 125-labeled 1 125I-Tyr2-NDP-MSH 1 125I-labeled 1 125I-IBA 1 125e250 1 1259-65 1 12574 1 12572 1 12571855 1 12571 1 1256-64 1 125-600 1 12551878 1 12544 1 125430 1 125429 1 1254-1260 1 1-254 1 1254 1 12535 1 1253 1 1-252 1 12517786 1 125-132 1 125-127 1 1251-1262 1 12507967 1 1-25 1 124I-SGMIB-Nanobody 1 124I-SGMIB 1 124I-huA33 1 124I-A33 1 12497 1 1249-1258 1 1248-51 1 1248 1 1247-55 1 124-7 1 1247 1 12468522 1 12466-12470 1 1245-1250 1 1244Y51 1 1244-1245 1 1243-1247 1 1242-1253 1 124-132 1 1241-1246 1 123I-SGMIB-Nanobody 1 12399266 1 1239-43 1 1239-1244 1 1239-1243 1 12377296 1 1237-1246 1 12350-12361 1 1234 1 1233-1243 1 1233 1 123-133 1 123131 1 122Y34 1 12298 1 1229-1239 1 1229-1238 1 1229 1 12-283-SDR 1 1227-8 1 12274 1 1226-32 1 122-6 1 12254 1 1225-1232 1 12-25 1 1225 1 1224-1231 1 12241 1 12-24 1 1223-32 1 1222-1227 1 12-22 1 12216078 1 12210 1 12209356 1 1220-1224 1 1220 1 121ra20 1 1219Y21 1 121974 1 121-9 1 1219 1 12187 1 12181222 1 1218 1 12178 1 12172 1 1217-1227 1 12163699 1 121-6 1 1216 1 12152671 1 1215- 1 1214-9 1 12144 1 12127 1 121-150 1 121-140 1 12107834 1 12104 1 12-10311 1 1-21 1 120e125 1 120-and 1 12086490 1 1208 1 1207-1211 1 12050328 1 1205 1 12034003 1 12033 1 1203-1212 1 1203-1208 1 120-132 1 1201-1209 1 1200e1700 1 12-0 1 11-year 1 11Y12 1 11-syllable 1 11-residue 1 11q13 1 11K038 1 11-item 1 11IQ 1 11drug-web 1 11degree 1 11D 1 11C-DTBZ 1 11C-dihydrotetrabenazine 1 11C- 1 11betaHSD 1 11B 1 11A 1 1199-1211 1 1199-1208 1 1199-1202 1 1198 1 119-7-1206 1 1197-1204 1 11965608 1 1193-200 1 11928769 1 119-128 1 119-126 1 1191255879384 1 1191-1207 1 1191-1193 1 11902988 1 1190-1198 1 1190 1 118GG 1 118AA 1 1189-1194 1 11888529 1 11881930 1 1188-1203 1 1187-1197 1 1185Y7 1 1185 1 11842383 1 11836153001 1 1183 1 1182-8 1 1182-1188 1 118-21 1 11818582 1 1181-1188 1 1181 1 1179-1182 1 1-179 1 1179 1 1178-82 1 11786270 1 1178-1181 1 1177Y83 1 1177e1184 1 11778mitochondrial 1 1177-84 1 1176-84 1 11752084 1 1175-1181 1 11739174 1 1173-1182 1 1172-1187 1 117-128 1 117-118 1 11711678 1 11710239 1 1-17 1 1169-1173 1 1168 1 1166-75 1 1165-1174 1 11621166 1 1162023 1 1162 1 116-123 1 116-120 1 1161-1170 1 1161 1 116010 1 1160 1 1-16 1 115Y9 1 1159-1168 1 11588052 1 1158-1171 1 11578897 1 1156-8 1 1156-61 1 1155-1161 1 1154-62 1 1154 1 115-30 1 11-53 1 115-26 1 11523 1 115-122 1 115-120 1 1151 1 1150-1157 1 1-15 1 1148-1155 1 1148 1 1147-55 1 1147-1158 1 1147 1 11460005 1 1145-1155 1 1144-53 1 1144-1152 1 1144 1 11438-11452 1 11433435 1 1142 1 114-117 1 114-116 1 1140-1143 1 1140 1 113Y8 1 1139-46 1 1139-1146 1 1138115987129 1 11372-11377 1 11368702 1 1135-1141 1 11342196 1 11340564 1 1134 1 1133S-1137S 1 1133-1140 1 1132-1144 1 -1132 1 11315190 1 113-140 1 113-124 1 1131-1139 1 1130-9 1 11306606 1 11301402 1 11297536 1 1128-134 1 1128-1134 1 112-8 1 11274650 1 1127-34 1 112-7 1 1127 1 11263833 1 11259795 1 1124-1132 1 11238295 1 11236029 1 1123-6 1 1122Y8 1 11227 1 1122-1127 1 11-22 1 11216523 1 112-144 1 112-124 1 112-119 1 1121 1 11209111 1 1-120 1 111In-DQTA-NAPamide 1 111In-DQTA-MSHQCT 1 111In-DQTA-MSHocT 1 111In-DOTA-Rhenium 1 111In-DOTA-MSHQCT 1 111In-DOTA-MSHOCT 1 111In-DOTA-CycMSH 1 1119-1121 1 1117-1127 1 11170 1 111-7 1 11165 1 1116-1120 1 1115-1121 1 11-15 1 111-5 1 1114 1 1113-20 1 1113-1129 1 111-24 1 111-125 1 111-112 1 110-to 1 110-km 1 1-10-JF-50 1 1109-1114 1 1108-1114 1 1108-1111 1 1107e1116 1 11059756 1 1103 1 11025 1 11020 1 110180 1 11016764 1 110-128 1 1101-1109 1 1100-6 1 1-10 1 11-0 1 -11 1 10-yr-old 1 10-week-old 1 10-week 1 10-to 1 10-times 1 10-tetraazacyclododecane-1 1 10-tetraacetic 1 10-syllable 1 10-station 1 10Signaling 1 10-point 1 10pg 1 10mL 1 10minutes 1 10-HU 1 10GRNT3900019 1 10e12 1 10CRP3670014 1 10994727 1 1099-1114 1 1097-1111 1 1097-0142 1 10969792 1 10968 1 10963 1 1095e1108 1 1095 1 1094-1103 1 109-3-1117 1 1092-102 1 109-122 1 10911025 1 10-91 1 10902 1 10901049 1 1089-1098 1 10890468 1 1088e1092 1 1088-94 1 108-8639 1 1087-101 1 1087 1 1086-95 1 10858549 1 10843 1 1084 1 10839 1 10836 1 1083 1 10818 1 108-155 1 10813 1 108-12 1 108-118 1 1081 1 10801 1 107patients 1 10790 1 10777-019 1 1077 1 10759 1 10750 1 1075 1 1074-1077 1 1074 1 1073-9 1 1073-74 1 1073 1 10724204 1 107-13 1 107-115 1 107113 1 107-109 1 1070 1 10-7 1 106981-001 1 1067-76 1 1067-1077 1 1067 1 1065-73 1 106-211IU 1 1062-1071 1 106-118 1 106-110 1 106-11 1 1060081-1060088 1 105-kDa 1 1059-1068 1 1059-1064 1 1059-1062 1 10587108 1 1058493 1 105-8461 1 10577 1 10573 1 1057-1059 1 1055-9965 1 1055-8 1 1053-64 1 1053-60 1 105-16 1 10514439 1 10514 1 10513 1 105-112 1 10511059 1 10509 1 104M 1 104e122 1 1049-1058 1 1048-54 1 10484355 1 1048-1052 1 1047-55 1 1047-1061 1 1047-1058 1 1047-1053 1 1046e1051 1 1043-1046 1 1042 1 10416 1 1041-1074 1 10411 1 10402 1 10401196 1 1040 1 103Y8 1 10396014 1 10392 1 103-9 1 1038-46 1 10371227 1 10365 1 103648 1 10360 1 1033-5 1 10334 1 10330 1 1033 1 103-129 1 103-113 1 1031-1046 1 10300728 1 1030 1 1029538 1 10-29 1 1029- 1 1029 1 1028-1033 1 1027-32 1 1026e1030 1 1026-1031 1 1025-1034 1 102503 1 1024 1 1022637 1 102-254 1 10224-10230 1 1022325 1 1022-32 1 1022-1029 1 1022-1028 1 10212 1 102-112 1 1021-1026 1 102-110 1 102-109 1 10198 1 10-19-0984 1 10187 1 1018-1022 1 1018 1 10172 1 1017-1022 1 10163 1 101610 1 10155 1 101530 1 1015-1023 1 1015 1 101473 1 10139 1 10135 1 10-13 1 10126902 1 1012-1021 1 101-20 1 10-12 1 101-112 1 1011-1014 1 101-110 1 101-109 1 101-106 1 101-102 1 10101 1 100-year-old 1 100Y8 1 100s 1 100repeated 1 100-point 1 100p 1 100nM 1 100mm 1 1009-1086 1 1009 1 1008307 1 1008-15 1 1008-1015 1 1006e1018 1 1006440 1 1006-1010 1 1006 1 100-5 1 1004-1011 1 10021 1 100200 1 1001-1008 1 1001-1007 1 100-10 1 1000A-scans 1 100016 1 1000100 1 10000XL 1 10000times 1 10-0 1 10- 1 0x 1 0Vascular 1 0SZ 1 0SR 1 0rtenblad 1 0QT 1 0o 1 0e98 1 0e9 1 0e74 1 0e36 1 0e10 1 0c 1 0BA 1 0b013e318213fefb 1 0b013e3181c5cd5a 1 0993 1 099 1 098 1 0974 1 095103 1 095 1 0941717 1 09-1107 1 09-072257 1 090030 1 09-0 1 0890-8567 1 0869 1 086 1 08500 1 0845 1 0830 1 083 1 08-168 1 08036 1 080 1 07-60-21-KARI 1 07313 1 072639 1 07261 1 0715 1 07121 1 0710 1 070505 1 0700 1 0692 1 067155 1 0662 1 0-66 1 06520-8048 1 06511 1 065 1 064 1 06-05 1 05-point 1 05e0 1 059 1 0578 1 0574 1 0569 1 0568 1 055 1 05401 1 05374 1 0529 1 05-240 1 050201 1 05-0 1 04710 1 0469 1 0437 1 0413 1 041215 1 041213 1 041-001 1 0400 1 04-0 1 039586 1 0367 1 0359 1 03550 1 0333102413500727 1 033001 1 0324 1 032 1 031973 1 03-02 1 03007995 1 030 1 0290 1 02841860903483676 1 02-7 1 025931 1 025918 1 0-255 1 0251 1 02505 1 024413 1 024215 1 023166 1 0230 1 0228 1 0223 1 02215 1 0214 1 02110 1 01-point 1 01N 1 01EO1302 1 019-19741 1 01780 1 0178 1 0176 1 01715 1 01702-5803 1 0158 1 0156 1 01-2013 1 01-2012 1 0118 1 0103 1 01000 1 0-10 1 01-0 1 0-1 1 00Molecular 1 00e16 1 00default00 1 0099 1 0098 1 0093 1 0078636 1 0077 1 00767 1 0060336 1 0058 1 0057753 1 00576 1 0054 1 004873-14 1 0047 1 00421 1 0038 1 0036 1 0030 1 00271-8 1 0027 1 0024 1 0021 1 0020 1 0017 1 001437 1 0014 1 000WTP 1 000s 1 000g 1 000e40 1 000-Dalton 1 000-8 1 00077 1 00074-6 1 000-6 1 0006 1 0005 1 00042-7 1 00036- 1 0003-4932 1 0003 1 00021-X 1 0001-0 1 00003-8 1 00001 1 00000-0001 1 0000000000000628 1 0000000000000480 1 0000000000000359 1 0000000000000305 1 0000000000000288 1 0000000000000276 1 0000000000000133 1 0000000000000132 1 0000000000000124 1 0000000000000121 1 0000000000000058 1 0000000000000050 1 0000000000000049 1 0-0 1 0-